Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABK3829.5                            8 END     8          17      100                LOC495293 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012074013 Xt7.1-CABI13530.3 - 45 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABI13530.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGCATATTCCACTGACTTACGTAACCAGAAAGTGTAGTGGTATTGAACCTCAGTGTGACAACATCTATCTCCTGAAAGAGGTTACAGGCAGAATAAATGTGTCAAGTGAGTTCCCATGGGTGAAGTTCAATGTCAACATGACTGGATACTATATAGTTGACTATGGTGCTGACGGCTGGGATGCCCTCATAAAGCAGCTTCTCAGGGATCACACAGTGCTACATTCCAGTGACCGAGCCAATCTGATCCATGACATATTCATGCTTGCAGGTGTGGGGAAGGTCCCTCTGGCAAAGGCTTTTGAACTGCTTGGGTACCTTGTAAATGAAACAAACAGTGCCCCCATCACCCAAGCTTTGAACCAGTTTTACCATATTCATGGTATCTTATTAAAGCGTGGCTTGGATGAGCTGTCCGACAAAGTTATGGAACGTGGTTTAAAACTACTCTCTAATCTTATCAACCAAACATGGGAAGATGAAGGAACACTGGCTGAACGAGAATTGAGATCCTCTCTCTTGGATTTTGCCTGTTTAAGTGGCCTTCAAAGTTGTGTAGAAAAAGCAACAGAGCTATTTAATATTTGGCGTCTTAATAACACAAGAATTCCCACTGATGTCATGAAGGTTGTGTTTAAGGTTGGAGCAAAAACTGCAGAAGGCTGGGCCTTTCTCTGGGATAAATATACAACTTCCCTCTATGAGACAGAAAAGAGGAAAATTCTTGAAGCTCTTGCAAGTACAGATAATGGCCGAAAATTACAGTGGTTGATGCAAGAGAGTCTTGATGGGGGCTTGATAAGATCTCAGGAGCTGCCTGCTGTTTTAGGATTCATTTCTAAAGGTTCACCTGGGTATTTGCTGGCCTGGGAATTTGCCAAGCAGAACTGGGATTTGATAACTCAGAAGTTCATGCCTGGATCTTTTCCTATACAGAGTATCGTTTCCACGACTACCTACCACTTTTCCACTGATACCCATTTAAATGAGGTTATTGCATTTTTTAATTCAACCAAGGGGCCGAGAAATGTGGTGCGTCAAAGAGGCCGTGGAGACAATCAAGTTTAACATTGAATGGATGAAAAACAACCTTGAGACAAGCCTTAAGACCTGGTTGCAGTCCTCACACTAGAATTTCCATGTTCCAGAGAACTTCTTACGTTGAACTGTTGCTCTGTTTCTTTTGCAGAAGCGAGGGTGGAAATTGCAACACTGTTTGCACTATTTGAGTGTTTTTGACAGCTCAGGGCGAAAAACAAAAAAAAAATTCCTCTTTTTTTTTTTTTTGTGTGCGAATGCTGAGGAGCGAGAGTGTATTTATTACAAAGTGTGGTAATCACCACATTATTGCCATAAAGCTGTAGAGCGATCCAAACTCCCTCTGTATTACACTTTGTTAAAAAAACACTGTATTCCAGTTGCTTGTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGGCTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATATAAAGTTTTTTTGTA
                                                  Xt7.1-CHK-1008226278                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTCCACTGACTTACGTAACCAGAAAGTGTAGTGGTATTGAACCTCAGTGTGACAACATCTATCTCCTGAAAGAGGTTACAGGCAGAATAAATGTGTCAAGTGAGTTCCCATGGGTGAAGTTCAATGTCAACATGACTGGATACTATATAGTTGACTATGGTGCTGACGGCTGGGATGCCCTCATAAAGCAGCTTCTCAGGGATCACACAGTGCTACATTCCAGTGACCGAGCCAATCTGATCCATGACATATTCATGCTTGCAGGTGTGGGGAAGGTCCCTCTGGCAAAGGCTTTTGAACTGCTTGGGTACCTTGTAAATGAAACAAACAGTGCCCCCATCACCCAAGCTTTGAACCAGTTTTACCATATTCATGGTATCTTATTAAAGCGTGGCTTGGATGAGCTGTCCGACAAAGTTATGGAACGTGGTTTAAAACTACTCTCTAATCTTATCAACCAAACATGGGAAGATGAAGGAACACTGGCTGAACGAGAATTGAGATCCTCTCTCTTGGATTTTGCCTGTTTAAGTGGCCTTCAAAGTTGTGTAGAAAAAGCAACAGAGCTATTTAATATTTGGCGTCTTAATAACACAAGAATTCCCACTGATGTCATGAAGGTTGTGTTTAAGGTTGGAGCAAAAACTGCAGAAGGCTGGGCCTTTCTCTGGGATAAATATACAACTTCCCTCTATGAGACAGAAAAGAGGAAAATTCTTGAAGCTCTTGCAAGTACAGATAATGGCCGAAAATTACAGTGGTTGATGCAAGAGAGTCTTGATGGGGGCTTGATAAGATCTCAGGAGCTGCCTGCTGTTTTAGGATTCATTTCTAAAGGTTCACCTGGGTATTTGCTGGCCTGGGAATTTGCCAAGCAGAACTGGGATTTGATAACTCAGAAGTTCATGCCTGGATCTTTTCCTATACAGAGTATCGTTTCCACGACTACCTACCACTTTTCCACTGATACCCATTTAAATGAGGTTATTGCATTTTTTAATTCAACCxAxGxGCCGAGAAATGTGGTGCGTCAAAGAGGCCGTGGAGACAATCAAGTTTAACATTGAATGGATGAAAAACAACCTTGAGACAAGCCTTAAGACCTGGTTGCAGTCCTCACACTAGAATTTCCATGTTCCAGAGAACTTCTTACGTTGAACTGTTGCTCTGTTTCTTTTGCAGAAGCGAGGGTGGAAATTGCAACACTGTTTGCACTATTTGAGTGTTTTTGACAGCTCAGGGCGAAAAACAAAAAAAAAATTCCTCTTTTTTTTTTTTTTGTGTGCGAATGCTGAGGAGCGAGAGTGTATTTATTACAAAGTGTGGTAATCACCACATTATTGCCATAAAGCTGTAGAGTGATCCAAACTCCCTCTGTATTACACTTTGTTAAAAAAACACTGTATTCCAGTTGCTTGTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGGCTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATATAAAGTTTTTTTGTATAATGT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     5     6     6     6     7     7     7     7     7     7     7     7     7     7     7     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     9    10     9    11     9    11     9    11     9    11     9    11    10    12    10    12    10    12    10    12    10    13    10    13    10    13     9    12     9    12     9    12     9    12     9    12     8    11     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     6    10     6    10     6     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     3     8     2     7     2     6     2     6     2     6     2     6     2     6     2     6     2     6     2     6     2     6     2     5     2     6     2     6     2     6     2     6     2     6     3     7     3     7     3     7     2     6     2     6     4     7     6     8     7     8     8    10     8    10     9    11    10    13    12    16    10    20    13    20    13    20    17    22    20    23    19    23    20    23    23    26    23    26    23    26    23    26    23    26    24    26    24    26    23    25    25    26    25    26    25    26    25    26    25    26    25    26    25    26    26    26    26    26    26    26    26    26    26    26    27    27    27    27    27    27    27    27    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    27    28    27    28    27    28    27    28    27    28    27    28    29    30    29    30    29    30    29    30    29    30    29    30    29    30    29    30    29    30    29    30    29    30    29    30    29    30    28    30    28    30    26    28    25    28    25    27    23    25    22    24    20    22    18    21    17    20
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----TG------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --C-----T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --T-------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---TG-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----TT-----
                                                                       ...PROTEIN --- Sc ---- 1e-014     NP_011913.1 arginine/alanine aminopeptidase; Aap1'p [Saccharomyces cerevisiae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 6e-022     NP_493503.2 F49B2.6 [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 3e-031     XP_789392.2 PREDICTED: similar to aminopeptidase N [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 2e-036     NP_650273.1 CG8773-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 3e-082     NP_955915.1 Unknown (protein for MGC:66103) [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 9e-093     XP_424862.2 PREDICTED: similar to oxytocinase splice [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 6e-093     NP_787116.2 leucyl/cystinyl aminopeptidase isoform 2 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 1e-093     NP_766415.1 leucyl/cystinyl aminopeptidase [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 1e-175     AAH84749.1 LOC495293 protein [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 1e-175     NP_001088429.1 hypothetical protein LOC495293 [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABI13530.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------TAA---TGAATG---------------TGA---------TAA---------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------TGA---------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------ATG---ATG---------------------------------------TAA---------TAA---------------------------------------------TGA------TAG------------------------------------------------TGA---------------TGA------------------------------------------------------TAA------------TAG---------------------------------TAATGA---------------------------TAG---------------------------------------TGA------------------------------TGA---------------ATG------------------------------------------------------TAG---------------------ATG------TAATAA---------------------TAA------------------ATG------------------------------------TAA---------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ...
  5   1   2       bld Lun1      in                        CABD13269.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAGGTGAAGAGATCACGGTTCAGCAGGAGCGGTTTCTTCGTACCCCTAGTCCAGACCATGCTACAAATGCCAGTACTGTGTGGCATATTCCACTGACTTACGTAACCAGAAAGTGTAGTGGTATTGAACCTCAGTGTGACAACATCTATCTCCTGAAAGAGGTTACAGGCAGAATAAATGTGTCAAGTGAGTTCCCATGGGTGAAGTTCAATGTCAACATGACTGGATACTATATAGTTGACTATGGTGCTGACGGCTGGGATGCCCTCATAAAGCAGCTTCTCAGGGATCACACAGTGCTACATTCCAGTGACCGAGCCAATCTGATCCATGACATATTCATGCTTGCAGGTGTGGGGAAGGTCCCTCTGGCAAAGGCTTTTGAACTGCTTGGGTACCTTGTAAATGAAACAAACAGTGCCCCCATCACCCAAGCTTTGAACCAGTTTTACCATATTCATGGTATCTTATTAAAGCGTGGCTTGGATGAGCTGTCCGACAAAGTTATGGAACGTGGTTTAAAACTACTCTCTAATCTTATCAACCAAACATGGGAAGATGAAGGAACACTGGCTGAACGAGAATTGAGATCCTCTCTCTTGGATTTTGCCTGTTTAAGTGGCCTTCAAAGTTGTGTAGAAAAAGCAACAGAGCTATTTAATATTTGGCGTCTTAATAACACAAGAATTCCCACTGATGTCATGAAGGTTGTGTTTAAGGTTGGAGCAAAAACTGCAGAAGGCTGGGCCTTTCTCTGGGATAAATATACAACTTCCCTCTATGAGACAGAAAAGAGGAAAATTCTTGAAGCTCTTGNCAGTACAGATAATGGCCGAAAATTACAGTGGTTGA
  5   1   2       bld Te4                                  CAAN2288.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGCATATTCCACTGACTTACGTAACCAGAAAGTGTAGTGGTATTGAACCTCAGTGTGACAACATCTATCTCCTGAAAGAGGTTACAGGCAGAATAAATGTGTCAAGTGAGTTCCCATGGGTGAAGTTCAATGTCAACATGACTGGATACTATATAGTTGACTATGGTGCTGACGGCTGGGATGCCCTCATAAAGCAGCTTCTCAGGGATCACACAGTGCTACATTCCAGTGACCGAGCCAATCTGATCCATGACATATTCATGCTTGCAGGTGTGGGGAAGGTCCCTCTGGCAAAGGCTTTTGAACTGCTTGGGTACCTTGCAAATGAAACAAACAGTGCCCCCATCACCCAAGCTTTGAACCAGTTTTACCATATTCATGGTATCTTATTAAAACGTGGTTTGGATGAGCTGTCCGACAAAGTTATGGAACGTGGTTTAAAACTACTCTCTAATCTTATCAACCAAACATGGGAAGATGAAGGAACACTGGCTGAACGAGAATTGAGATCCTCTCTCTTGGATTTTGCCTGTTCAAGTGGCCTTCAAAGTTGTGTAGATAAAGCAATGGAGCTATTTAATATTTGGCGTCTTAATAACACAAGAATTCCCACCGATGTTATGAAGGTTGTGTTTAAGGTTGGAGCAAAAACTGCAGAAGGCTGGGCCTTTCTCTGGGATAAATATACAACTTCCCTCTATGAGACAGAAAAGAGGAAAATTCTTGAAGCTCTTGNCAGTACAGATAATGGACGAAAATTACAGTGGTTGATGCAAGAGAGTCTTGATG
  5   1   2       bld Ova1      in                        CABE10225.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACCTCAGTGTGACAACATCTATCTCCTGAAAGAGGTTACAGGCAGAATAAATGTGTCAAGTGAGTTCCCATGGGTGAAGTTCAATGTCAACATGACTGGATACTATATAGTTGACTATGGTGTTGACGGCTGGGATGCCCTCATAAAGCAGCTTCTCAGGGATCACACAGTGCTACATTCCAGTGACCGAGCCAATCTGATCCATGACATATTCATGCTTGCAGGTGTGGGGAAGGTCCCTCTGGCAAAGGCTTTTGAACTGCTTGGGTACCTTGTAAATGAAACAAACAGTGCCCCCATCACCCAAGCTTTGAACCAGTTTTACCATATTCATGGTATCTTATTAAAGCGTGGCTTGGATGAGCTGTCCGACAAAGTTATGGAACGTGGTTTAAAACTACTCTCTAATCTTATCAACCAAACATGGGAAGATGAAGGAACACTGGCTGAACGAGAATTGAGATCCTCTCTCTTGGATTTTGCCTGTTTAAGTGGCCTTCAAAGTTGTGTAGAAAAAGCAACAGAGCTATTTAATATTTGGCGTCTTAATAACACAAGAATTCCCACTGATGTCATGAAGGTTGTGTTTAAGGTTGGAGCAAAAACTGCAGAAGGCTGGGCCTTTCTCTGGGATAAATATACAACTTCCCTCTATGAGACAGAAAAGAGGAAAATTCTTGAAGCTCTTGCAAGTACAGATAATGGCCGAAAATTACAGTGGTTGATGCAAGAGAGTCTTGATGGGGGCTTGATAAGATCTCAGGAGCTGCCTGCTGTTTTAGGATTCATTTCTAAAGGTTCACCTGGGTATTTGCTGGCCTGGGAATTTGCCAGCAGAACTGGGATTTGATAACTC
  5   1   2      shim Ski1      in                         CABJ7277.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATTCAATGTCAACATGACTGGATACTATATAGTTGACTATGGTGCTGACGGCTGGGATGCCCTCATAAAGCAGCTTCTCAGGGATCACACAGTGCTACATTCCAGTGACCGAGCCAATCTGATCCATGACATATTCATGCTTGCAGGTGTGGGGAAGGTCCCTCTGGCAAAGGCTTTTGAACTGCTTGGGTACCTTGTAAATGAAACAAACAGTGCCCCCATCACCCAAGCTTTGAACCAGTTTTACCATATTCATGGTATCTTATTAAAGCGTGGCTTGGATGAGCTGTCCGACAAAGTTATGGAACGTGGTTTAAAACTACTCTCTAATCTTATCAACCAAACATGGGAAGATGAAGGAACACTGGCTGAACGAGAATTGAGATCCTCTCTCTTGGATTTTGCCTGTTTAAGTGGCCTTCAAAGTTGTGTAGAAAAAGCAACAGAGCTATTTAATATTTGGCGTCTTAATAACACAAGAATTCCCACTGATGTCATGAAGGTTGTGTTTAAGGTTGGAGCAAAAACTGCAGAAGGCTGGGCCTTTCTCTGGGATAAATATACAACTTCCCTCTATGAGACAGAAAAGAGGAAAATTCTTGAAGCTCTTGCAAGTACAGATAATGGCCGAAAATTACAGTGGTTGATGCAAGAGAGTCTTGATGGGGGCTTGATAAGATCTCAGGAGCTGCCTGCTGTTTTAGGATTCATTTCTAAAGGTTCACCTGGGTATTTGCTGGCCTGGGAATTTGCCAAGCAGAACTGGGATTTGATAACTCAGAAGTTCATGCCTGGATCTTTTCCTATACAGAGTATCGTTTCCACGACTACCTACCACTTTTCCACTGATACCCATTTAAATGAGGTTATTGCTTT
  5   1   2       bld Te1       in                         CBWN6549.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCAACATGACTGGATACTATATAGTTGACTATGGTGCTGACGGCTGGGATGCCCTCATAAAGCAGCTTCTCAGGGATCACACAGTGCTACATTCCAGTGACCGAGCCAATCTGATCCATGACATATTCATGCTTGCAGGTGTGGGGAAGGTCCCTCTGGCAAAGGCTTTTGAACTGCTTGGGTACCTTGTAAATGAAACAAACAGTGCCCCCATCACCCAAGCTTTGAACCAGTTTTACCATATTCATGGTATCTTATTAAAGCGTGGCTTGGATGAGCTGTCCGACAAAGTTATGGAACGTGGTTTAAAACTACTCTCTAATCTTATCAACCAAACATGGGAAGATGAAGGAACACTGGCTGAACGAGAATTGAGATCCTCTCTCTTGGATTTTGCCTGTTTAAGTGGCCTTCAAAGTTGTGTAGAAAAAGCAACAGAGCTATTTAATATTTGGCGTCTTAATAACACAAGAATTCCCACTGATGTCATGAAGGTTGTGTTTAAGGTTGGAGCAAAAACTGCAGAAGGCTGGGCCTTTCTCTGGGATAAATATACAACTTCCCTCTATGAGACA
  5   1   2      shim Spl2      in                        CBSS7808.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTTGGGTACCTTGTAAATGAAACAAACAGTGCCCCCATCACCCAAGCCTTTGAACCAGTTTTACCATATTCATGGTATCTTATTAAAGCGTGGCTTGGATGAGCTGTCCGACAAAGTTATGGAACGTGGTTTAAAACTACTCTCTAATCTTATCAACCAAACATGGGAAGATGAAGGAACACTGGCTGAACGAGAATTGAGATCCTCTCTCTTGGATTTTGCCTGTTTAAGTGGCCTTCAAAGTTGTGTAGAAAAAGCAACAGAGCTATTTAATATTTGGCGTCTTAATAACACAAGAATTCCCACTGATGTCATGAAGGTTGTGTTTAAGGTTGGAGCAAAAACTGCAGAAGGCTGGGCCTTTCTCTGGGATAAATATACAACTTCCCTCTATGAGACAGAAAAGAGGAAAATTCTTGAAGCTCTTGCAAGTACAGATAATGGCCGAAAATTACAGTGGTTGATGCAAGAGAGTCTTGATGGGGGCTTGATAAGATCTCAGGAGCTGCCTGCTGTTTTAGGATTCATTTCTAAAGGTTCACCTGGGTATTTGCTGGCCTGGGAATTTGCCAAGCAGAACTGGGATTTGATAACTCAGAAGTTCATGCCTGGATCTTTTCCTATACAGAGTATCGTTTCCACGACTACCTACCACTTTTCCACTGATACCCATTTAAATGAGGTTATTGCATTTTTTAATTCAACCAAGGGGAAGA
  5   1   2       bld Fat1      in                         CABC9554.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAGTTTTACCATATTCATGGTATCTTATTAAAACGTGGTTTGGATGAGCTGTCCGACAAAGTTATGGAACGTGGTTTAAAACTACTCTCTAATCTTATCAACCAAACATGGGAAGATGAAGGAACACTGGCTGAACGAGAATTGAGATCCTCTCTCTTGGATTTTGCCTGTTCAAGTGGCCTTCAAAGTTGTGTAGATAAAGCAATGGAGCTATTTAATATTTGGCGTCTTAATAACACAAGAATTCCCACCGATGTTATGAAGGTTGTGTTTAAGGTTGGAGCAAAAACTGCAGAAGGCTGGGCCTTTCTCTGGGATAAATATACAACTTCCCTCTATGAGACAGAAAAGAGGAAAATTCTTGAAGCTCTTGCAAGTACAGATAATGGCCGAAAATTACAGTGGTTGATGCAAGAGAGTCTTGATGGGGGCTTGATAAGATCTCAGGAGCTGCCTGCTGTTTTAGGATTCATTTCTAAAGGTTCACCTGGGTATTTGCTGGCCTGGGAATTTGCCAAGCAGAACTGGGATTTGATAACTCAGAAGTAAGTATCCCTGTTAATAATATGGCTGCAGATCTCATTTTAAAAGTCCCCCCTCCCATATAACCCAAAAGAGAAATACTGTCATGTTTAAAGCCTCATTGTTTGGCTTAATTGGATTGGTGAGGTTTGGGAAGACATCTTCTTCCTCGTTTTTGTCAGTGGCTGCTTTTAAGCAAAGTCTATGANATGTGCTATCAGTTGCATATTGCTAGCAGGGCTGTGGAGT
  3  -1   2       bld Mus1      in                        CABH12213.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTATCTACCGACTCCACAGCCCTGATTGCTAGTCCTATTATTACATTTTTGGCAATTTGGAAATGGGAAAATTGTGCATATAACTGTATTAATTATAGTTGTGGTAGGGATATTTCAGATTTGGTGGGCAGCACATGCCCTACATAACCATGTAAGTGAGAACTGCTAAAATGTTTTTAAATGCGCATAAAGTGCCTGTTGTAAAAGTGAAAATAAAGTTCAGTTTATGGAGGATTGTGGTTAAAAGGAGTGGATCCTTTAAACACATCTGCTTAACTTCTGTTTTACACAGTCATCCAGGATTAAACAGAAGATAGAATAATAAAATGAAATGTGATTATCTAGGGAAAAGTATGGTTGTGTCTTTTGTTGTGGGTTTTTTTGTTTTTTCTTTTGTCTCCCATTCATTTGGCTCTGTACCAGAGGAACAATCCATTCCCTGTTTGGCATTTAAACCATACATGCCAGTGCACCAGCTGTTCATGCCTGGATCTTTTCCTATACAGAGTATCGTTTCCACGACTACCTACCACTTTTCCACTGATACCCATTTAAATGAGGTTATTGCATTTTTTAATTCAACCAAGGGGAAGAGCCGAGAAATGTGGTGCGTCAAAGAGGCCGTGGAGACAATCAAGTTTAACATTGAATGGATGAAAAACAACCTTGAGACAAGCCTTAAGACCTGGTTGCAGTCCTCACACTAGAATTTCCATGTTCCAGAGAACTTCTTACGTTGAACTGTTGCTCTGTTTCTTTTGCAGAAGCGAGGGTGGAAATTGCAACACTGTTTGCACTATTTGAGTGTTTTTGACAGCTCA
  5   1   2      shim Limb      in                        CBSU7396.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAACTACTCTCTAATCTTATCGACCACATATGGGAAGATGAAGGAACACTGGCTGAACGAGAATTGAGATCCTCTCTCTTGGATTTTGCCTGTTCAAGTGGCCTTCAAAGTTGTGTAGATAAAGCAATGGAGCTATTTAATATTTGGCGTCTTAATAACACACGAATTCCCACCGATGTTATGAAGGTTGTGTTTAAGGTTGGAGCAAAAACTGCAGAAGGCTGGGCCTTTCTCTGGGATAAATATACAACTTCCCTCTATGAGACAGAAAAGAGGAAAATTCTTGAAGCTCTTGCAAGTACAGATAATGGCCGAAAATTACAGTGGTTGATGCAAGAGAGTCTTGATGGGGGCTTGATAAGATCTCACGAGCTGCCTGCTGTTTTAGGATTCATTTCTAAAGGTTCACCTGGGTATTTGCTGGCCTGGGAATTTGCCAAGCAGAACTGGGATTTGATAACTCAGAAGTTCATGCCTGGATCTTTTCCTATACAGAGTATCGTTTCCACGACTACCTACCACTTTTCCACTGATACCCATTTAAATGAGGTTATTGCATTTTTTAATTCGA
  3   1   2       bld Tad5      out                        XZT32019.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAAGTTGTGTAGATAAAGCAATGGAGCTATTTAATATTTGGCGTCTTAATAACACAAGAATTCCCACCGATGTTATGAAGGTTGTGTTTAAGGTTGGAGCAAAAACTGCAGAAGGCTGGGCCTTTCTCTGGGATAAATATACAACTTCCCTCTATGAGACAGAAAAGAGGAAAATTCTTGAAGCTCTTGCAAGTACAGATAATGGCCGAAAATTACAGTGGTTGATGCAAGAGAGTCTTGATGGGGGCTTGATAAGATCTCAGGAGCTGCCTGCTGTTTTAGGATTCATTTCTAAAGGTTCACCTGGGTATTTGCTGGCCTGGGAATTTGCCAAGCAGAACTGGGATTTGATAACTCAGAAGTAAGTATCCCTGTTAATAATATGGCTGCAGATCTCATTTTAAAAGTCCCCCCTCCCATATAACCCAAAAGAGAAATACTGTCATGTTTAAAGCCTCATTGTTTGGCTTAATTGGATTGGTGAGGTTTGGGAAGACATCTTCTTCCTCGTTTTTGTCAGTGGCTGCTTTTAAGCAAAGTCTATGAAATGTGCTATCAGTTGCATATTGCTAGCAGGGCTGTggagtcggaggcaattttgggtacctggagtcggaggcaattttgggtacctggagtcggagtcggcaaaaaatgaaccgactccaactCCGACTCCTACTAAATTTAAATGGG
  5   1   0       add Lun1      in                        CABD10921.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACATGCCCTACATAACCATGTAAGTGAGAACTGCTAAAATGTTTTTAAATGCGCATAAAGTGCCTGTTGTAAAAGTGAAAATAAAGTTCAGTTTATGGAGGATTGTGGTTAAAAGGAGTGGATCCTTTAAACACATCTGCTTAACTTCTGTTTTACACAGTCATCCAGGATTAAACAGAAGATAGAATAATAAAATGAAATGTGATTATCTAGGGAAAAGTATGGTTGTGTCTTTTGTTGTGGGTTTTTTTGTTTTTTCTTTTGTCTCCCATTCATTTGGCTCTGTACCAGAGGAACAATCCATTCCCTGTTTGGCATTTAAACCATACATGCCAGTGCACCAGCTGTAAGTATGCATGTGCTGTGCCACCAGGGGATTCCATAGCACTTTTTCCTTATATTTTACCATTGAACTATCTTGATAATATGTTTTAAGGAGATAGACAACGTTGAAATTGTGGCTGTTAAAAATTGCACTACTTTTAGTGCTACAGTCCCTAGAATTTCTCGACCCAAGCGCTATAAAATGTGTTTTTTATGGGGGCACAAAGGGGCCTGACTTCCTCCAAAGGTAGGAAAGTTTGATATCAGGCACTGGGGACCTCATGGCCTCAGTTTGCTTTAAATTCACTATTACTCTTTTAGAAAAATATGCATTAATGGACATTCTGTTTTAGGTTCATGCCTGGATCTTTTCCTATACAGAGTATCGTTTCCACGACTACCTACCACTTTTCCACTGATACCCATTTAAATGAGGTTATTGCATTTTTTAAT
  5   1   2       bld Ovi1      in                        CABI13530.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGAGGGTTGTGTTTAAGGTTGGAGCAAAAACTGCAGAAGGCTGGGCCTTTCTCTGGGATAAATATACAACTTCCCTCTATGAGACAGAAAAGAGGAAAATTCTTGAAGCTCTTGCAAGTACAGATAATGGCCGAAAATTACAGTGGTTGATGCAAGAGAGTCTTGATGGGGGCTTGATAAGATCTCAGGAGCTGCCTGCTGTTTTAGGATTCATTTCTAAAGGTTCACCTGGGTATTTGCTGGCCTGGGAATTTGCCAAGCAGAACTGGGATTTGATAACTCAGAAGTTCATGCCTGGATCTTTTCCTATACAGAGTATCGTTTCCACGACTACCTACCACTTTTCCACTGATACCCATTTAAATGAGGTTATTGCATTTTTTAATTCAACCAAGGGGAAGAGCCGAGAAATGTGGTGCGTCAAAGAGGCCGTGGAGACAATCAAGTTTAACATCGAATGGATGAAAAACAACCTTGATAGCCTTAAGACCTGGTTGCAGTCCTCACACTAGAATTTCCATGTTCCAGAGAACTTCTTACGTTGAACTGTTGCTCTGTCTCTTTTGCAGAAGCGAGGGTGGAAATTGCAACACTGTTTGCACTATTTGAGTGTTTTTGACAGCTCAGGGCGAAAAACAAAAAAAAATTCCTCTTTTTTTTTTTTTGTGTGCGAATGCTGAGGAGCGAGAGTGTATTTATTACAAAGTGTGGTAATCACCACATTATTGCCATAAAGCTGTAGAGTGATCCAAACTCCCTCTGTATTACACTTTGTTAAAAAAACACTGTATTCCAGTTGCTTGTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTAT
  3  -1   2       bld Int1      in                        CAAP10084.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCTGGGCCTTTCTCTGGGATAAATATACAACTTCCCTCTATGAGACAGAAAAGAGGAAAATTCTTGAAGCTCTTGCAAGTACAGATAATGGCCGAAAATTACAGTGGTTGATGCAAGAGAGTCTTGATGGGGGCTTGATAAGATCTCAGGAGCTGCCTGCTGTTTTAGGATTCATTTCTAAAGGTTCACCTGGGTATTTGCTGGCCTGGGAATTTGCCAAGCAGAACTGGGATTTGATAACTCAGAAGTTCATGCCTGGATCTTTTCCTATACAGAGTATCGTTTCCACGACTACCTACCACTTTTCCACTGATACCCATTTAAATGAGGTTATTGCATTTTTTAATTCAACCAAGGGGAAGAGCCGAGAAATGTGGTGCGTCAAAGAGGCCGTGGAGACAATCAAGTTTAACATCGAATGGATGAAAAACAACCTTGATAGCCTTAAGACCTGGTTGCAGTCCTCACACTAGAATTTCCATGTTCCAGAGAACTTCTTACGTTGAACTGTTGCTCTGTTTCTTTTGCAGAAGCGAGGGTGGAAATTGCAACACTGTTTGCACTATTTGAGTGTTTTTGACAGCTCAGGGCGAAAAACAAAAAAAAATTCCTCTTTTTTTTTTTTGTGTGCGAATGCTGAGGAGCGAGAGTGTATTTATTACAAAGTGTGGTAATCACCACATTATTGCCATAAAGCTGTAGAGCGATCCAAACTCCCTCTGTATTACACTTTGTTAAAAAAACACTGTATTCCAGTTGCTTGTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGGCTTTGCAG
  5   1   2       bld Ova1      in                        CABE11490.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGAAGTTCATGCCTGGATCTTTTCCTATACAGAGTATCGTTTCCACGACTACCTACCACTTTTCCACTGATACCCATTTAAATGAGGTTATTGCATTTTTTAATTCAACCAAGGGGAAGAGCCGAGAAATGTGGTGCGTCAAAGAGGCCGTGGAGACAATCAAGTTTAACATTGAATGGATGAAAAACAACCTTGAGACAAGCCTTAAGACCTGGTTGCAGTCCTCACACTAGAATTTCCATGTTCCAGAGAACTTCTTACGTTGAACTGTTGCTCTGTTTCTTTTGCAGAAGCGAGGGTGGAAATTGCAACACTGTTTGCACTATTTGAGTGTTTTTGACAGCTCAGGGCGAAAAACAAAAAAAAAATTCCTCTTTTTTTTTTTTTTGTGTGCGAATGCTGAGGAGCGAGAGTGTATTTATTACAAAGTGTGGTAATCACCACATTATTGCCATAAAGTTGTAGAGTGATCCAAACTCCCTCTGTATTACACTTTGTTAAAAAAACACTGTATTCCAGTTGCTTGTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGTTTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAG
  3   1   2       bld Tbd0 5g3  out                      IMAGE:6977367                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGATTTGGCCTTGAAGGTGGAACCTGGGAAAGAAAGCATACTATTATTATTGTTTTATACACAAAAAGAATTTGGGTGGGGGTTAATTTCCCACCCCCCACCTTTTTATTTTCTGCCCTCTTAAAAAGGTCCTTTGTTAGGATATCCCCATTTCCCCGAAAATCTTCCCGTTTGTTGGTATTTTACCCACCTTTTTGTTTAAAAAAAAAAAACCCCCCTGTTTATTTCCCAGGTTTGGTTGGGTTTAAAAACCTTTGGGGACTTATTACCCGGAGGCTCCCAAGGTTTGGACAGCTTTCGGCCTTACCCTGGGCTGCCCTTTTTATTAGAAAAAAAATGGAATGGCTATCTCCACTGACTGGTAAAATAGGGCTTTTGGCAGGCCCACCTTCTCTTTATGGGAAAGAAAACATGGGACATGGTGCCCTTTCTTCAGTGAAGGAGTCCCAGTGAGCTACTAATCTAAATTGTCTGTTTAAAGGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATGTGATGTATAAATTTTAATGGTAAGCCGGCGGGCGGGGCGTGGTGTGTGTCGGTTGTCTTGTCTGGTGGCGGGGTCTGGGGGTTGCGGTGGGGGGGCGGTGGGGTGGCGTGTGGCGGTCGGTGGTGGTGTGTT
  5   1   2       bld Ovi1      in                        CABI11299.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGAGGGTGGAAATTGCAACACTGTTTGCACTATTTGAGTGTTTTTGACAGCTCAGGGCGAAAAACAAAAAAAAAATTCCTCTTTTTTTTTTTTTTGTGTGCGAATGCTGAGGAGCGAGAGTGTATTTATTACAAAGTGTGGTAATCACCACATTATTGCCATAAAGTTGTAGAGTGATCCAAACTCCCTCTGTATTACACTTTGTTAAAAAAACACTGTATTCCAGTTGCTTGTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGTTTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGA
  5  -1   2       bld Int1      out                       CAAP13076.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGTGTTTTTGACAGCTCAGGGCGAAAAACAAAAAAAAATCCCTCTTTTTTTTTTTTGTGTGCGAATGCTGAGGAGCGAGAGTGTATNTATTACAAAGTGTGGTAATCACCACATTATTGCCATAAAGCTGTAGAGCGATCCAAACTCCCTCTGTATTACACTTTGTTAAAAAAACACTGTATTCCAGTTGCTTGTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGGCTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAAT
  3   1   2       bld Lun1      in                        CABD13269.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAAAAAAAAATTCCTCTTTTTTTTTTTTTTGTGTGCGAATGCTGAGGAGCGAGAGTGTATTTATTACAAAGTGTGGTAATCACCACATTATTGCCATAAAGTTGTAGAGTGATCCAAACTCCCTCTGTATTACACTTTGTTAAAAAAACACTGTATTCCAGTTGCTTGTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGTTTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCC
  3   1   2       bld Ovi1      in                        CABI11299.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTTTTTTTTTTTTTGTGTGCGAATGCTGAGGAGCGAGAGTGTATTTATTACAAAGTGTGGTAATCACCACATTATTGCCATAAAGTTGTAGAGTGATCCAAACTCCCTCTGTATTACACTTTGTTAAAAAAACACTGTATTCCAGTTGCTTGTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGTTTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTGCACAAAATCTCT
  5   1   2       bld Lun1                                 CABD1692.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGTGCGAATGCTGAGGAGCGAGAGTGTATTTATTACAAAGTGTGGTAATCACCACATTATTGCCATAAAGCTGTAGAGCGATCCAAACTCCCTCTGTATTACACTTTGTTAAAAAAACACTGTATTCCAGTTGCTTGTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGGCTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAA
  3   1   2       bld Lun1      in                        CABD10921.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGAATGCTGAGGAGCGAGAGTGTATTTATTACAAAGTGTGGTAATCACCCACATTATTGCCATAAAGCTGTAGAGCGATCCAAACTCCCTCTGTATTACACTTTGTTAAAAAAACACTGTATTCCAGTTGCTTGTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGGCTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATATAAAGTTTTTTTGTATAATGAAAAAAA
  3   1   2       bld Ovi1      in                        CABI13530.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGTGTATTTATACAAAAGTGTGGTAATCACCACATTATTGCCATAAAGCTGTAGAGTGATCCAAACTCCCTCTGTATTACACTTTGTTAAAAAAACACTGTATTCCAGTTGCTTGTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGGCTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATATAAAGTTTTTTTGTATAATGTTAAAAA
  5  -1   2       bld Int1      in                        CAAP10084.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACAAAGTGTGGTAATCACCACATTATTGCCATAAAGCTGTAGAGCGATCCAAACTCCCTCTGTATTACACTTTGTTAAAAAAACACTGTATTCCAGTTGCTTGTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGGCTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTT
  3   1   2       bld Spl1      out                        CABK3829.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGATAGTTTATGGGACAGCATGAATGTGGTCACCAACAAAAATCCAAATGTGAAAAACATGATGAAGACATGGACTCAGAAAGCTGGTTATCCTCTAGTGACAGCTCTGAGGAAAGGTGAAGAGATCACGGTTCAGCAGGAGCGGTTTCTTCGTACCCCTAGTCCAGACCATGCTACTCACTGACTGTAAATAGGCTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATATAAAGTTTTTTTGTATAATGTTTTAAA
  5   1   2       bld AbdN                               IMAGE:7024219                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACCACATTATTGCCATAAAGCTGTAGAGCGATCCAAACTCCCTCTGTATTACACTTTGTTAAAAAAACACTGTATTCCAGTTGCTTGTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGGCTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGTAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAAAATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAACTCTTGTATAAATTATAATATAAAAGTTTTTTGTATAAG
  5  -1   2       bld Mus1      in                        CABH12213.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTATTGCCATAAAGTTGTAGAGTGATCCAAACTCCCTCTGTATTACACTTTGTAAAAAAACACTGTATTCCAGTTGCTTGTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGTTTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATATAAAGTTTTTTTGTATAATGTTTT
  3   1   2       bld Ski1      in                         CABJ7277.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTATTGCCATAAAGTTGTAGAGTGATCCAAACTCCCTCTGTATTACACTTTGTAAAAAAACACTGTATTCCAGTTGCTTGTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGTTTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATATAAAGTTTTTTTGTATAATG
  3   1   2       bld Fat1      in                         CABC9554.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATTGCATAAAAGCTGTAGAGTGATCCAAACTCCCTCTGTATTACACTTTGTTAAAAAAACACTGTATTCCAGTTGCTTGTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGGCTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATATAAAGTTTTTTTGTATAATGTT
  3   1   2       bld Ova1      in                        CABE11490.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTGCCATAAAGGTGTAGAGTGATCCAAACTCCCTCTGTATTACACTTGTTAAAAAAACACTGTATTCCAGTTGCTTGTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGTTTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATATAAAGTT
  3   1   2       bld Te4  5g3  out                        CAAN1426.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCCATAAAGCTGTAGAGTGATCCAAACTCCCTCTGTATTACACTTGTTAAAAAAACACTGTATTCCAGTTGCTTGTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGGCTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATATAAAGTTTTTTTGTATAATGTT
  3   1   2       bld Brn3      out                       CAAK12119.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAAAGCTGTAGAGTGATCCAAACTCCCTCTGTATTACACTTTGTAAAAAAACACTGTATTCCAGTTGCTGTTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGGCTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATATAAAGTTTTTTTGTATAATGTTT
  3   1   2       bld Ova1      in                        CABE10225.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGTATTACACTTTGTTAAAAAAACACTGTATTCCAGTGGCTTGTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGTTTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATATAAAGTTTTTTTGTATAATGTT
  3   1   2       bld Te1  5g3  out                       CBWN12727.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATTACACTTTGTTAAAAAACACTGTATTCCAGTTGCTTGTTTAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGGCTTTGCAGCCCACCTCTCTTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGCCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATATAAAGTTTTTTTGTATAATGTTTAAAAAAAAAAAAAAA
  3   1   2      seed Te4       out                        CAAN1648.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTAAAAAAACACTGTATTCCAGTTGCTTGTTAAACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGGCTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATAT
  3   1   2       bld Te3       out                        CAAM1697.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACATTGGACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCTTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGGCTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATATAAAGTTTTTTTGTATAATGTT
  3   1   2       bld Limb      in                        CBSU7396.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGGCTTTGCAGCCACCTCTCTTATGGAATAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGTGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATATAAAGTTTTTTTGTATAATGTT
  3   1   2       bld Tbd1      out                       CBXT12890.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACTATACAGAGCTCAAGCTGGCAGCTCGCCTACCTGCTGCCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGGCTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGAGCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATATAAAGTTTTTTTGTATAATGAAAAAAAAAAAAAAAA
  3   1   2       bld Spl2      in                        CBSS7808.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTCTTATAGAAAAATGGATGCTACTCACTGACTGTAAATAGTTTTTGCAGCCACCTCTCTTATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATATAAAGTTTTTTTGTATAATGTT
  3   1   2       bld Te1       in                         CBWN6549.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATGGAAGAAACATGGACATGGTGCCATTCTTCAGTGAAGAGTCCAGTGAGCTACTAATCTAATTGTCTGTTTAAAGCGGCATCTGTCTCTCCATTGGCGAACATGGGCATTACACTCTTTGAGGTAAATAGTCTGGCGCTTACACCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATATAAAGTTTTTTTGTATAATGTTAAAAAAAAAAAAAAA
  3   1   2       bld Gas5      in                           XZF704.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTGCAGCCAGATTCACTGACCATTTCTGGGATTTCTCATACTGAAAAGTCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAACTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTAATCTAATAACTGCTATGTCTTGAAAGATGTATAAAATATTTAAATAAT
  5   1   2       bld Sto1      in                        CABG10800.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCAGCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATGGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATATAAAGTTTTTTTGTATAATGTTTTATTTGGTTGTGGTGCTTTTTGCTTTCAAAGTCAAGGTATAACGATGTGGAGTAGATAACATCCACACAGAAGTACAAGACTCTTCTTACATTTTAGGGACTGGTTGTTAGTACAGTAAAAATCATATTCTGTGACAGATTTTATTCTAATGAGGTGACATTGAGCACGGTAGCTTCTTTCCCCTATCCCTCTATCAGAAATCATGGAAGCGAAAAAAAAAGTGCTTACTCTGAATCCCAATGAATTATGTCATAATATTTATGGTGTTAttttatttgtaaattacactgtttatatagcanataattcactctaccatttaaaattttattattgaactaacaaaagtatttttttttagctgtaatattggtgtgtaggagccatctcagtgcat
  5   1   2       bld Gas5      in                           XZF704.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCACTTATGAGTGCCAAAAAGCCCAAAGCATGTCACATTGGATTTCCTCCAACTTTACTTCCCTTAAATATATTCTGCTTAGACCTCCTTTTCCTTAAGTGATGTACCTGGTGTCTAATGACCTACATCTCCTTTAGAGCAACAGGTATAGGGATACTGTCACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTATAAAATATTTAAAATAAATATAAAGCAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Sto1      in                         CABG5416.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATATAAAGTTTTTTTGTATAATGTTT
  5   1   2       bld Sto1      in                         CABG5416.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTTTCTTCTTTACTGTGGTATCTTACAATGAGTGTTGCTTTTTCAGTTGGGGGCACATCTATGACTGACCTGTTTGATTATGAAAAGGAATATTTGGGGTGAAAAAGTACAATTCAATTTTAGAGCTTTGGATGCATAGGTTTTTAAGATCACTGATAAAATGTTGCTCTAATAACTGCTATGTCTTGAAAGATGTTAATATGGATGTAAACTTTTGATGCAGACTCACTTCCATGCTTGCACAAAATCTCTTGTATAAATTATAATATAAAGTTTTTTTGTATAATGTTTAAAAAAAAAAAAAAAAAA
  3   1   0       add Sto1      in                        CABG10800.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     agctgtaatattggtgtgtaggagccatctcagtgcattgtgcctgagtctgagctttcagaaggagccagcactacacattagaactgctttcagataacctattgtttctcctactccaatgtatctggaggagtcccaaaccggacttggatttctttctattgagtgctattctgatatctactgggagctgttatcttgctgccttcccattattctgctgattgggtggtgggaggtgatatcactccaacttgcagctcagcattaaagtgtgactgaagtttatcagggcatgggtcacatggctgtggcacactgggaaattatgaatatggctagcctcatgtgaaatttcaaagttaaatataaaaaaatctgtttgcacttttgaaaaatggatttcaatgccgaattctgctggagaagccctattatctgatatgtttgacaaagaacatgGGCTTTGCCCCCCAAGTGGGCCAGCCCCAAAGTTTAGTAACCACTGCCCTACCTGATGCAGATGACCATAGTAGCCATATATCCAGGTTGCTTGAAATTTCCAAGAGAAAATTGAGTACAACTATGGAATGGTTACCAGCAAATTACTGATAGTAGCAATTTTTATCTAGAGCTTATAACAAATATTTGAATACATTTTCAAAGGAAAGGCAAGGGCACATGGAGCAGTTCTATGTAACATTTTTAAAAACATGGATTTCAGCGTAcattaaagcggacctgtcaccttaagaaataatttcacattgttttctattgtgtttggcaaacaaaataaactttacttacactat

In case of problems mail me! (mike.gilchrist@crick.ac.uk)