Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAQ2308.3.5                         98 END     1           1        1                Bromodomain containing 1 [Xenopus tropicalis]
     2   2.0    0Xt7.1-THdA029k09.5.5                       92 END     1           1        1                Unknown (protein for MGC:97823) [Xenopus tropicalis]
     3   2.0    0Xt7.1-CABJ7262.3                           68 END     1           1        1                MGC81550 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 65%

 1012074066 Xt7.1-XZT70608.5 - 65 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT70608.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTCGGACCATTACCTCTCCTCCTCATACAGGAAGATTTTCGGAGACCCTCCCCGGGCTTCATCAGCTCGCCTGGGAGTGAGCAGCTCCTCCAGGGCTACCGCCACCTCTGGCTACCGGTCCCACTCCCTGTCCCGCAGCAATGTCCCCTCAGCGCCTTCCTACAGGAGGGCCTCCAGGGGGGCTGGCTACCTGGCTGGGGACAACTTAGATCTCACTCAAACTTCAGCAGTCAATAACGAGTACAAGATCATTCGCACCAATGAGAAGGAGCAGCTGCAGGGGTTAAATGACAGGTTTGCCATGTTCATTGAGAAGGTGCATAACCTGGAGCAGCAGAACAAGGTGCTGGAGACGGAGCTGACAGCCCTCAGGCAAAGGCAATCGGAGCCCTCCAGGCTGGGGGAACTCTACCAGCAGGAGATCAAGGAACTCAGGGCTCAGCTGGAGGAGCTCAATGCAGAGAAGGCTCAGATCATCATAGAGAGGGATAACCTAGAAGATGACCTACAGAAACTTAAAGGGAAATATGAAGATGAAATCCGAATGAGAGAGGAGACTGAATACGCCCTGAAGTCTCACAAGAAGGATGTGGATGATGCCACCCTGGCTCGCCTGGACCTGGAGAAGAAGGTGGAATCCCTGTTGGATGAGATCTCCTTCCTCAGGAAAGTCCATGATGAAGAGGTGACCGAGCTGATGGCCATGCTGCAGGCTTCCCAGGTCTCCGTGGAGATGGAGCTCTCTAAGCCGGACCTCACCTCGGCCCTGAAGGAGATCCGCTCTCAGTACGAGTCCCTGGCCGCCAAGAACCTGCAGTCCGCGGATGAATGGTACAAATCCAAATTCGCCAACCTGACCGAGCAGGCATCCCGCAGCACCGAGCTCATCCGAGCCAACAGGGAGGAGATCAATGACTACAGGAGGCAGCTGCAGTCCAAAACCATCGAGATCGAAAGTCTCCGCGGCACCAATGAGTCTCTGGAAAGGCAACTCCAAGAGATGGAGGACAGACACATGGCAGAGACCGCCGGGCTCCAGGATACCATTAACCAGCTGGAAAATGAATTGAGAAACACAAAAGGCGAAATGGCTCGACACCTGCGTGAATATCAGGATCTCCTTAATGTCAAAATGGCCCTGGATATTGAGATAGCCGCATACAGGAAATTGCTGGAGGGTGAAGAAACCAGGTTCAGCACAGCAGGAATTAGCATGATGCCTTTTAATCCAAATCCTCCCCCAAGTTACTCTTATCAGTCCCGGGTTCATAGTTCTTCCACTTCTAAGGTTACCCCTGCAGTCGATTCTAGAAAAAAGGAGGAAACTGATGGGGTCTCCAAAGTCGTCTCTAAATCATCTACTCGCATAGGGGAAACGTATGAGGAAATCATAGAGGAAACTGTTGTATCAACTAAGAAACTGGATAAGCCAGATCAAAGTGATGAAGCCTTGGTAAAACCTTAGAAAAAATATCTTAGTGGGGTAATGTAATAATAGGTGCAAATTTAGCACCAGATCTAGTAACCAAAAACAACCAGTTCTGTTCTTTCAAACAGTTGACCAGTAAATGTAAGTGTAGGACTTGTGTGTCAGGGGCCCACATGGGCTGCCGCCTGAGCCCCCTACCCCAGTAGCGAGGTCCTGCTCCCCCCAGGCCACATACCGCATCCCCTCCATGATCAGGGTGGGAGTTCAGGTGCGTGCAGTTCATGGCCCGGCAGGGGGAGGGGAAAGAGCAGGCTGGGTTGGTGGGGGGCTGCCCACTGGGCTGGGGTCCACTGGGTTTTTTCCCGGTATCCTGCTGGTCTAGTCCGACCCTGGTAAATACTATCTGCTCACTGGTTGCTATGGGTTACTAGAAGCGGCGCTAACTTTGCCACTGTTGCTACATAACCCATACAAATTAGCTAGGATACATTTTTTCACTTCATAGTCTATTCATTCACCAGCAGGAATATTATTGGAAGCCACAGGACATGTCCCAGAACTATAGGTGGCCTTTAAAAGTAATGCTGCCACCTAAAACATACCATTTGTAGTAATAGTAGTTAAAAGCCCAATGCAGCTTGAGCTACTAGGGCCTTGCAATACACACTGCCCACAAGCAAGATCAGTTGTCCTCTATGGGACACTGAGATGAGACGCTGGCTCTGCATGGGTTACAAAAGGCCATTGCTACAGATTGGTCAGGCAAGCAATCATATAAATAAGGTACTTTCTATGGAGCCGGGGCACTTATCTTCTGGCTGCCCCCTGGCATACCTACCACTCTGCCCTCTCCAGTGAGAAATAAGCTGCAAACAAAAATAATCAAATAGGCACCCGATATTCTCCAAACATGTTCTAAAAGTGATTGGCCATTGGAAACTATCAAACTGGGCCTGGACAAATTCTACTATCAGACAGTGCCATTGGTGCAGGTTTGGCAATGGATCTCATATCAACTACATTTCCCAGCATTCCCCTACCAGCATAGTTAGCCAGTGGATATTGAGATCTCTTGAAATCTAATGATACCTGCCTAAATAAAAACCCATATCAAATGTGTTGATAAGTCTTGTTGGCATTTCCAGTGCATAATCACATGCATGGTGACCATCACCACCAAGTGTAATGTCGTAATCGCTCATTGATAGGAGAACATTAGTCTTTTATGTACCGAATACAAGACATTCCGCCATCTTTACACTTTAGACTTAGACACTGGGATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGGGGTCCACCTTATCTTAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAATCAAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGCTGTGTAGTTGACTAAGCTGTGGGTAAGAACGAATACGAGGAATGAAATAAACTGCTTTGGCATCTGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008224640                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCATTACCTCTCCTCCTCATACAGGAAGATTTTCGGAGACCCTCCCCGGGCTTCATCAGCTCGCCTGGGAGTGAGCAGCTCCTCCAGGGCTACCGCCACCTCTGGCTACCGGTCCCACTCCCTGTCCCGCAGCAATGTCCCCTCAGCGCCTTCCTACAGGAGGGCCTCCAGGGGGGCTGGCTACCTGGCTGGGGACAACTTAGATCTCACTCAAACTTCAGCAGTCAATAACGAGTACAAGATCATTCGCACCAATGAGAAGGAGCAGCTGCAGGGGTTAAATGACAGGTTTGCCATGTTCATTGAGAAGGTGCATAACCTGGAGCAGCAGAACAAGGTGCTGGAGACGGAGCTGACAGCCCTCAGGCAAAGGCAATCGGAGCCCTCCAGGCTGGGGGAACTCTACCAGCAGGAGATCAAGGAACTCAGGGCTCAGCTGGAGGAGCTCAATGCAGAGAAGGCTCAGATCATCATAGAGAGGGATAACCTAGAAGATGACCTACAGAAACTTAAAGGGAAATATGAAGATGAAATCCGAATGAGAGAGGAGACTGAATACGCCCTGAAGTCTCACAAGAAGGATGTGGATGATGCCACCCTGGCTCGCCTGGACCTGGAGAAGAAGGTGGAATCCCTGTTGGATGAGATCTCCTTCCTCAGGAAAGTCCATGATGAAGAGGTGACCGAGCTGATGGCCATGCTGCAGGCTTCCCAGGTCTCCGTGGAGATGGAGCTCTCTAAGCCGGACCTCACCTCGGCCCTGAAGGAGATCCGCTCTCAGTACGAGTCCCTGGCCGCCAAGAACCTGCAGTCCGCGGATGAATGGTACAAATCCAAATTCGCCAACCTGACCGAGCAGGCATCCCGCAGCACCGAGCTCATCCGAGCCAACAGGGAGGAGATCAATGACTACAGGAGGCAGCTGCAGTCCAAAACCATCGAGATCGAAAGTCTCCGCGGCACCAATGAGTCTCTGGAAAGGCAACTCCAAGAGATGGAGGACAGACACATGGCAGAGACCGCCGGGCTCCAGGATACCATTAACCAGCTGGAAAATGAATTGAGAAACACAAAAGGCGAAATGGCTCGACACCTGCGTGAATATCAGGATCTCCTTAATGTCAAAATGGCCCTGGATATTGAGATAGCCGCATACAGGAAATTGCTGGAGGGTGAAGAAACCAGGTTCAGCACAGCAGGAATTAGCATGATGCCTTTTAATCCAAATCCTCCCCCAAGTTACTCTTATCAGTCCCGGGTTCATAGTTCTTCCACTTCTAAGGTTACCCCTGCAGTCGATTCTAGAAAAAAGGAGGAAACTGATGGGGTCTCCAAAGTCGTCTCTAAATCATCTACTCGCATAGGGGAAACGTATGAGGAAATCATAGAGGAAACTGTTGTATCAACTAAGAAACTGGATAAGCCAGATCAAAGTGATGAAGCCTTGGTAAAACCTTAGAAAAAATATCTTAGTGGGGTAATGTAATAATAGGTGCAAATTTAGCACCAGATCTAGTAACCAAAAACAACCAGTTCTGTTCTTTCAAACAGTTGACCAGTAAATGTAAGTGTAGGACTTGTGTGTCAGGGGCCCACATGGGCTGCCGCCTGAGCCCCCTACCCCAGTAGCGAGGTCCTGCTCCCCCCAGGCCACATACCGCATCCCCTCCATGATCAGGGTGGGAGTTCAGGTGCGTGCAGTTCATGGCCCGGCAGGGGGAGGGGAAAGAGCAGGCTGGGTTGGTGGGGGGCTGCCCACTGGGCTGGGGTCCACTGGGTTTTTTCCCGGTATCCTGCTGGTCTAGTCCGACCCTGGTAAATACTATCTGCTCACTGGTTGCTATGGGTTACTAGAAGCGGCGCTAACTTTGCCACTGTTGCTACATAACCCATACAAATTAGCTAGGATACATTTTTTCACTTCATAGTCTATTCATTCACCAGCAGGAATATTATTGGAAGCCACAGGACATGTCCCAGAACTATAGGTGGCCTTTAAAAGTAATGCTGCCACCTAAAACATACCATTTGTAGTAATAGTAGTTAAAAGCCCAATGCAGCTTGAGCTACTAGGGCCTTGCAATACACACTGCCCACAAGCAAGATCAGTTGTCCTCTATGGGACACTGAGATGAGACGCTGGCTCTGCATGGGTTACAAAAGGCCATTGCTACAGATTGGTCAGGCAAGCAATCATATAAATAAGGTACTTTCTATGGAGCCGGGGCACTTATCTTCTGGCTGCCCCCTGGCATACCTACCACTCTGCCCTCTCCAGTGAGAAATAAGCTGCAAACAAAAATAATCAAATAGGCACCCGATATTCTCCAAACATGTTCTAAAAGTGATTGGCCATTGGAAACTATCAAACTGGGCCTGGACAAATTCTACTATCAGACAGTGCCATTGGTGCAGGTTTGGCAATGGATCTCATATCAACTACATTTCCCAGCATTCCCCTACCAGCATAGTTAGCCAGTGGATATTGAGATCTCTTGAAATCTAATGATACCTGCCTAAATAAAAACCCATATCAAATGTGTTGATAAGTCTTGTTGGCATTTCCAGTGCATAATCACATGCATGGTGACCATCACCACCAAGTGTAATGTCGTAATCGCTCATTGATAGGAGAACATTAGTCTTTTATGTACCGAATACAAGACATTCCGCCATCTTTACACTTTAGACTTAGACACTGGGATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGGGGTCCACCTTATCTTAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAATCAAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGCTGTGTAGTTGACTAAGCTGTGGGTAAGAACGAATACGAGGAATGAAATAAACTGCTTTGGCATCTGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              5     5     8     8     8     8     8     8     8     8     9     9     9    10    10    10    10    10    10    10    10    10     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    10    10    10    10    10    10    11    11    11    11    11    11    12    12    11    12    11    11    11    11    11    11    11    11    10    11    10    10     8     8     8     8     7     7     6     6     5     6     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     7     7     7     7     7     7     7     7     7     7     6     6     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     9     8     9     8     9     8     9     8     9     7     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8    10     8    10     8    10    10    11     9    10     8    10     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     9     7     9     6     8     6     8     5     7     5     7     5     7     4     6     4     6     4     6     4     6     4     6     4     6     4     7     4     7     4     7     4     7     4     7     4     7     5     7     5     7     5     8     5     9     6     9     6     9     7    10     7    10     9    12     9    12     7    12     8    12     9    13    12    15    13    16    14    16    14    17    15    17    15    17    15    17    15    17    15    18    17    19    17    19    16    18    16    18    16    18    17    19    18    21    18    21    18    21    18    21    19    22    22    24    22    24    21    24    23    24    25    26    25    26    26    26    26    26    25    26    29    29    29    29    29    29    29    29    31    31    31    31    31    31    31    31    31    32    32    33    32    33    34    34    34    34    34    34    34    34    34    34    35    35    35    35    35    35    35    35    34    34    34    34    34    34    34    34    35    35    35    35    35    35    34    35    34    35    34    35    33    33    32    33    31    33    21    23    17    23    15    23    15    22    14    22    15    23    15    23    14    21    14    21    14    21    12    19    12    19    12    18    12    17     5    11     4     5     2     2     2     2     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------T----
                                               BLH ATG     -10     124                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Cs ---- 7e-007     AAX84194.1 cytospin A [Ciona savignyi] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sc ---- 4e-011     NP_010225.1 involved intracellular protein transport, coiled-coil protein necessary forprotein transport from ER to Golgi; Uso1p [Saccharomyces cerevisiae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Sp ---- 1e-038     NP_999665.1 nuclear intermediate filament protein [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ce ---- 3e-041     NP_001076764.1 Intermediate Filament, A family member (ifa-1) [Caenorhabditis elegans] -----------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dm ---- 3e-042     NP_523742.2 CG10119-PA [Drosophila melanogaster] ----------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Br ==== 9e-070     CAA45827.1 cytoplasmic intermediate filament protein [Branchiostoma lanceolatum] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Bf ---- 2e-070     CAA11447.1 intermediate filament protein B1 [Branchiostoma floridae] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ci ---- 1e-083     CAC24550.1 intermediate filament protein IF-A [Ciona intestinalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Gg ---- 6e-116     XP_417680.2 PREDICTED: similar to NF-M protein [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Mm ==== 5e-159     NP_666212.2 internexin neuronal intermediate filament protein, alpha [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Hs ==== 2e-167     NP_116116.1 internexin neuronal intermediate filament protein, alpha; neurofilament 5(66kD); neurofilament-66, tax-binding protein [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Dr ==== 1e-168     XP_682810.1 PREDICTED: similar to gefiltin [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Xl ==== 0          AAB41403.1 xefiltin; neurofilament [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- ?? ==== 0          NP_001079278.1 internexin neuronal intermediate filament protein, alpha [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xt ==== 0          AAI35569.1 Unknown (protein for IMAGE:7605582) [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT70608.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------ATGTAATAATAG---------TAG---------TAGTAA---------------------------------TGA------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------TAA---------------TAG------------------------------------------------------------------------------------------TAA---TAA---------------------------------------TAA---------------TGA------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------ATG------------------------------------------------------------TGA---------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATGA------------TAA------------------------------------------------TAA------------TGA------------------ATG---TAA---------------------------------------------------------------------TAG---TAG---------------TGA---TAA------------ATG---------------------------TAA---------------------------------------------TAA------------------TAA------------TAA---------------ATG------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------TAA---------------------------------------ATG---------------------TAAATG---------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  0   1   1           Tad5 FLt5                        XZT29389.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTCGGACCATTACCTCTCCTCCTCATACAGGAAGATTTTCGGAGACCCTCCCCGGGCTTCATCAGCTCGCCTGGGAGTGAGCAGCTCCTCCAGGGCTACCGCCACCTCTGGCTACCGGTCCCACTCCCTGTCCCGCAGCAATGTCCCCTCAGCGCCTTCCTACAGGAGGGCCTCCAGGGGGGCTGGCTACCTGGCTGGGGACAACTTAGATCTCACTCAAACTTCAGCAGTCAATAACGAGTACAAGATCATTCGCACCAATGAGAAGGAGCAGCTGCAGGGGTTAAATGACAGGTTTGCCATGTTCATTGAGAAGGTGCATAACCTGGAGCAGCAGAACAAGGTGCTGGAGACGGAGCTGACAGCCCTCAGGCAAAGGCAATCGGAGCCCTCCAGGCTGGGGGAACTCTACCAGCAGGAGATCAAGGAACTCAGGGCTCAGCTGGAGGAGCTCAATGCAGAGAAGGCTCAGATCATCATAGAGAGGGATAACCTAGAAGATGACCTACAGAAACTTAAAGGGAAATATGAAGATGAAATCCGAATGAGAGAGGAGACTGAATACGCCCTGAAGTCTCACAAGAAGGATGTGGATGATGCCACCCTGGCTCGCCTGGACCTGGAGAAGAAGGTGGAATCCCTGTTGGATGAGATCTCCTTCCTCAGGAAAGTCCATGATGAAGAGGTGACCGAGCTGATGGCCATGCTGCAGGCTTCCCAGGTCTCCGTGGAGATGGAGCTCTCTAAGCCGGACCTCACCTCGGCCCTGAAGGAGATCCGCTCTCAGTACGAGTCCCTGGCCGCCAAGAACCTGCAGTCCGCGGATGAATGGTACAAATCCAAATTCGCCAACCTGACCGAGCAGGCATCCCGCAGCACCGAGCTCATCCGAGCCAACAGGGAGGAGATCAATGACTACAGGAGGCAGCTGCAGTCCAAAACCATCGAGATCGAAAGTCTCCGCGGCACCAATGAGTCTCTGGAAAGGCAACTCCAAGAGATGGAGGACAGACACATGGCAGAGACCGCCGGGCTCCAGGATACCATTAACCAGCTGGAAAATGAATTGAGAAACACAAAAGGAGAAATGGCTCGACACCTGCGTGAATATCAGGATCTCCTTAATGTCAAAATGGCCCTGGATATTGAGATAGCCGCATACAGGAAATTGCTGGAGGGTGAAGAAACCAGGTTCAGCACAGCAGGAATTAGCATGATGCCTTTTAATCCAAATCCTCCCCCAAGTTACTCTTATCAGTCCCGGGTTCATAGTTCTTCCACTTCTAAGGTTACCCCTGCAGTCGATTCTAGAAAAAAGGAGGAAACTGATGGGGTCTCCAAAGTCGTCTCTAAATCATCTACTCGCATAGGGGAAACGTATGAGGAAATCATAGAGGAAACTGTTGTATCAACTAAGAAACTGGATAAGCCAGATCAAAGTGATGAAGCCTTGGTAAAACCTTAGAAAAAATATCTTAGTGGGGTAATGTAATAATAGGTGCAAATTTAGCACCAGATCTAGTAACCAAAAACAACCAGTTCTGTTCTTTCAAACAGTTGACCAGTAAATGTAAGTGTAGGACTTGTGTGTCAGGGGCCCACATGGGCTGCCGCCTGAGCCCCCTACCCCAGTAGCGAGGTCCTGCTCCCCCCAGGCCACATACCGCATCCCCTCCATGATCAGGGTGGGAGTTCAGGTGCGTGCAGTTCATGGCCCGGCAGGGGGAGGGGAAAGAGCAGGCTGGGTTGGTGGGGGGCTGCCCACTGGGCTGGGGTCCACTGGGTTTTTTCCCGGTATCCTGCTGGTCTAGTCCGACCCTGGTAAATACTATCTGCTCACTGGTTGCTATGGGTTACTAGAAGCGGCGCTAACTTTGCCACTGTTGCTACATAACCCATACAAATTAGCTAGGATACATTTTTTCACTTCATAGTCTATTCATTCACCAGCAGGAATATTATTGGAAGCCACAGGACATGTCCCAGAACTATAGGTGGCCTTTAAAAGTAATGCTGCCACCTAAAACATACCATTTGTAGTAATAGTAGTTAAAAGCCCAATGCAGCTTGAGCTACTAGGGCCTTGCAATACACACTGCCCACAAGCAAGATCAGTTGTCCTCTATGGGACACTGAGATGAGACGCTGGCTCTGCATGGGTTACAAAAGGCCATTGCTACAGATTGGTCAGGCAAGCAATCATATAAATAAGGTACTTTCTATGGAGCCGGGGCACTTATCTTCTGGCTGCCCCCTGGCATACCTACCACTCTGCCCTCTCCAGTGAGAAATAAGCTGCAAACAAAAATAATCAAATAGGCACCCGATATTCTCCAAACATGTTCTAAAAGTGATTGGCCATTGGAAACTATCAAACTGGGCCTGGACAAATTCTACTATCAGACAGTGCCATTGGTGCAGGTTTGGCAATGGATCTCATATCAACTACATTTCCCAGCATTCCCCTACCAGCATAGTTAGCCAGTGGATATTGAGATCTCTTGAAATCTAATGATACCTGCCTAAATAAAAACCCATATCAAATGTGTTGATAAGTCTTGTTGGCATTTCCAGTGCATAATCACATGCATGGTGACCATCACCACCAAGTGTAATGTCGTAATCGCTCATTGATAGGAGAACATTAGTCTTTTATGTACCGAATACAAGACATTCCGCCATCTTTACACTTTAGACTTAGACACTGGGATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGGGGTCCACCTTATCTTAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAAAAAAA
  5   1   2   14  bld Brn3 5g3  in                         CAAK5372.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGATGAGTTACGGTTCGGACCATTACCTCTCCTCCTCATACAGGAAGATTTTCGGAGACCCTCCCCGGGCTTCATCAGCTCGCCTGGGAGTGAGCAGCTCCTCCAGGGCTACCGCCACCTCTGGCTACCGGTCCCACTCCCTGTCCCGCAGCAATGTCCCCTCAGCGCCTTCCTACAGGAGGGCCTCCAGGGGGGCTGGCTACCTGGCTGGGGACAACTTAGATCTCACTCAAACTTCAGCAGTCAATAACGAGTACAAGATCATTCGCACCAATGAGAAGGAGCAGCTGCAGGGGTTAAATGACAGGTTTGCCATGTTCATTGAGAAGGTGCATAACCTGGAGCAGCAGAACAAGGTGCTGGAGACGGAGCTGACAGCCCTCAGGCAAAGGCAATCGGAGCCCTCCAGGCTGGGGGAACTCTACCAGCAGGAGATCAAGGAACTCAGGGCTCAGCTGGAGGAGCTCAATGCAGAGAAGGCTCAGATCATCATAGAGAGGGATAACCTAGAAGATGACCTACAGAAACTTAAAGGGAAATATGAAGATGAAATCCGAATGAGAGAGGAGACTGAATACGCCCTGAAGTCTCACAAGAAGGATGTGGATGATGCCACCCTGGCTCGCCTGGACCTGG
  3  -1   2       bld Brn3      out                        CAAK7700.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCGCGATCTAGAACTAGGACCATTACCTCTCCTCCTCATACAGGAAGATTTTCGGAGACCCTCCCCGGGCTTCATCAGCTCGCCTGGGAGTGAGCAGCTCCTCCAGGGCTACCGCCACCTCTGGCTACCGGTCCCACTCCCTGTCCCGCAGCAATGTCCCCTCAGCGCCTTCCTACAGGAGGGCCTCCAGGGGGGCTGGCTACCTGGCTGGGGACAACTTAGATCTCACTCAAACTTCAGCAGTCAATAACGAGTACAAGATCATTCGCACCAATGAGAAGGAGCAGCTGCAGGGGTTAAATGACAGGTTTGCCATGTTCATTGAGAAGGTGCATAACCTGGAGCAGCAGAACAAGGTGCTGGAGACGGAGCTGACAGCCCTCAGGCAAAGGCAATCGGAGCCCTCCAGGCTGGGGGAACTCTACCAGCAGGAGATCAAGGAACTCAGGGCTCAGCTGGAGGAGCTCAATGCAGAGAAGGCTCAGATCATCATAGAGAGGGATAACCTAGAAGATGACCTACAGAAACTTAAAGGGAAATATGAAGATGAAATCCGAATGAGAGAGGAGACTGAATACGCCCTGAAGTCTCACAAGAAGGATGTGGATGATGCCACCCTGGCTCGCCTGGACCTGGAGAAGAAGGTGGAATCCCTGTTGGATGAGATCTCCTTCCTCAGGAAAGTCCATGATGAAGAGGTGACCGAGCTGATGGCCATGCTGCAGGCTTCCCAGGTCTCCGTGGAGATGGAGCTCTCTAAGCCGGAACTCACCTCGGCCCTGAAGGAGATCCGCTCTCAGTACGAGTCCCTGGCCGCCAAGAACCTGCAGTCCGCGGAT
  5   1   2       bld TbA  5g3  in                   TTbA021j08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGTGTTACGGGTTCGGACCATTACCTCTCCTCCTCATACAGGAAGATTTTCGGGGACCCTCCCCGGGCTTCATCAGCTCGCCCGGGTGCGTGCAGCTCCTCCAGGGCTACCGCCACCTCCGGCTACCGGTCCCACTCCCCGTCCCGCAGCAACGTCCCCTCAGCGCCTTCCTACAGGTGGGCCTCCAGGGGGGCCGGCTACCTGGCCGGGGACAACTTAGATCTCACTCAAACTTCAGCAGTCAATAACGAGTACAAGATCATTCGCACCAATGAGAAGGAGCAGCTGCAGGGGTTAAATGACAGGTTTGCCATGTTCATTGAGAAGGTGCATAACCTGGAGCAGCAGAACAAGGTGCTGGAGACGGAGCTGACAGCCCTCAGGCAAAGGCAATCGGTGCCCTCCAGGCTGGGGGAAACTCTACCAGCAGGAGATCAAGGAAACTCAGGGCTCAGCTGGAGGTGCTCAATGGCAGAGAAGGCTCAGATCATCATAGAGTGGGGTAACCTAGAAGAAGACCTACAGAAAACTTAAAGGGGAATATGAAGATGAAAATCCGAATGAGAGAGGGGACTGAATACGCCCTGAAGTCTCACAAGAAGGGTGTGGAAGAAGCCACCCTGGGCTCGCCTGGACCTGGAGAAG
  5   1   2       bld Brn3      in                        CAAK11444.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAGTTACGGTTCGGACCATTACCTCTCCTCCTCATACAGGAAGATTTTCGGAGACCCTCCCCGGGCTTCATCAGCTCGCCTGGGAGTGAGCAGCTCCTCCAGGGCTACCGCCACCTCTGGCTACCGGTCCCACTCCCTGTCCCGCAGCAATGTCCCCTCAGCGCCTTCCTACAGGAGGGCCTCCAGGGGGGCTGGCTACCTGGCTGGGGACAACTTAGATCTCACTCAAACTTCAGCAGTCAATAACGAGTACAAGATCATTCGCACCAATGAGAAGGAGCAGCTGCAGGGGTTAAATGACAGGTTTGCCATGTTCATTGAGAAGGTGCATAACCTGGAGCAGCAGAACAAGGTGCTGGAGACGGAGCTGACAGCCCTCAGGCAAAGGCAATCGGAGCCCTCCAGGCTGGGGGAACTCTACCAGCAGGAGATCAAGGAACTCAGGGCTCAGCTGGAGGAGCTCAATGCAGAGAAGGCTCAGATCATCATAGAGAGGGATAACCTAGAAGATGACCTACAGAAACTTAAAGGGAAATATGAAGATGAAATCCGAATGAGAGAGGAGACTGAATACGCCCTGAAGTCTCACAAGAAGGATGTGGATGATGCCACCCTGGCTCGCCTGGACCTGGAGAAGAAGGTGGAATCCCTGTTGGATGAGATCTCCTTCCTCAGGAAAGTCCATGATGAAGAGGTGACCGAGCTGATGGCCATGCTGCAGGCTTCCCAGGTCTCCGTGGAGATGGAGCTCTCTAAGCCGGACCTCACCTCGGCCCTGAAGGAGATCCGCTCTCAGTACGAGTCCCTGGCCGCCAAGAACCTGCAGTCCGCGGATGAATGGTACAAATCCAATTCGCCAACCNNTGACGAGCAGCATCCCGCAGCACCGAGCTCATCCGAGCCAACA
  5   1   2       bld Tad5 FLt5                            XZT29389.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTCGGACCATTACCTCTCCTCCTCATACAGGAAGATTTTCGGAGACCCTCCCCGGGCTTCATCAGCTCGCCTGGGAGTGAGCAGCTCCTCCAGGGCTACCGCCACCTCTGGCTACCGGTCCCACTCCCTGTCCCGCAGCAATGTCCCCTCAGCGCCTTCCTACAGGAGGGCCTCCAGGGGGGCTGGCTACCTGGCTGGGGACAACTTAGATCTCACTCAAACTTCAGCAGTCAATAACGAGTACAAGATCATTCGCACCAATGAGAAGGAGCAGCTGCAGGGGTTAAATGACAGGTTTGCCATGTTCATTGAGAAGGTGCATAACCTGGAGCAGCAGAACAAGGTGCTGGAGACGGAGCTGACAGCCCTCAGGCAAAGGCAATCGGAGCCCTCCAGGCTGGGGGAACTCTACCAGCAGGAGATCAAGGAACTCAGGGCTCAGCTGGAGGAGCTCAATGCAGAGAAGGCTCAGATCATCATAGAGAGGGATAACCTAGAAGATGACCTACAGAAACTTAAAGGGAAATATGAAGATGAAATCCGAATGAGAGAGGAGACTGAATACGCCCTGAAGTCTCACAAGAAGGATGTGGATGATGCCACCCTGGCTCGCCTGGACCTGGAGAAGAAGGTGGAATCCCTGTTGGATGAGATCTCCTTCCTCAGGAAAGTCCATGATGAAGAGGTGACCGAGCTGATGGCCATGCTGCANGCTTCCCAGGT
  5   1   2       bld Brn3 PIPE in                        CAAK12456.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCGGACCATTACCTCTCCTCCTCATACAGGAAGATTTTCGGAGACCCTCCCCGGGCTTCATCAGCTCGCCTGGGAGTGAGCAGCTCCTCCAGGGCTACCGCCACCTCTGGCTACCGGTCCCACTCCCTGTCCCGCAGCAATGTCCCCTCAGCGCCTTCCTACAGGAGGGCCTCCAGGGGGGCTGGCTACCTGGCTGGGGACAACTTAGATCTCACTCAAACTTCAGCAGTCAATAACGAGTACAAGATCATTCGCACCAATGAGAAGGAGCAGCTGCAGGGGTTAAATGACAGGTTTGCCATGTTCATTGAGAAGGTGCATAACCTGGAGCAGCAGAACAAGGTGCTGGAGACGGAGCTGACAGCCCTCAGGCAAAGGCAATCGGAGCCCTCCAGGCTGGGGGAACTCTACCAGCAGGAGATCAAGGAACTCAGGGCTCAGCTGGAGGAGCTCAATGCAGAGAAGGCTCAGATCATCATAGAGAGGGATAACCTAGAAGATGACCTACAGAAACTTAAAGGGAAATATGAAGATGAAATCCGAATGAGAGAGGAGACTGAATACGCCCTGAAGTCTCACAAGAAGGATGTGGATGATGCCACCCTGGCTCGCCTGGACCTGGAGAAGAAGGTGGAATCCCTGTTGGATGAGATCTCCTTCCTCAGGAAAGTCCATGATGAAGAGGTGACCGAGCTGATGGCCATGCTGCAGGCTTCCCAGGTCTCCGTGGAGATGGAGCTCTCTAAGCCGGACCTCACCTCGGCCCTGAAGGAGATCCGCTCTCAGTACGAGTCCCTG
  5   1   2       bld Brn3      in                         CAAK1790.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCGGACCATTACCTCTCCTCCTCATACAGGAAGATTTTCGGAGACCCTCCCCGGGCTTCATCAGCTCGCCTGGGAGTGAGCAGCTCCTCCAGGGCTACCGCCACCTCTGGCTACCGGTCCCACTCCCTGTCCCGCAGCAATGTCCCCTCAGCGCCTTCCTACAGGAGGGCCTCCAGGGGGGCTGGCTACCTGGCTGGGGACAACTTAGATCTCACTCAAACTTCAGCAGTCAATAACGAGTACAAGATCATTCGCACCAATGAGAAGGAGCAGCTGCAGGGGTTAAATGACAGGTTTGCCATGTTCATTGAGATGGTGCATAACCTGGAGCAGCAGAACAAGGTGCTGGAGACGGAGCTGACAGCCCTCAGGCAAAGGCAATCGGAGCCCTCCAGGCTGGGGGAACTCTACCAGCAGGAGATCAAGGAACTCAGGGCTCAGCTGGAGGAGCTCAATGCAGAGAAGGCTCAGATCATCATAGAGAGGGATAACCTAGAAGATGACCTACAGAAACTTAAAGGGAAATATGAAGATGAAATCCGAATGAGAGAGGAGACTGAATACGCCCTGAAGTCTCACAAGAAGGATGTGGATGATGCCACCCTGGCTCGCCTGGACCTGGAGAAGAAGGTGGAATCCCTGTTGGATGAGATCTCCTTCCTCAGGAAAGTCCATGATGAAGAGGTGACCGAGCTGATGGCCATGCTGCAGGCTTCCCAGGTCTCCGTGGAGATGGAGCTCTCTAAGCCGGACCTCACCTCGGCCCTGAAGGAGATCCGCTCTCAGTACGAGTCCCTGGCCGCCAAGAACCTGCAGTCCGCGGATGAATGGTACANATCCAAATTCGCCAAACCTGACG
  5   1   2       bld Brn3      in                         CAAK2448.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCGGACCATTACCTCTCCTCCTCATACAGGAAGATTTTCGGAGACCCTCCCCGGGCTTCATCAGCTCGCCTGGGAGTGAGCAGCTCCTCCAGGGCTACCGCCACCTCTGGCTACCGGTCCCACTCCCTGTCCCGCAGCAATGTCCCCTCAGCGCCTTCCTACAGGAGGGCCTCCAGGGGGGCTGGCTACCTGGCTGGGGACAACTTAGATCTCACTCAAACTTCAGCAGTCAATAACGAGTACAAGATCATTCGCACCAATGAGAAGGAGCAGCTGCAGGGGTTAAATGACAGGTTTGCCATGTTCATTGAGAAGGTGCATAACCTGGAGCAGCAGAACAAGGTGCTGGAGACGGAGCTGACAGCCCTCAGGCAAAGGCAATCGGAGCCCTCCAGGCTGGGGGAACTCTACCAGCAGGAGATCAAGGAACTCAGGGCTCAGCTGGAGGAGCTCAATGCAGAGAAGGCTCAGATCATCATAGAGAGGGATAACCTAGAAGATGACCTACAGAAACTTAAAGGGAAATATGAAGATGAAATCCGAATGAGAGAGGAGACTGAATACGCCCTGAAGTCTCACAAGAAGGATGTGGATGATGCCACCCTGGCTCGCCTGGACCTGGAGAAGAAGGTGGAATCCCTGTTGGATGAGATCTCCTTCCTCAGGAAAGTCCATGATGAAGAGGTGACCGAGCTGATGGCCATGCTGCAGGCTTCCCAGGTCTCCGTGGAGATGGAGCTCTCTAAGCCGGAACTCACCTCGGCCCTGAAGGAGATCCGCTCTCAGTACGAGTCCCT
  5   1   2       bld TpA       in                  TTpA022o02.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTCATCAGCTCACCTGGGAGTGAGCAGCTCCTCCAGGGCTACCGCCACCTCTGGCTACCGGTCCCACTCCCTGTCCCGCACCAATGTCCCCTCAGCGCCTTCCTACAGGAGGGCCTCCACGGGGGCTGGCTACCTGGCTGGGGACAACTTAGATCTCACTCAAACTTCACCAGCCAATAACGAGTACAAGATCATTCACACCAATGACAAGGAGCAGCTGCAGGGGATAAATGACAGGTTTGCCATGTTCATTGAGAAGGTGCATAACCTGGAGCAGCAGAACAAGGTGCTGGAGACGGAGCTGACAGCCCTCAGGCAAAGGCAATCGGAGCCCTCCAGGCTGGGGGAACTCTACCAGCATGAGATCAAGGAACTCATGGCTCAGCTGGAGGAGCTCAATGCATAGAAGGCTCAGATCATCATAGAGAGGGATAACCTAGAAGATGACCTACAGAAACTTAAAGGGAAATATGAAGATGAAATCCGAATGAGAGAGGAGACTGAATACGCCCTGAAGTCTCACAAGAAGGATGTGGATGATGCCACCCTGGCTCGCCTGGACCTGGAGAAGAAGGTGGAATCCCTGTTGGATGAGATCTCCTTCCTCAGGAAAGTCCATGATGAAGAGGTGACCGAGCTGATGGCCATGCTGCACGCTTCCCAGGTCTCCGTGGAGATGGAGCTCTCTAAGCCGGACCTCACCTCGGGCCCTGAAGGAGATCCGCTCT
  5   1   2       bld Brn3      in                         CAAK5226.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCTGGGAGTGAGCAGCTCCTCCAGGGCTACCGCCACCTCTGGCTACCGGTCCCACTCCCTGTCCCGCAGCAATGTCCCCTCAGCGCCTTCCTACAGGAGGGCCTCCAGGGGGGCTGGCTACCTGGCTGGGGACAACTTAGATCTCACTCAAACTTCAGCAGTCAATAACGAGTACAAGATCATTCGCACCAATGAGAAGGAGCAGCTGCAGGGGTTAAATGACAGGTTTGCCATGTTCATTGAGAAGGTGCATAACCTGGAGCAGCAGAACAAGGTGCTGGAGACGGAGCTGACAGCCCTCAGGCAAAGGCAATCGGAGCCCTCCAGGCTGGGGGAACTCTACCAGCAGGAGATCAAGGAACTCAGGGCTCAGCTGGAGGAGCTCAATGCAGAGAAGGCTCAGATCATCATAGAGAGGGATAACCTAGAAGATGACCTACAGAAACTTAAAGGGAAATATGAAGATGAAATCCGAATGAGAGAGGAGACTGAATACGCCCTGAAGTCTCACAAGAAGGATGTGGATGATGCCACCCTGGCTCGCCTGGACCTGGAGAAGAAGGTGGAATCCCTGTTGGATGAGATCTCCTTCCTCAGGAAAGTCCATGATGAAGAGGTGACCGAGCTGATGGCCATGCTGCAGGCTTCCCAGGTCTCCGTGGAGATGGAGCTCTCTAAGCCGGACCTCACCTCGGCCCTGAAGGAGATCCGCTCTCAGTACGAGTCCCTGGCCGCCAAGAACCTGCAGTCCGCGGATGAATGGTACAAA
  5   1   2       bld Tad5      in                         XZT27107.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAGATCATTCGCACCAATGAGAAGGAGCAGCTGCAGGGGTTAAATGACAGGTTTGCCATGTTCATTGAGAAGGTGCATAACCTGGAGCAGCAGAACAAGGTGCTGGAGACGGAGCTGACAGCCCTCAGGCAAAGGCAATCGGAGCCCTCCAGGCTGGGGGAACTCTACCAGCAGGAGATCAAGGAACTCAGGGCTCAGCTGGAGGAGCTCAATGCAGAGAAGGCTCAGATCATCATAGAGAGGGATAACCTAGAAGATGACCTACAGAAACTTAAAGGGAAATATGAAGATGAAATCCGAATGAGAGAGGAGACTGAATACGCCCTGAAGTCTCACAAGAAGGATGTGGATGATGCCACCCTGGCTCGCCTGGACCTGGAGAAGAAGGTGGAATCCCTGTTGGATGAGATCTCCTTCCTCAGGAAAGTCCATGATGAAGAGGTGACCGAGCTGATGGCCATGCTGCAGGCTTCCCAGGTCTCCGTGGAGATGGAGCTCTCTAAGCCGGACCTCACCTCGGCCCTGAAGGAGATCCGCTCTCAGTACGAGTCCCTGGCCGCCAAGAACCTGCAGTCCGCGGATGAATGGTACAAATCCAAATTCGCCAACCTGACCGAGCAGGCATCCCGCAGCACCGAGCTCATCCGAGCCAACAGGGAGGAGATCAATGACTACAGGAGGCAGCTGCAGTCCAAAACCATCGAGATCGAAAGTCTCCGCGGCACCAATGAGTCTCTGGAAAGGCAACTCCAAGAGATGGAGGACAGACACATGGCAGAGACCGCCGGGCTCCAGGATACCATTAAACAGCTGGAAAATGAATTGAGAAAC
  5   1   2       bld Brn3      in                        CAAK10897.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGAGAAGGAGCAGCTGCAGGGGTTAAATGACAGGTTTGCCATGTTCATTGAGAAGGTGCATAACCTGGAGCAGCAGAACAAGGTGCTGGAGACGGAGCTGACAGCCCTCAGGCAAAGGCAATCGGAGCCCTCCAGGCTGGGGGAACTCTACCAGCAGGAGATCAAGGAACTCAGGGCTCAGCTGGAGGAGCTCAATGCAGAGAAGGCTCAGATCATCATAGAGAGGGATAACCTAGAAGATGACCTACAGAAACTTAAAGGGAAATATGAAGATGAAATCCGAATGAGAGAGGAGACTGAATACGCCCTGAAGTCTCACAAGAAGGATGTGGATGATGCCACCCTGGCTCGCCTGGACCTGGAGAAGAAGGTGGAATCCCTGTTGGATGAGATCTCCTTCCTCAGGAAAGTCCATGATGAAGAGGTGACCGAGCTGATGGCCATGCTGCAGGCTTCCCAGGTCTCCGTGGAGATGGAGCTCTCTAAGCCGGACCTCACCTCGGCCCTGAAGGAGATCCGCTCTCAGTACGAGTCCCTGGCCGCCAAGAACCTGCAGTCCGCGGATGAATGGTACAAATCCAAATTCGCCAACCTGACCGAGCAGGCATCCCGCAGCACCGAGCTCATCCGAGCCAACAGGGAGGAGATCAATGACTACAGGAGGCAGCTGCAGTCCAAAACCATCGAGATCGAAAGTCTCCGCGGCACCAATGAGTCTCTGGAAAGGCAACTCCAAGAGATGGAGGACAGACACATGGCAGAGACCGCCGGGCTCCAGGATACCATTAACCAGCTGGAAAATGAATTGAGAAACACAAAAGGA
  5   1   2       bld TpA       in                   TTpA005c02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTCCTCAGGAAAGTCCATGATGAAGAGGTGACCGAGCTGATGGCCATGCTGCAGGCTTCCCAGGTCTCCGTGGAGATGGAGCTCTCTAAGCCGGACCTCACCTCGGCCCTGAAGGAGATCCGCTCTCAGTACGAGTCCCTGGCCGCCAAGAACCTGCAGTCCGCGGATGAATGGTACAAATCCAAATTCGCCAACCTGACCGAGCAGGCATCCCGCAGCACCGAGCTCATCCGAGCCAACAGGGAGGAGATCAATGACTACAGGAGGCAGCTGCAGTCCAAAACCATCGAGATCGAAAGTCTCCGCGGCACCAATGAGTCTCTGGAAAGGCAACTCCAAGAGATGGAGGACAGACACATGGCAGAGACCGCCGGGCTCCAGGATACCATTAACCAGCTGGAAAATGAATTGAGAAACACAAAAGGAGAAATGGCTCGACACCTGCGTGAATATCAGGATCTCCTTAATGTCAAAATGGCCCTGGATATTGAGATAGCCGCATACAGGAAATTGCTGGAGGGTGAAGAAACCAGGTTCAGCACAGCAGGAATTAGCATGATGCCTTTTAATCCAAATCCTCCCCCAAGTTACTCTTATCAGTCCCGGGTTCATAGTTCTTCCACTTCTAAGGTTACCCCTGCAGTCGATTCTAGAAAAAAGGAGGAAACTGATGGGGTCTCCAAAGTCGTCTCTAAATCATCTACTCGCATAGGGGAAACGTATGAGGAAATCATAGAGGAAACTGTTGTATCAACTAAGAAACTGGATAAGCCAGATCAAAGTGATGAAGCCTTGGTAAAACCTTAGAAAAAATATCTTAGTGGGGTAATGTAATAATAGGTGCAAATTTAGCACCAGATCTAGTAACCAAAAACAACCAGTTCTGTTCTTTCAAACAGTTGACCAGTAAATGTAAGTGTAGGACTTGTGTGTCAGGGGCCCACATGGGCTG
  5   1   2       bld Tad5      in                         XZT51129.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACCGAGCTGATGGCCATGCTGCAGGCTTCCCAGGTCTCCGTGGAGATGGAGCTCTCTAAGCCGGACCTCACCTCGGCCCTGAAGGAGATCCGCTCTCAGTACGAGTCCCTGGCCGCCAAGAACCTGCAGTCCGCGGATGAATGGTACAAATCCAAATTCGCCAACCTGACCGAGCAGGCATCCCGCAGCACCGAGCTCATCCGAGCCAACAGGGAGGAGATCAATGACTACAGGAGGCAGCTGCAGTCCAAAACCATCGAGATCGAAAGTCTCCGCGGCACCAATGAGTCTCTGGAAAGGCAACTCCAAGAGATGGAGGACAGACACATGGCAGAGACCGCCGGGCTCCAGGATACCATTAACCAGCTGGAAAATGAATTGAGAAACACAAAAGGAGAAATGGCTCGACACCTGCGTGAATATCAGGATCTCCTTAATGTCAAAATGGCCCTGGATATTGAGATAGCCGCATACAGGAAATTGCTGGAGGGTGAAGAAACCAGGTTCAGCACAGCAGGAATTAGCATGATGCCTTTTAATCCAAATCCTCCCCCAAGTTACTCTTATCAGTCCCGGGTTCATAGTTCTTCCACTTCTAAGGTTACCCCTGCAGTCGATTCTAGAAAAAAGGAGGAAACTGATGGGGTCTCCAAAGTCGTCTCTAAATCATCTACTCGCATAGGGGAAACGTATGAGGAAATCATAGAGGAAACTGTTGTATCAACTAAGAAACTGGATAAGCCAGATCANAGTGATGAAGCCTTGGTAAAACC
  5   1   2       bld HdA       out                 THdA024n04.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGAGCTCATCCGAGCCAACAGGGAGGAGATCAATGACTACAGGAGGCAGCTGCAGTCCAAAACCATCGAGATCGAAAGTCTCCGCGGCACCAATGAGTCTCTGGAAAGGCAACTCCAAGAGATGGAGGACAGACACATGGCAGAGACCGCCGGGCTCCAGGATACCATTAACCAGCTGGAAAATGAATTGAGAAACACAAAAGGCGAAATGGCTCGACACCTGCGTGAATATCAGGATCTCCTTAATGTCAAAATGGCCCTGGATATTGAGATAGCCGCATACAGGAAATTGCTGGAGGGTGAAGAAACCAGGTTCAGCACAGCAGGAATTAGCATGATGCCTTTTAATCCAAATCCTCCCCCAAGTTACTCTTATCAGTCCCGGGTTCATAGTTCTTCCACTTCTAAGGTTACCCCTGCAGTCGATTCTAG
  3   1   2       bld BrSp      in                      EC2BBA7CE08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGATGGAGGACAGACACATGGCAGAGACCGCCGGGCTCCAGGATACCATTAACCAGCTGGAAAATGAATTGAGAAACACAAAAGGCGAAATGGCTCGACACCTGCGTGAATATCAGGATCTCCTTAATGTCAAAATGGCCCTGGATATTGAGATAGCCGCATACAGGAAATTGCTGGAGGGTGAAGAAACCAGGTTCAGCACAGCAGGAATTAGCATGATGCCTTTTAATCCAAATCCTCCCCCAAGTTACTCTTATCAGTCCCGGGTTCATAGTTCTACCACTTCTAAGGTTACCCCTGCAGTGGATTCTAGAAAAAAGGAGGAAACTGATGGGGTCTCCAAAGTCGTCTCTAAATCATCTACTCGCATAGGGGAAACGTATGAGGAAATCATAGAGGAAACTGTTGTATCAACTAAGAAACAGAATAAGCCAGATCAA
  5   1   2       bld BrSp      in                      EC2BBA7CE08.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGATGGAGGACAGACACATGGCAGAGACCGCCGGGCTCCAGGATACCATTAACCAGCTGGAAAATGAATTGAGAAACACAAAAGGCGAAATGGCTCGACACCTGCGTGAATATCAGGATCTCCTTAATGTCAAAATGGCCCTGGATATTGAGATAGCCGCATACAGGAAATTGCTGGAGGGTGAAGAAACCAGGTTCAGCACAGCAGGAATTAGCATGATGCCTTTTAATCCAAATCCTCCCCCAAGTTACTCTTATCAGTCCCGGGTTCATAGTTCTACCACTTCTAAGGTTACCCCTGCAGTGGATTCTAGAAAAAAGGAGGAAACTGATGGGGTCTCCAAAGTCGTCTCTAAATCATCTACTCGCATAGGGGAAACGTATGAGGAAATCATAGAGGAAACTGTTGTATCAACTAAGAAACTGGATAAGCCAGATCAAAGTGATGAAGCCTTGGTAAAACCTTAGAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Brn3      out                        CAAK3061.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAAATGGCCCTGGATATTGAGATAGCCGCATACAGGAAATTGCTGGAGGGTGAAGAAACCAGGTTCAGCACAGCAGGAATTAGCATGATGCCTTTTAATCCAAATCCTCCCCCAAGTTACTCTTATCAGTCCCGGGTTCATAGTTCTTCCACTTCTAAGGTTACCCCTGCAGTCGATTCTAGAAAAAAGGAGGAAACTGATGGGGTCTCCAAAGTCGTCTCTAAATCATCTACTCGCATAGGGGAAACGTATGAGGAAATCATAGAGGAAACTGTTGTATCAACTAAGAAACTGGATAAGCCAGATCAAAGTGATGAAGCCTTGGTAAAACCTTAGAAAAAATATCTTAGTGGGGTAATGTAATAATAGGTGCAAATTTAGCACCAGATCTAGTAACCAAAAACAACCAGTTCTGTTCTTTCAAACAGTTGACCAGTAAATGTAAGTGTAGGACTTGTGTGTCAGGNGCCCACATGGGCTGCCGCCTGAGCCCCCTACCCCAGTAGCGAGGTCCTGCTCCCCCCAGGCCACATACCGCATCCCCTCCATGATCAGGGTGGGAGTTCAGGTGCGTGCAGTTCATG
  5   1   2       bld TpA                            TTpA005p08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAATTGCTGGAGGGTGAAGAAACCCTTTTCAGCACAGCAGGAATTAGCATGATGCCTTTTAATCCAAATCCTCCCCCAAGTTACTCTTATCAGTCCCGGGTTCATAGTTCTTCCACTTCTAAGGTTACCCCTGCAGTCGATTCTAGAAAAAAGGAGGAAACTGATGGGGTCTCCAAAGTCGTCTCTAAATCATCTACTCGCATAGGGGAAACGTATGAGGAAATCATAGAGGAAACTGTTGTATCAACTAAGAAACTGGATAAGCCAGATCAAAGTGATGAAGCCTTGGTAAAACCTTAGAAAAAATATCTTAGTGGGGTAATGTAATAATAGGTGCAAATTTAGCACCAGATCTAGTAACCAAAAACAACCAGTTCTGTTCTTTCAAACAGTTGACCAGTAAATGTAAGTGTAGGACTTGTGTGTCAGGGGCCCACATGGGCTGCCGCCTGAGCCCCCTACCCCAGTAGCGAGGTCCTGCTCCCCCCAGGCCACATACCGCATCCCCTCCATGATCAGGGTGGGAGTTCAGGTGCGTGCAGTTCATGGCCCGGCAGGGGGAGGGGAAAGAGCAGGCTGGGTTGGTGGGGGGCTGCCCACTGGGCTGGGGTCCACTGGGTTTTTTCCCGGTATCCTGCTGGTCTAGTCCGACCCTGGTAAATACTATCTGCTCACTGGTTGCTATGGGTTACTAGAAGCGGCGCTAACTTTGCCACTGTTGCTACATAACCCATACAAATTAGCTAGGATACATTTTTTCACTTCATAGTCTATTCATTCACCAGCAGGAATATTATTGGAAGCCACAGGACATGTCCCAGAACTATAGGTGGCCTTTAAAAGTAATGCTG
  5   1   2       bld Brn4      in                        CAAL11386.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAAACCAGGTTCAGCACAGCAGGAATTAGCATGATGCCTTTTAATCCAAATCCTCCCCCAAGTTACTCTTATCAGTCCCGGGTTCATAGTTCTTCCACTTCTAAGGTTACCCCTGCAGTCGATTCTAGAAAAAAGGAGGAAACTGATGGGGTCTCCAAAGTCGTCTCTAAATCATCTACTCGCATAGGGGAAACGTATGAGGAAATCATAGAGGAAACTGTTGTATCAACTAAGAAACTGGATAAGCCAGATCAAAGTGATGAAGCCTTGGTAAAACCTTAGAAAAAATATCTTAGTGGGGTAATGTAATAATAGGTGCAAATTTAGCACCAGATCTAGTAACCAAAAACAACCAGTTCTGTTCTTTCAAACAGTTGACCAGTAAATGTAAGTGTAGGACTTGTGTGTCAGGGGCCCACATGGGCTGCCGCCTGAGCCCCCTACCCCAGTAGCGAGGTCCTGCTCCCCCCAGGCCACATACCGCATCCCCTCCATGATCAGGGTGGGAGTTCAGGTGCGTGCAGTTCATGGCCCGGCAGGGGGAGGGGAAAGAGCAGGCTGGGTTGGTGGGGGGCTGCCCACTGGGCTGGGGTCCACTGGGTTTTTTCCCGGTATCCTGCTGGTCTAGTCCGACCCTGGTAAATACTATCTGCTCACTGGTTGCTATGGGTTACTAGAAGCGGCGCTAACTTTGCCACTGTTGCTACATAACCCATACAAATTAGCTAGGATACATTTTTTCACTTCATAGTCTATTCATTCACCAGCAGGAATATTATTGGAAGCCACAGGACATGTCCCAGAACTATAGGTGGCCTTTAAAAGTAATGCTGCCACCTAAAACATACCATTTGTAGTAATAGTAG
  5   1   2       bld Tad5      in                          XZT8882.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGATGGGGTCTCCAAGTCGTCTCTAAATCATCTACTCGCATAGGGGAAACGTATGAGGAAATCATAGAGGAAACTGTTGTATCAACTAAGAAACTGGATAAGCCAGATCAAAGTGATGAAGCCTTGGTAAAACCTTAGAAAAAATATCTTAGTGGGGTAATGTAATAATAGGTGCAAATTTAGCACCAGATCTAGTAACCAAAAACAACCAGTTCTGTTCTTTCAAACAGTTGACCAGTAAATGTAAGTGTAGGACTTGTGTGTCAGGGGCCCACATGGGCTGCCGCCTGAGCCCCCTACCCCAGTAGCGAGGTCCTGCTCCCCCCAGGCCACATACCGCATCCCCTCCATGATCAGGGTGGGAGTTCAGGTGCGTGCAGTTCATGGCCCGGCAGGGGGAGGGGAAAGAGCAGGCTGGGTTGGTGGGGGGCTGCCCACTGGGCTGGGGTCCACTGGGTTTTTTCCCGGTATCCTGCTGGTCTAGTCCGACCCTGGTAAATACTATCTGCTCACTGGTTGCTATGGGTTACTAGAAGCGGCGCTAACTTTGCCACTGTTGCTACATAACCCATACAAATTAGCTAGGATACATTTTTTCACTTCATAGTCTATTCATTCACCAGCAGGAATATTATTGGAAGCCACAGGACATGTCCCAGAACTATAGGTGGCCTTTAAAAGTAATGCTGCCACCTAANACATACCATTTGTAGTAATAGTAGTTAAAAGCCCAATGCAGCTTGAGCTACTAGGGCCTTGCAATACACACTGCCCCACAGCAAGATCAGTTGTCCTCTATGGGACACTGAGATGAGACGCTGGCTCTGCATGGGTTACAAAAGGCATTGCTACA
  5   1   2       bld Brn4      in                        CAAL12078.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAATCATAGAGGAAACTGTTGTATCAACTAAGAAACTGGATAAGCCAGATCAAAGTGATGAAGCCTTGGTAAAACCTTAGAAAAAAATATCTTAGTGGGGTAATGTAATAATAGGTGCAAATTTAGCGCCAGATCTAGTAACCAAAAACAACCAGTTCTGTTCTTTCAAACAGTTGACCAGTAAATGTAAGTGTAGGACTTGTGTGTCAGGGGCCCACATGGGCTGCCGCCTGAGCCCCCTACCCCAGTAGCGAGGTCCTGCTCCCCCCAGGCCACATACCGCATCCCCTCCATGATCAGGGTGGGAGTTCAGGTGCGTGCAGTTCATGGCCCGGCAGGGGGAGGGGAAAGAGCAGGCTGGGTTGGTGGGGGGCTGCCCACTGGGCTGGGGTCCACTGGGTTTTTTCCCGGTATCCTGCTGGTCTAGTCCGACCCTGGTAAATACTATCTGCTCACTGGTTGCTATGGGTTACTAGAAGCGGCGCTAACTTTGCCACTGTTGCTACATAACCCATACAAATTAGCTAGGATACATTTTTTCACTTCATAGTCTATTCATTCACCAGCAGGAATATTATTGGAAGCCACAGGACATGTCCCAGAACTATAGGTGGCCTTTAAAAGTAATGCTGCCACCTAAAACATACCATTTGTAGTAATAGTAGTTAAAAGCCCAATGCAGCTTGAGCTACTAGGGCCTTGCAATACACACTGCCCACAAGCAAGATCAGTTGTCCTCTATGGGACACTGAGATGAGACGCTGGCTCTGGATGGGTTACAAAAAGCCATTGCTACAGATTGGTCAGGCAAGCAATCATATAAATAAGGTACTTTCTATGGAGCCGGGGCACTTATC
  5   1   2       bld Tad5      in                         XZT21208.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGATAAGCCAGATCAAAGTGATGAAGCCTTGGTAAAACCTTAGAAAAAATATCTTAGTGGGGTAATGTAATAATAGGTGCAAATTTAGCACCAGATCTAGTAACCAAAAACAACCAGTTCTGTTCTTTCAAACAGTTGACCAGTAAATGTAAGTGTAGGACTTGTGTGTCAGGGGCCCACATGGGCTGCCGCCTGAGCCCCCTACCCCAGTAGCGAGGTCCTGCTCCCCCCAGGCCACATACCGCATCCCCTCCATGATCAGGGTGGGAGTTCAGGTGCGTGCAGTTCATGGCCCGGCAGGGGGAGGGGAAAGAGCAGGCTGGGTTGGTGGGGGGCTGCCCACTGGGCTGGGGTCCACTGGGTTTTTTCCCGGTATCCTGCTGGTCTAGTCCGACCCTGGTAAATACTATCTGCTCACTGGTTGCTATGGGTTACTAGAAGCGGCGCTAACTTTGCCACTGTTGCTACATAACCCATACAAATTAGCTAGGATACATTTTTTCACTTCATAGTCTATTCATTCACCAGCAGGAATATTATTGGAAGCCACAGGACATGTCCCAGAACTATAGGTGGCCTTTAAAAGTAATGCTGCCACCTAAAACATACCATTTGTAGTAATAGTAGTTAAAAGCCCAATGCAGCTTGAGCTACTAGGGCCTTGCAATACACACTGCCCACAAGCAAGATCAGTTGTCCTCTATGGGACACTGAGATGAGACGCTGGCTCTGCATGGGTTACAAAAGGCCATTGCTACAGATTGGTCAGGCAAGCAATCATAT
  5   1   2       bld Brn2      in                         CAAJ6485.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTGCTCCCCCCAGGCCACATACCGCATCCCCTCCATGATCAGGGTGGGAGTTCAGGTGCGTGCAGTTCATGGCCCGGCAGGGGGAGGGGAAAGAGCAGGCTGGGTTGGTGGGGGGCTGCCCACTGGGCTGGGGTCCACTGGGTTTTTTCCCGGTATCCTGCTGGTCTAGTCCGACCCTGGTAAATACTATCTGCTCACTGGTTGCTATGGGTTACTAGAAGCGGCGCTAACTTTGCCACTGTTGCTACATAACCCATACAAATTAGCTAGGATACATTTTTTCACTTCATAGTCTATTCATTCACCAGCAGGAATATTATTGGAAGCCACAGGACATGTCCCAGAACTATAGGTGGCCTTTAAAAGTAATGCTGCCACCTAAAACATACCATTTGTAGTAATAGTAGTTAAAAGCCCAATGCAGCTTGAGCTACTAGGGCCTTGCAATACACACTGCCCACAAGCAAGATCAGTTGTCCTCTATGGGACACTGAGATGAGACGCTGGCTCTGGATGGGTTACAAAAGGCCATTGCTACAGATTGGTCAGGCAAGCAATCATATAAATAAGGTACTTTCTATGGAGCCGGGGCACTTATCTTCTGGCTGCCCCCTGGCATACCTACCACTCTGCCCTCTCCAGTGAGAAATAAGCTGCAAACAAAAATAATCAAATAGGCACCCGATATTCTCCAAACATGTTCTAAAAGTGATTGGCCATTGGAAACTATCANACTGGGCCTGGACAAATTCTACTATCAGACAGTGCCATTGGTGCAGGTTTGGCAATGGATCTCATATCAACTACATTTCCCAGCATTCCCCTACCAGCATAGTTAGCCAGTGGATATTGAGATCTCTTGAAATCTATGATACCTG
  5   1   2       bld Tbd0      in                       IMAGE:6977485                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACTGGGTTTTTTCCCGGTATCCTGCTGGTCTAGTCCGACCCTGGTAAATACTATCTGCTCACTGGTTGCTATGGGTTACTAGAAGCGGCGCTAACTTTGCCACTGTTGCTACATAACCCATACAAATTAGCTAGGATACATTTTTTCACTTCATAGTCTATTCATTCACCAGCAGGAATATTATTGGAAGCCACAGGACATGTCCCAGAACTATAGGTGGCCTTTAAAAGTAATGCTGCCACCTAAAACATAGCATTTGTAGTAATAGTAGTTAAAAGCCCAATGCAGCTTGAGCTACTAGGGCCTTGCAATACACACTGCCCACAAGCAAGATCAGTTGTCCTCTATGGGACACTGAGATGAGACGCTGGCTCTGCATGGGTTTACAAAAAGCCATTGCTACAGATTGGGTCAGGCAAGCCAATCATATAAAATAAGGTACTTTTCAATTGAAGCCCGGGGGCACTTTATCTTTCCGGGCTGCCCCCCTGGCCATTACCTACCACTTCTGCCCCTTTTCCAGGGGAAAAAAAAAAGCTGGCCAAACCAAAAATTAATTCCAAATTAGGGGCCCCCCCAAAAATTTTTTCCCAAAAAATGGGTTTCTTAAAAAAATGGGATTTGGGGCCCATTTGGGGAAAAACTCTTTTCTCAAAACTTGGGGGGCCCCTTGGGAAAAAAAAAATTTCTCTAACTTTTTCCGAAAAAACGTGGGGGCCCCCATTTTGGGTGTGCCCAAGGGTTTTTTGGGGCCCAAAAGGGGGGATATCTTTACAAATAAAAACAA
  5   1   2       bld Tad5      in                         XZT56828.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCGGCGCTAACTTTGCCACTGTTGCTACATAACCCATACAAATTAGCTAGGATACATTTTTTCACTTCATAGTCTATTCATTCACCAGCAGGAATATTATTGGAAGCCACAGGACATGTCCCAGAACTATAGGTGGCCTTTAAAAGTAATGCTGCCACCTAAAACATACCATTTGTAGTAATAGTAGTTAAAAGCCCAATGCAGCTTGAGCTACTAGGGCCTTGCAATACACACTGCCCACAAGCAAGATCAGTTGTCCTCTATGGGACACTGAGATGAGACGCTGGCTCTGCATGGGTTACAAAAGGCCATTGCTACAGATTGGTCAGGCAAGCAATCATATAAATAAGGTACTTTCTATGGAGCCGGGGCACTTATCTTCTGGCTGCCCCCTGGCATACCTACCACTCTGCCCTCTCCAGTGAGAAATAAGCTGCAAACAAAAATAATCAAATAGGCGCCCGATATTCTCCAAACATGTTCTAAAAGTGATTGGCCATTGGAAACTATCAAACTGGGCCTGGACAAATTCTACTATCAGACAGTGCCATTGGTGCAGGTTTGGCAATGGATCTCATATCAACTACATTTCCCAGCATTCCCCTACCAGCATAGTTAGCCAGTGGATATTGAGATCTCTTGAAATCTAATGATACCTGCCTAAATAAAAACCCATATCANATGTGTTGATAAGTCTTGTTGGCATTTCCAGTGCATAATCACATGCATGGTGACCATCACCACCAAGTGTAATGTCGTAATCGCTCATTGATAGGAGAACATTAGTCTTTTATGTACCGA
  3   1   2       chi Tbd0      in                       IMAGE:6977485                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           NTTATTACAGTATACTCCTTTGCTTCTGAAGTCGGCTATATATCGTAGCCGTCATATGTGGGGGTGATATGACCAGAGATGTGTCGTTTGATAGTCACATAGTATGGGTTGATTTTTGTGTTTGCCTGGTGTTNTTTTAGCAGTAGATGCTTTAACCCATTTAGTTTGTCTATCGCGCAAGGAACGCAATGTTTTTCCCCCCTCCCCGGTATATCTTCCACATATTGCCTAAAGTTAAAGGTGTGTTTTTATTGACACCTAACCCGAGGAGTGGGGGAAAAACTGGAATTCTCGGAGTTGGGGGAAATTTTTGCGTTTTGTTTTCGTTGAGGAGGACAATATATTTTCTTTTTGAAAGTAAAATTTTGGTAGGAATTAACTGCCCCCCTTATGTGAACCATATTTTTTGTGGTCAAAGTATAGTATGCAGAATAAAAGTTCGCCTCGCGCCGTATTTATTTTTTGTGGGAGGAAAAGAATTATGGGGGGGAGTTCGCGTATTCAAATTGCAAANATAGAATTTCTCGTTTTGTCGTGGGGGTGTTGGGGGAGGACCAAATGTNTTGTTTGTCACTGCAGAGGGGTGTGGCGCATTATTATATATTTTACCGTTCCAATTGGGGACATTTAGGGGTTTATGTAACACCTTTTATCAAACCACTAACCTCGAAAGGTGTGGATAATAGATTTTACGGTTAAAGTTCAGGGCTACAATTTGAGATTAGGGGAGGAAAACCGTTTAGGTTTTTTTGTAAATTGACCTGGTATATTCCAAAGGACATTTTCCGCCAATGGTTTGGCAAATTGATGGCGTTAAGACATTTGGGGATGTTATTATGATCGATAAGTCAATAAATAACATTGGTTTTTGACGTGGGGTCCACCTTTATCTTAAAGGCACAGTAGTTAGAAATTTTAACGTTAAACCTAGAAGTTAGCCTTTAATCAATTCATGTGATATTTTAACCACTTTACAGGTAAATAACCAGCTTTCATATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCACCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATCCTTGACCGGTTATAGTAGTCAAGCTATTAGATTGTGAGCAGCGTCCGTAC
  5   1   2       bld TpA                            TTpA048j03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTGGAAGCCACAGGACATGTCCCAGAACTATAGGTGTGCCTTTAAAAGTAATGCTGCCACCTAAAACATACCATTTGTAGTAATAGTAGTTAAAAGCCCAATGCAGCTTGAGCTACTAGGGCCTTGCAATACACACTGCCCACAAGCAAGATCAGTTGTCCTCTATGGGACACTGAGATGAGACGCTGGCTCTGCATGGGTTACAAAAGGCCATTGCTACAGATTGGTCAGGCAAGCAATCATATAAATAAGGTACTTTCTATGGAGCCGGGGCACTTATCTTCTGGCTGCCCCCTGGCATACCTACCACTCTGCCCTCTCCAGTGAGAAATAAGCTGCAAACAAAAATAATCAAATAGGCACCCGATATTCTCCAAACATGTTCTAAAAGTGATTGGCCATTGGAAACTATCAAACTGGGCCTGGACAAATTCTACTATCAGACAGTGCCATTGGTGCAGGTTTGGCAATGGATCTCATATCAACTACATTTCCCAGCATTCCCCTACCAGCATAGTTAGCCAGTGGATATTGAGATCTCTTGAAATCTAATGATACCTGCCTAAATAAAAACCCATATCAAATGTGTTGATAAGTCTTGTTGGCATTTCCAGTGCATAATCACATGCATGGTGACCATCACCACCAAGTGTAATGTCGTAATCGCTCATTGATAGGAGAACATTAGTCTTTTATGTACCGAATACAAGACATTCCGCCATCTTTACACTTTAGACTTAGACACTGGGATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGNGGTCCACCTTATCTTNAAGCACAGTAGTTAGAATTNTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACACTTTAC
  5   1   2       bld TpA       out                 TTpA048j04.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTAAAAGTAATGCTGCCACCTAAAACATACCATTTGGAGTAATAGTAGTTAAAAGCCCAATGCAGCTTGAGCTACTAGGGCCTTGGAATACACACTGCCCACAAGCAAGATCAGTTGTCCTCTATGGGACACTGATATGAGACGCTGGGTCTGCATGGGTTACAAAAGGCCATTGCTACAGATTGGTCAGGCAAGCAATCATATAAATAAGGTACTTTCTATGGAGCCGGGGCACTTATCTTCTGGCTGCCCCCTGGCATACCTACCACTCTGCCCTCTCCAGTGAGAAATAAGCTGCAAACAAAAATAATCAAATAGGCACCCGATATTCTCCAAACATGTTCTAAAAGTGATTGGCCATTGGAAACTATCAAACTGGGCCTGGACAAATTCTACTATCAGACAGTGCCATTGGTGCAGGTTTGGCAATGGATCTCATATCAACTACATTTCCCAGCATTCCCCTACCAGCATAGTTAGCCAGTGGATATTGAGATCTCATGAAATCTAATGATACCTGCCTAGATAAAAACCCATATCAAATGTGTTGATAAGACTTGTTGGCATTTCCAGTGCATAATCACATGCGTGGTGACCATCACCACCAAGTGTAATGTCGTAATCGCTCATTGATAGGAGAACATTAGTCTTTTATGT
  5   1   2       bld Brn3      in                         CAAK7242.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGCAAACAAAAATAATCAAATAGGCACCCGATATTCTCCAATCACTTTTAGAACATGTTTGGAGAATATCAAACTGGGCCTGGACAAATTCTACTATCAGACAGTGCCATTGGTGCAGGTTTGGCAATGGATCTCATATCAACTACATTTCCCAGCATTCCCCTACCAGCATAGTTAGCCAGTGGATATTGAGATCTCTTGAAATCTAATGATACCTGCCTAAATAAAAACCCATATCAAATGTGTTGATAAGTCTTGTTGGCATTTCCAGTGCATAATCACATGCATGGTGACCATCACCACCAAGTGTAATGTCGTAATCGCTCATTGATAGGAGAACATTAGTCTTTTATGTACCGAATACAAGACATTCCGCCATCTTTACACTTTAGACTTAGACACTGGGATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGGGGTCCACCTTATCTTAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGAT
  3   1   2       bld Tbd0 5x3  out                      IMAGE:6977576                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGATAGTCGGGGATGGAGTATCTAAGCGGTATGGGGGCCATTTTTCACGACATGTGCCAATATAGTCCTACCTTTAGACAAGGGTGGGGAGCCAATTTATAATCCTACACAATAGTTAGTTAAAAGTGTGCCGTAAATATGCGCATCCCATGGGGACTGAGGGGAGGGAAACCATTTGGGTTTCTTTTTTTGAGGGTAACCGGGGANTTTACATATGATCCGTTTTCCCCGCCATATTTTTTATACCAATGTTTGAGAAACTTTAGGAACCATTTGGGGGATGGTTAATATTGATGCCATAATGTCAAATTAGGGTAACCCATTGCCTTTTTCTTAACGGTGGGGGGGTTCCCACCTTTATTGGTTTAAAAGCCACCAGTAGGTTTGGGAATTTTAAACCTTTAAACCTAAAAACTTAGGCCTTTAATCAAATTTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAATCAAATTTTTGCACATGGTGTGTTTGCTTCCGAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGTTGTGTAGTTGACTAAGCTGTGGGTAAGAACGAATACGAGTAATAAACTTGCTTGGAATTACAAGGGGGATTCAACTGGGAAATAAAATGTAAAAGAT
  3   1   2       bld Brn3      in                        CAAK11444.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGACAGTGCCATTGGTGCAGGTTTGGCATGGATCTCATATCAACTACATTTCCCAGCATTCCCCTACCAGCATAGTTAGCCAGTGGATATTGAGATCTCTGAAAATCTAATGATACCTGCCTAAATAAAAACCCATATCAAATGTGTTGATAAGTCTTGTTGGCATTTCCAGTGCATAATCACATGCATGGTGACCATCACCACCAAGTGTAATGTCGTAATCGCTCATTGATAGGAGAACATTAGTCTTTTATGTACCGAATACAAGACATTCCGCCATCTTTACACTTTAGACTTAGACACTGGGATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGGGGTCCACCTTATCTTAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCC
  3   1   2       bld Brn3      in                         CAAK1790.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATATCAACTACATTTCCCAGCATTCCCCTACCAGCATAGTTAGCCAGTGGATATTGAGATCTCTTGAAATCTAATGATACCTGCCTAAATAAAAACCCATATCAAATGTGTTGATAAGTCTTGTTGGCATTTCCAGTGCATAATCACATGCATGGTGACCATCACCACCAAGTGTAATGTCGTAATCGCTCATTGATAGGAGAACATTAGTCTTTTATGTACCGAATACAAGACATTCCGCCATCTTTACACTTTAGACTTAGACACTGGGATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGGGGTCCACCTTATCTTAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACGGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCC
  3   1   2       bld Tad5      in                         XZT27107.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCAGCATAGTTAGCCAGTGGATATTGAGATCTCTTGAAATCTAATGATACCTGCCTAAATAAAAACCCATATCAAATGTGTTGATAAGTCTTGTTGGCATTTCCAGTGCATAATCACATGCATGGTGACCATCACCACCAAGTGTAATGTCGTAATCGCTCATTGATAGGAGAACATTAGTCTTTTATGTACCGAATACAAGACATTCCGCCATCTTTACACTTTAGACTTAGACACTGGGATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGGGGTCCACCTTATCTTAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAAAAAAAAGG
  3   1   2       bld Brn3      in                         CAAK5226.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCATAGTTAGCCAGTGGATATGAGATCTCTGAAAAATCTAATGATACCTGCCTAAATAAAAACCCATATCAAATGTGTTGATAAGTCTTGTTGGCATTTNCAGTGCATAATCACATGCATGGTGACCATCACCACCAAGTGTAATGTCGTAATCGCTCATTGATAGGAGAACATTAGTCTTTTATGTACCGAATACAAGACATTCCGCCATCTTTACACTTTAGACTTAGACACTGGGATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGGGGTCCACCTTATCTTAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCC
  3   1   2       bld Brn4      in                        CAAL11386.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATGATACCTGCCTAAATATAAACCCATATCAAATGTGTTGATAAGTCTTGTTGGCATTTCCAGTGCATAATCACATGCATGGTGACCATCACCACCAAGTGTAATGTCGTAATCGCTCATTGATAGGAGAACATTAGTCTTTTATGTACCGAATACAAGACATTCCGCCATCTTTACACTTTAGACTTAGACACTGGGATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGGGGTCCACCTTATCTTAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCC
  3   1   2       bld Brn4      in                        CAAL12078.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATGATACCTGCCTAAATAAAAACCCATATCAAATGTGTTGATAAGTCTTGTTGGCATTTCCAGTGCATAATCACATGCATGGTGACCATCACCACCAAGTGTAATGTCGTAATCGCTCATTGATAGGAGAACATTAGTCTTTTATGTACCGAATACAAGACATTCCGCCATCTTTACACTTTAGACTTAGACACTGGGATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGGGGTCCACCTTATCTTAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCC
  3   1   2       bld Brn3 PIPE in                        CAAK12456.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAAATAAAAACCCATATCAAATGTGTTGATAAGTCTTGTTGGCATTTCCAGTGCATAATCACATGCATGGTGACCATCACCACCAAGTGTAATGTCGTAATCGCTCATTGATAGGAGAACATTAGTCTTTTATGTACCGAATACAAGACATTCCGCCATCTTTACACTTTAGACTTAGACACTGGGATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGGGGTCCACCTTATCTTAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCC
  3   1   2       bld Tad5      in                         XZT51129.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAAAACCCATATCAAATGTGTTGATAAGTCTTGTTGGCATTTCCAGTGCATAATCACATGCATGGTGACCATCACCACCAAGTGTAATGTCGTAATCGCTCATTGATAGGAGAACATTAGTCTTTTATGTACCGAATACAAGACATTCCGCCATCTTTACACTTTAGACTTAGACACTGGGATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGGGGTCCACCTTATCTTAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAAAAAAAAGG
  3   1   2       bld Brn2      in                         CAAJ6485.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCATATCAAATGTGTTGATAAGTCTTGTTGGCATTTCCAGTGCATAATCACATGCATGGTGACCATCACCACCAAGTGTAATGTCGTAATCGCTCATTGATAGGAGAACATTAGTCTTTTATGTACCGAATACAAGACATTCCGCCATCTTTACACTTTAGACTTAGACACTGGGATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGGGGTCCACCTTATCTTAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCC
  3   1   2       bld Brn3      in                         CAAK2448.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTGTTGATAAGTCTTGTTGGCATCTCCAGTGCATAATCACATGCATGGTGACCATCACCACCAAGTGTAATGTCGTAATCGCTCATTGATAGGAGAACATTAGTCTTTTATGTACCGAATACAAGACATTCCGCCATCTTTACACTTTAGACTTAGACACTGGGATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGGGGTCCACCTTATCTTAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCC
  5   1   2      seed Tad5                                 XZT70608.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGTTGGCATTTCCAGTGCATAATCACATGCATGGTGACCATCACCACCAAGTGTAATGTCGTAATCGCTCATTGATAGGAGAACATTAGTCTTTTATGTACCGAATACAAGACATTCCGCCATCTTTACACTTTAGACTTAGACACTGGGATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGGGGTCCACCTTATCTTAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCANAAAAAAAATCAAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGCTGTGTAGTTGACTAAGCTGTGGGTA
  3   1   2       bld TbA  5g3  in                    TTbA021j08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAATCGCTCATGATAGGGAGAACATTAGTCTTTTATGTACCGAATACAAGACATTCCGCCATCTTTACACTTTAGACTTAGACACTGGGATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGGGGTCCACCTTATCTTAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACGGTCAGCGTCACAATAAACTAAATGTACGCTCCGACCTATAGATGTGCCGAAGTGAA
  3   1   2       bld TpA       in                    TTpA022o02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATAGGAGAACATTAGTCTTTTATGTACCGAATACAAGACATTCCGCCATCTTTACACTTTAGACTTAGACACTGGGATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGGGGTCCACCTTATCTTAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCACCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAATCAAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGTTGTGTAGTTGACTAAGCTGTGGGTAAGAACGAATACGAGGAATGAAATAAACTGCTTGGCATCT
  5   1   2       bld Tbd1      in                        CBXT13043.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATTAGTCTTTTATGTACCGAATACAAGACATTCCGCCATCTTTACACTTTAGACTTAGACACTGGGATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGGGGTCCACCTTATCTTAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAATCAAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACA
  3   1   2       bld Brn3      in                         CAAK7242.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGACTTAGACACTGGGATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGGGGTCCACCTTATCTTAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCCCATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACCCCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCCCAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAATCAAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGTTGTGTAGTTGACTAAGCTGTGGGTAAGAACGAATACGAGGAATGAAATAAACTGCTTTGGCATCTGTC
  3   1   2       bld Brn3      in                        CAAK10897.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGGGGTCCACCTTATCTTAAAGCACAGTAGTTAGAATTTTAACCTAAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAATCAAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGCTGTGTAGTTGACTAAGCTGTGGGTAAGAACGAATACGAGGAATGAAATAAACTGCTTTGGCATCTGTC
  3   1   2       bld Tad5      in                         XZT21208.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGTATATGATCATAATCAATAAATAACATGCTTTCTGACGTGGGGTCCACCTTTCTTAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAATCAAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGCTGTGTAGTTGACTAAGCTGTGGGTAAGAACGAATACGAGGAATGAAATAAACTGCTTTGGCATCTG
  3   1   2       bld Tbd1      in                        CBXT13043.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGGGGTCCACCTTATCTTAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAATCAAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTTTGAAATGCTGTGTAGTTGACTAAGCTGTGGGTAAGAACGAATACGAGGAATGAAATAAACTGCTTTGGCATCTGAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT56828.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAAGCACAGTAGTTAGAATTTTAACCTTAAACCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAATCAAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGTTGTGTAGTTGACTAAGCTGTGGGTAAGAACGAATACGAGGAACGAAATAAACTGCTTTGGCATCTGTC
  5   1   2       bld TpA       in                   TTpA006n19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAGACAGTAGTTAGAATTTTAACCTTAAATCTAGAACTTAGCCTTTAATCAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAATCAAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGTTGTGTAGTTGACTAAGCTGTGGGTAAGAACGAATACGAGGAATGAAATAAACTGCTTTGGCATCTGTC
  3   1   2       bld Tad5      in                          XZT5982.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCACGCGTCCGAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAATCAAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGCTGTGTAGTTGACTAAGCTGTGGGTAAGAACGAATACGAGGAATGAAATAAACTGCTTTGGCATCTGTCAAAAAAAAAAAAAAAGG
  3   1   2       bld Brn3 5g3  in                         CAAK5372.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAATTCATGTGATATCTTAACCACTTTACAGGTAAATAACCAGCTTCCNTATGTTGAGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAATCAAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGCTGTGTAGTTGACTAAGCTGTGGGTAAGAACGAATACGAGGAATGAAATAAACTGCTTTGGCATCTGTC
  5   1   2       bld Tad5      in                          XZT5982.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTACCACTTTACAGGTAAATAACCAGCTTTCCTATGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAATCAAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGCTGTGTAGTTGACTAAGCTGTGGGTAAGAACGAATACGAGGAATGAAATAAACTGCTTTGGCATCTGTCAAAAAAAAAAAAAAAGG
  3   1   2       bld Tad5      in                          XZT8882.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTTTGGTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGGCACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAGCCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCCCAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAATCAAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACT
  5   1   2       bld Tbd1      in                        CBXT21200.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGACACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAACCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTGTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAATCAGAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGTTGTGTAGTTGACTAAGCTGTGGGTAAGAACGAATACGAGGAATGAAATAAACTGCTTTGGCATCTGTTAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                        CBXT21200.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCAAAGTAACAGTTAGACGTGTTGTGGTAACGGTGCACAGACACAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAACCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTGTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAATCAGAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGTTGTGTAGTTGACTAAGCTGTGGGTAAGAACGAATACGAGGAATGAAATAAACTGCTTTGGCATCTGTTAAAAAAAAAAAAAAA
  3   1   2       bld HeRe      in                      EC2CAA2BD12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAACCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAAATTAGAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGTTGTGTAGTTGACTAAGCTGTGGGTAAGAACGAATACGAG
  5   1   2       bld HeRe      in                      EC2CAA2BD12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGGTAATTTCACATTAATAAGCGCAGTAAGGAACACTAACCCGGAATCTCACATTCTCACAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAAATTAGAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGTTGTGTAGTTGACTAAGCTGTGGGTAAGAACGAATACGAGGAATGAAATAAACTGCTTTGGCATCTGCCAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Brn3                                CAAK13045.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAATCAAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGCTGTGTAGTTGACTAAGCTGTGGGTAAGAACGAATACGAGGAATGAAATAAACTGCTTTGGCATCTGTCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld TpA       in                    TTpA005c02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAACCAGTGGGGCTTATGGGCCCCAGTGCACAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAATCAAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGCTGTGTAGTTGACTAAGCTGTGGGTAAGAACGAATACGAGGAATGAAATAAACTGCTTTGGCATCTGAAAAAAAAAAAAAAAAAA
  3   1   2       bld HeRe                             EC2CAA32DE09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAGGCGCCCCTTGCTCATTAGGGGATGGTTTATTTGCACCCCTGCCAGCTACACCACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAAAAATAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAAGTACACTCCAACCTATAGATGTGCCAAGGAACAACATGA
  5   1   2       bld Tad5                                 XZT25892.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACTGCTCACAGCTGCCACTGTATTATATATAATATTGCTAAGAAAGCTTTGACTTGATTCACAAATACATTGTAACACCAAAGAGGAGCCTTAGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAATCAAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGCTGTGTAGTTGACTAAGCTGTGGGTAAGAACGAATACGAGGAATGAAATAAACTGCTTTGGCATCTGTCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGG
  3   1   2       bld TpA       in                    TTpA006n19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGATCACAGATTTAATGGAGGGATGACAGTCAGCGTCACAATAAACTAAATGTACACTCCAACCTATAGATGTGCCAAGTGAACAACATGGAATTCCCAATGCCTTATTACCAGCAACTGTAATCCAAAAAAAAAATCAAATTTTTGCACATGGTGTGTTTGCTTCCAGATTGTTCACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGTTGTGTAGTTGACTAAGCTGTGGGTAAG
  5   1   2       bld HeRe                             EC2CAA32AE09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACAGATGGTTAATTGGTTTCACTGAACACTGTGGTCTGAAATGTTGTGTAGTTGACTAAGCTGTGGGTAAGAACGAATACGAGGAATGAAATAAACTGCTTTGGCATCTGTTAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)