Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012074083 Xt7.1-CABD9769.3 - 49 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABD9769.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTATACTGAAGCAGCGTCACAAGGAAAAGGAGGAGTACATTAGCCGACTGGCTCAGGACAAGGAAGAGATGAAGGCGAAGCTGCTGGAACTGCAAGTCCTGGTCATGAGGCTGGTGTCTGAGCGCAATGAGTGGTACCGGAGGTTTGTGGAAGCCACCCAGGGTCCCCACATAGGCTCCCCAGAGTTCCCTGCAGAAAATCTTATGGCACTTGAGGCAAAAGAAAATGGAGCTCTGGAGGAAGTCAGCTTAGAAGAGGATGGGGAACAGGAGGAAGTCCAGTTGTTGTCACATTTGGCAGCCCCTCAGGAAGGACCAAACCCGAGCCCTGAATCAGAAGACCCAACCACTAAACAAATTATGCAACTTCTGCATGAGATACAGAACCCGCAGGAACGGCCCAGCGCCCTGCTGCAAAATCCCTGCATCCCCTTTTTCTACCGTGCTGACGAGAACGACGAGGTCCGAATTATGGTGATTTGAGGGGGGGGAGGAGTTGACCGATCTGCCCAACCCTCCTCCTTTCCATGCCAACACCTTCTTGTGCTGGAATTCATTTTCTCCAAGGACACATTAGAAGTGATTACTTTGGGATGGGGGAGGGCTGGAGATTGGCTGTTAGTGGGATGGATGTAGAGAACTGTTGCCTTCCTGCGCTGAATGGGGCTCAGTGAATAATCTGTGAACCAGGAAATGTGCAGTATTGCCTTCCACCCAGGCCAATGGATTGTACCATTCAGCACCGGCTCTAGTAATAAGCTGCTATTTCCATCTGCTCCCCTTGGAGGGGCTCAACCACATCCACTTGAATAGTCGCTCTAATTTCCAGAATTTATTTTTATTTGTACATATCTGAAGCACTACTGTTTGGTATGATGTTGACAGCAAGGAGGAATGGTGGTTTGGGAATGAAGTGGAGAGTTAGACTGTTGCAGATTCAAGTCCTTAATCCTTGGTCTTGTACCTGACTGGTGTAAAGGCGAAGGTGCCCGACGTAGAATAAACTGTTCAGGCTGGCAGAGCAGAAGAGATTGTATAAGGAATCCTTTGTGACTCCAGGAAAGAGTGCTTATTCTAGAACTTTATTTTAGAACGTTGGCTAAAGGCAGGCTATGGGCGTTGCATGTTACTATGCAGCCCATGGAATCTCTTTCCTTGCATTGAGCCCATCCAATATCCATGACCTGCGTGGGAAGAGATTTTAGACTGTTTTAACATCTGCAGAAATGAACCATACATTCTACATAGAAAGCTGAGAAATGGGCAGAACACAAGATATTTTGAAAGTGATAAGATGAAGTGCAGGGAGGTTAAAGAGGCTGTATCCAAAGTCAGTTCTTTTAATAGAATGCTAGTGATCTATCTGCTGATGACTGAAAAGCAAGACTGGACCCAGTCCGTTGTTAGTCAGCTCTGCAGTCTGGTGGTACCAGTACAGTCCAGCTTCATAAAAGGCACAAGGGGGTTTCTCTTCCGTGTTTGTTTTTATATAAGGAGTAGCAGAAGACATAGACCTGAGCAGTTGATAAATAATACCCTGACAAGCAATTACACAAGCTGAACCATATTTATTGCATATTTAAAAAAATCATTGCCCTGCAGTGCACCGTGCACCTTGAGATCCTGTGGAATTTGCACCTCTCTGCTTAAAGGGGACATGGACCCTACTGTATGACAATGTCCAGTGTCTTAAGTGCCCTGAACACTTTTTCTATTTACATTCATTTAGATTTCATGATATAAACAATGTTTCCAGTTTTTTTTAGCCCAGGCGCCGGCTGGATAGAGCAGCAAAAGCTGCCCTATCCAGAGCGGTCATCTCAGGGAACACAGGGAACGTATGGGGCTAAGCTCCACCTTCCACAAGGCAGGACACTGTGACACAAAGTGTCCTGTTTCTAGGAGTTGGACCCCCCATGTCTCTAGTGAGACCCTAGAGGAAATCATCGGACAGTGATTAGCACTGACACCTGGGCAAAACCTGGAGCAGGACTACCTGCCTCCTTACGGGTTAATCCCCCTAATCTAAATAGCCACCAGGGGTCTGCACGTAGCCTGCTCATGTCTATACTGTAATACAGAAGGCCTGGCTTGTAAGGGGTGTGGGAGTGAGTATGCTGCTCAGCCCTCTTGCTCTTCCTGCTGCTGTGCTTCTGCTCCTTACCCTCCCAAAACATCCATCCACTTTCAACCCACCTCTGACTGCCGGCCCCAGCTTACCCACAAAAACTTATTTTACTGAAGCAGGAAGTGTTTGCTGACGCTTCCCTGCTCAGCTCTCTTGTACAGTGTGACAGGAGCAATAGACCCTTTCTGCCTCAGTATATTAAGCTGTTGTTGCTGTTCTGCCAGGGCCGACAGGGGGTTACACATTCATGATAGCAGCAGCATCAAACTGCTCATATCATAAAATCTACAACAAAATTAATATTGTAAATTGCGAACAGGCACACTGAGCTGTTTTGCTTAAGTTTCATGTCCCCTTTAACAGCGAAGCTTTACAATTATCCAGGGTCATGCACTAACACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTATTGGAAATATGTTTTCCTTTCTGAATAAATGTATATTCAGTAAATCAAAAAA
                                                  Xt7.1-CHK-1008225789                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAAGCAGCGTCACAAGGAAAAGGAGGAGTACATTAGCCGACTGGCTCAGGACAAGGAAGAGATGAAGGCGAAGCTGCTGGAACTGCAAGTCCTGGTCATGAGGCTGGTGTCTGAGCGCAATGAGTGGTACCGGAGGTTTGTGGAAGCCACCCAGGGTCCCCACATAGGCTCCCCAGAGTTCCCTGCAGAAAATCTTATGGCACTTGAGGCAAAAGAAAATGGAGCTCTGGAGGAAGTCAGCTTAGAAGAGGATGGGGAACAGGAGGAAGTCCAGTTGTTGTCACATTTGGCAGCCCCTCAGGAAGGACCAAACCCGAGCCCTGAATCAGAAGACCCAACCACTAAACAAATTATGCAACTTCTGCATGAGATACAGAACCCGCAGGAACGGCCCAGCGCCCTGCTGCAAAATCCCTGCATCCCCTTTTTCTACCGTGCTGACGAGAACGACGAGGTCCGAATTATGGTGATTTGAGGGGGGGGAGGAGTTGACCGATCTGCCCAACCCTCCTCCTTTCCATGCCAACACCTTCTTGTGCTGGAATTCATTTTCTCCAAGGACACATTAGAAGTGATTACTTTGGGATGGGGGAGGGCTGGAGATTGGCTGTTAGTGGGATGGATGTAGAGAACTGTTGCCTTCCTGCGCTGAATGGGGCTCAGTGAATAATCTGTGAACCAGGAAATGTGCAGTATTGCCTTCCACCCAGGCCAATGGATTGTACCATTCAGCACCGGCTCTAGTAATAAGCTGCTATTTCCATCTGCTCCCCTTGGAGGGGCTCAACCACATCCACTTGAATAGTCGCTCTAATTTCCAGAATTTATTTTTATTTGTACATATCTGAAGCACTACTGTTTGGTATGATGTTGACAGCAAGGAGGAATGGTGGTTTGGGAATGAAGTGGAGAGTTAGACTGTTGCAGATTCAAGTCCTTAATCCTTGGTCTTGTACCTGACTGGTGTAAAGGCGAAGGTGCCCGACGTAGAATAAACTGTTCAGGCTGGCAGAGCAGAAGAGATTGTATAAGGAATCCTTTGTGACTCCAGGAAAGAGTGCTTATTCTAGAACTTTATTTTAGAACGTTGGCTAAAGGCAGGCTATGGGCGTTGCATGTTACTATGCAGCCCATGGAATCTCTTTCCTTGCATTGAGCCCATCCAATATCCATGACCTGCGTGGGAAGAGATTTTAGACTGTTTTAACATCTGCAGAAATGAACCATACATTCTACATAGAAAGCTGAGAAATGGGCAGAACACAAGATATTTTGAAAGTGATAAGATGAAGTGCAGGGAGGTTAAAGAGGCTGTATCCAAAGTCAGTTCTTTTAATAGAATGCTAGTGATCTATCTGCTGATGACTGAAAAGCAAGACTGGACCCAGTCCGTTGTTAGTCAGCTCTGCAGTCTGGTGGTACCAGTACAGTCCAGCTTCATAAAAGGCACAAGGGGGTTTCTCTTCCGTGTTTGTTTTTATATAAGGAGTAGCAGAAGACATAGACCTGAGCAGTTGATAAATAATACCCTGACAAGCAATTACACAAGCTGAACCATATTTATTGCATATTTAAAAAAATCATTGCCCTGCAGTGCACCGTGCACCTTGAGATCCTGTGGAATTTGCACCTCTCTGCTTAAAGGGGACATGGACCCTACTGTATGACAATGTCCAGTGTCTTAAGTGCCCTGAACACTTTTTCTATTTACATTCATTTAGATTTCATGATATAAACAATGTTTCCAGTTTTTTTTAGCCCAGGCGCCGGCTGGATAGAGCAGCAAAAGCTGCCCTATCCAGAGCGGTCATCTCAGGGAACACAGGGAACGTATGGGGCTAAGCTCCACCTTCCACAAGGCAGGACACTGTGACACAAAGTGTCCTGTTTCTAGGAGTTGGACCCCCCATGTCTCTAGTGAGACCCTAGAGGAAATCATCGGACAGTGATTAGCACTGACACCTGGGCAAAACCTGGAGCAGGACTACCTGCCTCCTTACGGGTTAATCCCCCTAATCTAAATAGCCACCAGGGGTCTGCACGTAGCCTGCTCATGTCTATACTGTAATACAGAAGGCCTGGCTTGTAAGGGGTGTGGGAGTGAGTATGCTGCTCAGCCCTCTTGCTCTTCCTGCTGCTGTGCTTCTGCTCCTTACCCTCCCAAAACATCCATCCACTTTCAACCCACCTCTGACTGCCGGCCCCAGCTTACCCACAAAAACTTATTTTACTGAAGCAGGAAGTGTTTGCTGACGCTTCCCTGCTCAGCTCTCTTGTACAGTGTGACAGGAGCAATAGACCCTTTCTGCCTCAGTATATTAAGCTGTTGTTGCTGTTCTGCCAGGGCCGACAGGGGGTTACACATTCATGATAGCAGCAGCATCAAACTGCTCATATCATAAAATCTACAACAAAATTAATATTGTAAATTGCGAACAGGCACACTGAGCTGTTTTGCTTAAGTTTCATGTCCCCTTTAACAGCGAAGCTTTACAATTATCCAGGGTCATGCACTAACACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTATTGGAAATATGTTTTCCTTTCTGAATAAATGTATATTCAGTAAATCAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     7     8     7     8     7     8     7     8     7     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     8     8     8     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     4     6     4     6     3     4     3     3     3     3     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     7     7     7     7     7     7     7     7     7     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     8     8     8     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     9     7     9     7     9     7     9     7     9     7     9     7     9     8    10     8    10     8    10     8    10     8    10     7     9     7     9     7     9     7     9     7     9     8    10     8    10     7    10     7    10     7    10     7    10     7     8     7     8     7     8     6     8     6     8     6     8     6     8     7     9     7     9     7     9     8    10     8    10     8    10     8    10     8    10    10    12    10    13    10    13    11    14    13    16    14    17    15    18    15    18    16    19    16    19    16    19    17    20    17    21    17    21    17    20    17    20    18    21    20    21    21    23    20    23    20    23    21    23    21    23    21    23    20    22    21    23    21    23    21    24    24    26    23    25    23    25    23    25    23    25    24    25    26    27    26    27    25    27    26    27    26    27    26    27    26    27    25    27    26    27    26    26    28    28    28    28    27    28    27    28    28    28    26    28    26    28    27    27    27    27    27    27    26    26    26    26    26    26    26    26    24    26    24    26    24    26    24    24    24    24    24    24    23    24    23    23    21    23    21    23    19    22    19    21     6     8
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------T----
                                                                       ...PREDICTED - Dr ---- 5e-026     XP_693722.1 PREDICTED: similar to Golgi autoantigen, golgin subfamily a, 2 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 8e-036     NP_004477.2 Golgi autoantigen, golgin subfamily a, 2 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Mm ---- 3e-037     XP_929837.1 PREDICTED: similar to Golgi autoantigen, golgin subfamily A member 2 (Golgi matrix protein GM130) isoform 11 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 5e-048     XP_425338.2 PREDICTED: similar to MGC81213 protein [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 2e-073     AAH81001.1 MGC81213 protein [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 2e-073     NP_001087616.1 MGC81213 protein [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABD9769.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATG---------------------------------ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG------TGA---------------------------------------------------------------------------------------------------------------------------------------------------ATGTAG---------------------TGAATG------------TAA---------------ATG------------------------------------------------------------------------------------------------------------------TAG------TAA---------------------------------------------------TGA---TGA------------ATG------------TGA------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------ATG------ATG------------------TGA---------------ATG------------------------------TAA------------TGA---------------TAG---------------------------------TGA---TGATAA------------------TAA---------------------------TAATAG---------------------------TGA---------------------------TAG------------------------------------------------------------------------------------------TAG---------TAG---TGA------------TAA------------------------------------------------------------------------------------------------------------------TAA---------------------ATG---ATG------------------------------------------------------ATG---TAA---ATG---------------------------------------------------------------------------------------------------------------------------------TGA------------------TAG---------------------TAGTGA------------------------------------------------------------------------------------------------------------------------------------ATG---------TAA------------------TAA------------TGA---------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATAG---------------------------------------------------TAA---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------TAA------------TAA---------------------------TAA---------------TAA---------------------------------------------------------------------------------TAG------------TAG---------------------------------TAGTGA---------------------------------TAA---------------------TAA---------------------------------TAA------------------------------------------------------------ATG------------------ATGATG---------TAG---------------------------------------TAG---------TAA------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2       bld In66                            IMAGE:8965825.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTACCGACTTGATGCAGGAGAGGGTAGACCTGAAGGAGCGCGTAGAAGAGCTGGAGCATCGATGCATTCAGCTGTCAGGAGAGACAGACACTATTGGTGAATACATTGCACTTTATCAGAGCCAGAGAGCTATACTGAAGCAGCGTCACAAGGAAAAGGAGGAGTACATTAGCCGACTGGCTCAGGACAAGGAAGAGATGAAGGCGAAGCTGCTGGAACTGCAAGTCCTGGTCATGAGGCTGGTGTCTGAGCGCAATGAGTGGTACCGGAGGTTTGTGGAAGCCACCCAGGGTCCCCACATAGGCTCCCCAGAGTTCCCTGCAGAAAATCTTATGGCACTTGAGGCAAAAGAAAATGGAGCTCTGGAGGAAGTCAGCTTAGAAGAGGATGGGGAACAGGAGGAAGTCCAGTTGTTGTCACATTTGGCAGCCCCTCAGGAAGGACCAAACCCGAGCCCTGAATCAGAAGACCCAACCACTAAACAAATTATGCAACTTCTGCATGAGATACAGAACCCGCAGGAACGGCCCAGCGCCCTGCTGCAAAATCCCTGCATCCCCTTTTTCTACCGTGCTGACGAGAACGACGAGGTCCGAATTATGGTGATTTGAGGGGGGGGAGGAGTTGACCGATCTGCCCAACCCTCCTCCTTTCCATGCCAACACCTTCTTGTGCTGGAATTCATTTTCTCCAAGGACACATTAGAAGTGATTACTTTGGGATGGGGGAGGGCTGGAGATTGGCTGTAGTGGGATGATGTAGAGACTGTTGCTTCTGCGCTGATGGGGCTCATGAATATCTGGTGAACCAGGAATGTGCAGATTGCTTTCATCAGGCAATGGATGTACATTCAGCACGACTCAGTATAGCCTGCTAATTTCCATCTGCTCGCATGGAGGGACTCATCACATTCAAC
  5   1   2       bld Int1      in                        CAAP12497.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTATACTGAAGCAGCGTCACAAGGAAAAGGAGGAGTACATTAGCCGACTGGCTCAGGACAAGGAAGAGATGAAGGCGAAGCTGCTGGAACTGCAAGTCCTGGTCATGAGGCTGGTGTCTGAGCGCAATGAGTGGTACCGGAGGTTTGTGGAAGCCACCCAGGGTCCCCACATAGGCTCCCCAGAGTTCCCTGCAGAAAATCTTATGGCACTTGAGGCAAAAGAAAATGGAGCTCTGGAGGAAGTCAGCTTAGAAGAGGATGGGGAACAGGAGGAAGTCCAGTTGTTGTCACATTTGGCAGCCCCTCAGGAAGGACCAAACCCGAGCCCTGAATCAGAAGACCCAACCACTAAACAAATTATGCAACTTCTGCATGAGATACAGAACCCGCAGGAACGGCCCAGCGCCCTGCTGCAAAATCCCTGCATCCCCTTTTTCTACCGTGCTGACGAGAACGACGAGGTCCGAATTATGGTGATTTGAGGGGGGGGAGGAGTTGACCGATCTGCCCAACCCTCCTCCTTTCCATGCCAACACCTTCTTGTGCTGGAATTCATTTTCTCCAAGGACACATTAGAAGTGATTACTTTGGGATGGGGGAGGGCTGGAGATTGGCTGTTAGTGGGATGGATGTAGAGAACTGTTGCCTTCCTGCGCTGAATGGGGCTCAGTGAATAATCTGTGAACCAGGAAATGTGCAGTATTGCCTTCCACCCAGGCCAATGGATTGTACCATTCAGCACCGGCTCTAGTAATAAGCTGCTATTTCCATCTGCTCCCCTTGGAGGGGCTCAACCACATCCACTTGAATAG
  5   1   2       bld Tad5      in                         XZT13247.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGGAGGAGTACATTAGCCGACTGGCTCAGGACAAGGAAGAGATGAAGGCGAAGCTGCTGGAACTGCAAGTCCTGGTCATGAGGCTGGTGTCTGAGCGCAATGAGTGGTACCGGAGGTTTGTGGAAGCCACCCAGGGTCCCCACATAGGCTCCCCAGAGTTCCCTGCAGAAAATCTTATGGCACTTGAGGCAAAAGAAAATGGAGCTCTGGAGGAAGTCAGCTTAGAAGAGGATGGGGAACAGGAGGAAGTCCAGTTGTTGTCACATTTGGCAGCCCCTCAGGAAGGACCAAACCCGAGCCCTGAATCAGAAGACCCAACCACTAAACAAATTATGCAACTTCTGCATGAGATACAGAACCCGCAGGAACGGCCCAGCGCCCTGCTGCAAAATCCCTGCATCCCCTTTTTCTACCGTGCTGACGAGAACGACGAGGTCCGAATTATGGTGATTTGAGGGGGGGGAGGAGTTGACCGATCTGCCCAACCCTCCTCCTTTCCATGCCAACACCTTCTTGTGCTGGAATTCATTTTCTCCAAGGACACATTAGAAGTGATTACTTTGGGATGGGGGAGGGCTGGAGATTGGCTGTTAGTGGGATGGATGTAGAGAACTGTTGCCTTCCTGCGCTGAATGGGGCTCAGTGAATAATCTGTGAACCAGGAAATGTGCAGTATTGCCTTCCACCCAGGCCAATGGATTGTACCATTCAGCACCGGCTCTAGTAATAAGCTGCTATTTCCATCTGCTCCCCTTGGAGGGGCTCAACCACATCCACTTGAATAGTCGCT
  5   1   2       bld Gas7      in                         XZG34342.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTGAGGCAAAAGAAAATGGAGCTCTGGAGGAAGTCAGCTTAGAAGAGGATGGGGAACAGGAGGAAGTCCAGTTGTTGTCACATTTGGCAGCCCCTCAGGAAGGACCAAACCCGAGCCCTGAATCAGAAGACCCAACCACTAAACAAATTATGCAACTTCTGCATGAGATACAGAACCCGCAGGAACGGCCCAGCGCCCTGCTGCAAAATCCCTGCATCCCCTTTTTCTACCGTGCTGACGAGAACGACGAGGTCCGAATTATGGTGATTTGAGGGGGGGGAGGAGTTGACCGATCTGCCCAACCCTCCTCCTTTCCATGCCAACACCTTCTTGTGCTGGAATTCATTTTCTCCAAGGACACATTAGAAGTGATTACTTTGGGATGGGGGAGGGCTGGAGATTGGCTGTTAGTGGGATGGATGTAGAGAACTGTTGCCTTCCTGCGCTGAATGGGGCTCAGTGAATAATCTGTGAACCAGGAAATGTGCAGTATTGCCTTCCACCCAGGCCAATGGATTGTACCATTCAGCACCGGCTCTAGTAATAAGCTGCTATTTCCATCTGCTCCCCTTGGAGGGGCTCAACCACATCCACTTGAATAGTCGCTCTAATTTCCAGAATTTATTTTTATTTGTACATATCTGAAGCACTACTGTTTGGTATGATGTTGACAGCAAGGAGGAATGGTGGTTTGGGAATGAAGTGGAGAGTTAGACTGTTGCAGATTCAAGTCCTTAATCCTTGGTCTTGTACCTGACTGGTGTAAAGGCGAAAGTGCCCGACGTAGAATAAACTGTTCAGGCTGGCNGAGAANAAA
  5   1   2       bld Gas                            TGas088g09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAAGTCCAGTTGTTGTCACATTTGGCAGCCCCTCAGGAAGGACCAAACCCGAGCCCTGAATCAGAAGACCCAACCACTAAACAAATTATGCAACTTCTGCATGAGATACAGAACCCGCAGGAACGGCCCAGCGCCCTGCTGCAAAATCCCTGCATCCCCTTTTTCTACCGTGCTGACGAGAACGACGAGGTACGAATTATGGTGATTTGA
  3   1   2       bld Gas7      in                         XZG34342.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTTGGCAGCCCCTCAGGAAGGACCAAACCCGAGCCCTGAATCAGAAGACCCAACCACTAAACAAATTATGCAACTTCTGCATGAGATACAGAACCCGCAGGAACGGCCCAGCGCCCTGCTGCAAAATCCCTGCATCCCCTTTTTCTACCGTGCTGACGAGAACGACGAGGTCCGAATTATGGTGATTTGAGGGGGGGGAGGAGTTGACCGATTTGCCCAACCCTCCTCCTTTCCATGCCAACACCTTCTTGTGCTGGAATTCATTTTCTCCAAGGACCCATTAGAAGTGATTACTTTGGGATGGGGGAGGGCTGGAGATTGGCTGTTAGTGGGATGGATGTAGAGAACTGTTGCCTTCCTGCGCTGAATGGGGCTCAGTGAATAATCTGTGAACCAGGAAATGTGCAGTATTGCCTTCCACCCAGGCCAATGGATTGTACCATTCAGCACCGGCTCTAGTAATAAGCTGCTATTTCCATCTGCTCCCCTTGGAGGGGCTCAACCACATCCACTTGAATAGTCGCTCTAATTTCCAGAATTTATTTTTATTTGTACATATCTGAAGCACTACTGTTTGGTATGATGTTGACAGCAAGGAGGAATGGTGGTTTGGGAATGAAGTGGAGAGTTAGACTGTTGCAGATTCAAGTCCTTAATCCTTGGTCTTGTACCTGACTGGGTAAAGGCGAAGGTGCCCGACGTAGAATAAACTGTTCAGGCTGGCAGGG
  5   1   2       bld Eye       in                         CCAX4551.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACAGAACCCGCAGGAACGGCCCAGCGCCCTGCTGCAAAATCCCTGCATCCCCTTTTTCTACCGTGCTGACGAGAACGACGAGGTCCGAATTATGGTGATTTGAGGGGGGGGAGGAGTTGACCGATCTGCCCAACCCTCCTCCTTTCCATGCCAACACCTTCTTGTGCTGGAATTCATTTTCTCCAAGGACACATTAGAAGTGATTACTTTGGGATGGGGGAGGGCTGGAGATTGGCTGTTAGTGGGATGGATGTAGAGAACTGTTGCCTTCCTGCGCTGAATGGGGCTCAGTGAATAATCTGTGAACCAGGAAATGTGCAGTATTGCCTTCCACCCAGGCCAATGGATTGTACCATTCAGCACCGGCTCTAGTAATAAGCTGCTATTTCCATCTGCTCCCCTTGGAGGGGCTCAACCACATCCACTTGAATAGTCGCTCTAATTTCCAGAATTTATTTTTATTTGTACATATCTGAAGCACTACTGTTTGGTATGATGTTGACAGCAAGGAGGAATGGTGGTTTGGGAATGAAGTGGAGAGTTAGACTGTTGCAGATTCAAGTCCTTAATCCTTGGTCTTGTACCTGACTGGTGTAAAGGCGAAAGTGCCCGACGTAGAATAAAACTGTTCAGGCTGGCAGAGCAGAAGAGATTG
  5   1   2       bld Tbd1      in                        CBXT19073.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCGCCCTGCTGCAAAATCCCTGCATCCCCTTTTTCTACCGTGCTGACGAGAACGACGAGGTCCGAATTATGGTGATTTGAGGGGGGGGAGGAGTTGACCGATCTGCCCAACCCTCCTCCTTTCCATGCCAACACCTTCTTGTGCTGGAATTCATTTTCTCCAAGGACACATTAGAAGTGATTACTTTGGGATGGGGGAGGGCTGGAGATTGGCTGTTAGTGGGATGGATGTAGAGAACTGTTGCCTTCCTGCGCTGAATGGGGCTCAGTGAATAATCTGTGAACCAGGAAATGTGCAGTATTGCCTTCCACCCAGGCCAATGGATTGTACCATTCAGCACCGGCTCTAGTAATAAGCTGCTATTTCCATCTGCTCCCCTTGGAGGGGCTCAACCACATCCACTTGAATAGTCGCTCTAATTTCCAGAATTTATTTTTATTTGTACATATCTGAAGCACTACTGTTTGGTATGATGTTGACAGCAAGGAGGAATGGTGGTTTGGGAATGAAGTGGAGAGTTAGACTGTTGCAGATTCAAGTCCTTAATCCTTGGTCTTGTACCTGACTGGTGTAAAGGCGAAGGTGCCCGACGTAGAATAAACTGTTCAGGCTGGCAGAGCAGAAGAGATTGTATAAGGAATCCTTTGTGACTCCAGGAAAG
  5   1   2       bld Tad5      in                         XZT38645.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGATGTAGAGAACTGTTGCCTTCCTGCGCTGAATGGGGCTCAGTGAATAATCTGTGAACCAGGAAATGTGCAGTATTGCCTTCCACCCAGGCCAATGGATTGTACCATTCAGCACCGGCTCTAGTAATAAGCTGCTATTTCCATCTGCTCCCCTTGGAGGGGCTCAACCACATCCACTTGAATAGTCGCTCTAATTTCCAGAATTTATTTTTATTTGTACATATCTGAAGCACTACTGTTTGGTATGATGTTGACAGCAAGGAGGAATGGTGGTTTGGGAATGAAGTGGAGAGTTAGACTGTTGCAGATTCAAGTCCTTAATCTTTGGTCTTGTACCTGACTGGTGTAAAGGCGAAGGTGCCCGACGTAGAATAAACTGTTCAGGCTGGCAGAGCAGAAGAGATTGTATAAGGAATCCTTTGTGACTCCAGGAAAGAGTGCTTATTCTAGAACTTTATTTTAGAACGTTGGCTAAAGGCAGGCTATGGGCGTTGCATGTTACTATGCAGCCCATGGAATCTCTTTCCTTGCATTGAGCCCATCCAATATCCATGACCTGCGTGGGAAGAGATTTTAGACTGTTTTAACATCTGCAGAAATGAACCATACATTCTACATAGAAAGCTGAGAAATGGGCAGAACACAAGATATTTTGAAAGTGATAAGATGAAGTGCAGGGAGGTTAAAGAGGCTGTATCCAAAGTCAGTTCTTTTAATAGAATGCTAGTGATCTATCTGCTGATGACTGAAAAGCAAGACTGGACCCAGTCCGTTGTTAGTCAGCTCTGCAGTCTGGTGGTACCAGTACAGTCCAGCTTCATAAAAGGCACAAGGGG
  5   1   2       bld Te3       in                         CAAM5841.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCAGTATTGCCTTCCACCCAGGCCAATGGATTGTACCATTCAGCACCGGCTCTAGTAATAAGCTGCTATTTCCATCTGCTCCCCTTGGAGGGGCTCAACCACATCCACTTGAATAGTCGCTCTAATTTCCAGAATTTATTTTTATTTGTACATATCTGAAGCACTACTGTTTGGTATGATGTTGACAGCAAGGAGGAATGGTGGTTTGGGAATGAAGTGGAGAGTTAGACTGTTGCAGATTCAAGTCCTTAATCCTTGGTCTTGTACCTGACTGGTGTAAAGGCGAAGGTGCCCGACGTAGAATAAACTGTTCAGGCTGGCAGAGCAGAAGAGATTGTATAAGGAATCCTTTGTGACTCCAGGAAAGAGTGCTTATTCTAGAACTTTATTTTAGAACGTTGGCTAAAGGCAGGCTATGGGCGTTGCATGTTACTATGCAGCCCATGGAATCTCTTCCCTTGCATTGAGCCCATCCAATATCCATGACCTGCGTGGGAAGAGATTTTAGACTGTTTTAACATCTGCAGAAATGAACCATACATTCTACATAGAAAGCTGAGAAATGGGCAGAACACAAGATATTTTGAAAGTGATAAGATGAAGTGCAGGGAGGTTAAAGAGGCTGTATCCAAAGTCAGTTCTTTTAATAGAATGCTAGTGATCTATCTGCTGATGACTGAAAAGCAAGACTGGACCCAGTCCGTTGTTAGTCAGCTCTGCAGTCTGGTGGTACCAGTACAGTCCAGCTTCATAAAAGGCA
  5   1   2       bld In66                            IMAGE:8967133.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTAATAAAACGTTGGCTAAAGGCAGGCTATGGGCGTTGCATGTTACTATGCAGCCCATGGAATCTCTTTCCTTGCATTGAGCCCATCCAATATCCATGACCTGCGTGGGAAGAGATTTTAGACTGTTTTAACATCTGCAGAAATGAACCATACATTCTACATAGAAAGCTGAGAAATGGGCAGAACACAAGATATTTTGAAAGTGATAAGATGAAGTGCAGGGAGGTTAAAGAGGCTGTATCCAAAGTCAGTTCTTTTAATAGAATGCTAGTGATCTATCTGCTGATGACTGAAAAGCAAGACTGGACCCAGTCCGTTGTTAGTCAGCTCTGCAGTCTGGTGGTACCAGTACAGTCCAGCTTCATAAAAGGCACAAGGGGGTTTCTCTTCCGTGTTTGTTTTTATATAAGGAGTAGCAGAAGACATAGACCTGAGCAGTTGATAAATAATACCCTGACAAGCAATTACACAAGCTGAACCATATTTATTGCATATTTAAAAAAATCATTGCCCTGCAGTGCACCGTGCACCTTGAGATCCTGTGGAATTTGCACCTCTCTGCTTAAAGGGGACATGGACCCTACTGTATGACAATGTCCAGTGTCTTAAGTGCCCTGAACACTTTTTCTATTTACATTCATTTAGATTTCATGATATAAACAATGTTTCCAGTTTTTTTTAGCCCAGGCGCGGCTGGATAGAGCAGCAAAAGCTGCCCTATCCAGAGCGGTCATCTCAGGAACACAGGAACGTATGGGCTAGCTCACTTCACAGCAGACACTGTGACACAAGTGTCTGTTTCTAGATGACCCCATGTCTCTATGAACTAAGAATCATCGACTGATAGACTGACCTGGGCAAACTGAGCAGACTACTGCTCTTACGGTAAT
  5   1   2       bld Lun1      in                         CABD9926.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTGAGCCCATCCAATATCCATGACCTGCGTGGGAAGAGATTTTAGACTGTTTTAACATCTGCAGAAATGAACCATACATTCTACATAGAAAGCTGAGAAATGGGCAGAACACAAGATATTTTGAAAGTGATAAGATGAAGTGCAGGGAGGTTAAAGAGGCTGTATCCAAAGTCAGTTCTTTTAATAGAATGCTAGTGATCTATCTGCTGATGACTGAAAAGCAAGACTGGACCCAGTCCGTTGTTAGTCAGCTCTGCAGTCTGGTGGTACCAGTACAGTCCAGCTTCATAAAAGGCACAAGGGGGTTTCTCTTCCGTGTTTGTTTTTATATAAGGAGTAGCAGAAGACATAGACCTGAGCAGTTGATAAATAATACCCTGACAAGCAATTACACAAGCTGAACCATATTTATTGCATATTTAAAAAAATCATTGCCCTGCAGTGCACCGTGCACCTTGAGATCCTGTGGAATTTGCACCTCTCTGCTTAAAGGGGACATGGACCCTACTGTATGACAATGTCCAGTGTCTTAAGTGCCCTGAACACTTTTTCTATTTACATTCATTTAGATTTCATGATATAAACAATGTTTCCAGTTTTTTTTAGCCCAGGCGCCGGCTGGATAGAGCAGCAAAAGCTGCCCTATCCAGAGCGGTCATCTCAGGGAACACAGGGAACGTATGGGGCTAAGCTCCACCTTCCACAAGGCAGGACACTGTGACACAAAGTGTCCTGTTTCTAGGAGTTGGACCCCCCATGTCTCTAGTGAGACCCTAGAGGAAATCATCGGACAGTGATTAGCACTGACACCTGGGCAAAACCTGGAGCAGGACTACCTGCCTCCTTAC
  5   1   2       bld In63                            IMAGE:8960154.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAACATTTTTCCTAACATCACTTTTAGCTGAGAAATTGGGCAGAACACAAGATATTTTGAAAGTGATAAGATGAAGTGCAGGGAGGTTAAAGAGGCTGTATCCAAAGTCAGTTCTTTTAATAGAATGCTAGTGATCTATCTGCTGATGACTGAAAAGCAAGACTGGACCCAGTCCGTTGTTAGTCAGCTCTGCAGTCTGGTGGTACCAGTACAGTCCAGCTTCATAAAAGGCACAAGGGGGTTTCTCTTCCGTGTTTGTTTTTATATAAGGAGTAGCAGAAGACATAGACCTGAGCAGTTGATAAATAATACCCTGACAAGCAATTACACAAGCTGAACCATATTTATTGCATATTTAAAAAAATCATTGCCCTGCAGTGCACCGTGCACCTTGAGATCCTGTGGAATTTGCACCTCTCTGCTTAAAGGGGACATGGACCCTACTGTATGACAATGTCCAGTGTCTTAAGTGCCCTGAACACTTTTTCTATTTACATTCATTTAGATTTCATGATATAAACAATGTTTCCAGTTTTTTTTAGCCCAGGCGCCGGCTGGATAGAGCAGCAAAAGCTGCCCTATCCAGAGCGGTCATCTCAGGGAACACAGGGAACGTATGGGGCTAAGCCCCACCTTCCACAAGGCAGACACTGTGACACAAAGTGTCCTGTTTCTAGGAGTTGGACCCCCCATGTCTCTAGTGAGACCCTAGAGGAAATCATCGGACAGTGATTAGCACTGACACCTGGGCAAAACCTGAGCAGACTACTGCTCTTACGGGTTAATCCCCTAATCTAATAGCACCAGGGTCTGCACGTAGCTGTCATGTTCTATACTGTATAACGAAGCTGCTTGTAAGGGGGTGGGAGTGGAATATGCTGTTCACCCTCTTGCCTCTCTCTGCGTGTGTTGAAT
  5   1   2       bld Eye       in                         CCAX7813.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGAAAAGCAAGACTGGACCCAGTCCGTTGTTAGTCAGCTCTGCAGTCTGGTGGTACCAGTACAGTCCAGCTTCATAAAAGGCACAAGGGGGTTTCTCTTCCGTGTTTGTTTTTATATAAGGAGTAGCAGAAGACATAGACCTGAGCAGTTGATAAATAATACCCTGACAAGCAATTACACAAGCTGAACCATATTTATTGCATATTTAAAAAAATCATTGCCCTGCAGTGCACCGTGCACCTTGAGATCCTGTGGAATTTGCACCTCTCTGCTTAAAGGGGACATGGACCCTACTGTATGACAATGTCCAGTGTCTTAAGTGCCCTGAACACTTTTTCTATTTACATTCATTTAGATTTCATGATATAAACAATGTTTCCAGTTTTTTTTAGCCCAGGCGCCGGCTGGATAGAGCAGCAAAAGCTGCCCTATCCAGAGCGGTCATCTCAGGGAACACAGGGAACGTATGGGGCTAAGCCCCACCTTCCACAAGGCAGGACACTGTGACACAAAGTGTCCTGTTTCTAGGAGTTGGACCCCCCATGTCTCTAGTGAGACCCTAGAGGAAATCATCGGACAGTGATTAGCACTGACACCTGGGCAAAACCTGGAGCAGGACTACCTGCCTCCTTACGGGTTAATCCCCCTAATCTAAATAGCCACCAGGGGTCTGCACGTAGCCTGCTCATGTCTATACTGTAATACAGAAGGGCCTGGCTTGTAAGGGGTGTGGGGAGTGAGTATGCTGCTCAGCCCTCTTGCTCTTCCT
  5   1   2       bld Lun1      in                         CABD9769.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGAGGCGTTGTTAGTCAGCTCTGCAGTCTGGTGGTACCAGTACAGTCCAGCTTCATAAAAGGCACAAGGGGGTTTCTCTTCCGTGTTTGTTTTTATATAAGGAGTAGCAGAAGACATAGACCTGAGCAGTTGATAAATAATACCCTGACAAGCAATTACACAAGCTGAACCATATTTATTGCATATTTAAAAAAATCATTGCCCTGCAGTGCACCGTGCACCTTGAGATCCTGTGGAATTTGCACCTCTCTGCTTAAAGGGGACATGGACCCTACTGTATGACAATGTCCAGTGTCTTAAGTGCCCTGAACACTTTTTCTATTTACATTCATTTAGATTTCATGATATAAACAATGTTTCCAGTTTTTTTTAGCCCAGGCGCCGGCTGGATAGAGCAGCAAAAGCTGCCCTATCCAGAGCGGTCATCTCAGGGAACACAGGGAACGTATGGGGCTAAGCTCCACCTTCCACAAGGCAGGACACTGTGACACAAAGTGTCCTGTTTCTAGGAGTTGGACCCCCCATGTCTCTAGTGAGACCCTAGAGGAAATCATCGGACAGTGATTAGCACTGACACCTGGGCAAAACCTGGAGCAGGACTACCTGCCTCCTTACGGGTTAATCCCCCTAATCTAAATAGCCACCAGGGGTCTGCACGTAGCCTGCTCATGTCTATACTGTAATACAGAAGGCCTGGCTTGTAAGGGGTGTGGGAGTGAGTATGCTGCTCAGCCCTCTTGCTCTTCCTGCTGCTGTGCTTCTGCTCCTTACCCTCCCAAAACATCCATCCACTTTCAACCCACCTCTGACTGCCGGCCCCAGCTTACCCACAAAAACTTATTTTACTGAAGCAGGAAGTGTTTGCTGACGCTTCCCTGCTCAGCTCTCTTGTACAGTGTGACA
  5   1   2       bld In62                            IMAGE:8955053.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCATATTTCACCCGCATATTTAAAAAAATCATTGCCCTGCAGTGCACCGTGCACCTTGAGATCCTGTGGAATTTGCACCTCTCTGCTTAAAGGGGACATGGACCCTACTGTATGACAATGTCCAGTGTCTTAAGTGCCCTGAACACTTTTTCTATTTACATTCATTTAGATTTCATGATATAAACAATGTTTCCAGTTTTTTTTAGCCCAGGCGCCGGCTGGATAGAGCAGCAAAAGCTGCCCTATCCAGAGCGGTCATCTCAGGGAACACAGGGAACGTATGGGGCTAAGCTCCACCTTCCACAAGGCAGGACACTGTGACACAAAGTGTCCTGTTTCTAGGAGTTGGACCCCCCATGTCTCTAGTGAGACCCTAGAGGAAATCATCGGACAGTGATTAGCACTGACACCTGGGCAAAACCTGGAGCAGGACTACCTGCCTCCTTACGGGTTAATCCCCCTAATCTAAATAGCCACCAGGGGTCTGCACGTAGCCTGCTCATGTCTATACTGTAATACAGAAGGCCTGGCTTGTAAGGGGTGTGGGAGTGAGTATGCTGCTCAGCCCTCTTGCTCTTCCTGCTGCTGTGCTTCTGCTCCTTACCCTCCCAAACATCCATCCACTTTCACCCACCTCTGACTGCGGCCCAGCTACCACAAAACTATTTACTGAGCAGAGTGTTGCTGACGCTCCTGTCACTCTCTGACGGGCAGACATAACCTTCTGCTCATTATAGTGTGTGTGTCTGCAGGCACGGGTACATCTGAACGACTCAATGTCTTCTAATTCAAATAATGATGGAAGCACGATGTGTAGTCGCCTACGACTAATACAGTGCTACTACACATGCACTGCGGACACATCTTAAACGATGCATGTCACTCATCGACTTTATCTGCGGAATGTTTTGAGTCCGTCGA
  5   1   2       bld Tad5      in                         XZT52409.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCACGNNCGTCCGGTTTTTTTTAGCCCAGGCGCCGGCTGGATAGAGCAGCAAAAGCTGCCCTATCCAGAGCGGTCATCTCAGGGAACACAGGGAACGTATGGGGCTAAGCTCCACCTTCCACAAGGCAGGACACTGTGACACAAAGTGTCCTGTTTCTAGGAGTTGGACCCCCCATGTCTCTAGTGAGACCCTAGAGGAAATCATCGGACAGTGATTAGCACTGACACCTGGGCAAAACCTGGAGCAGGACTACCTGCCTCCTTACGGGTTAATCCCCCTAATCTAAATAGCCACCAGGGGTCTGCACGTAGCCTGCTCATGTCTATACTGTAATACAGAAGGCCTGGCTTGTAAGGGGTGTGGGAGTGAGTATGCTGCTCAGCCCTCTTGCTCTTCCTGCTGCTGTGCTTCTGCTCCTTACCCTCCCAAAACATCCATCCACTTTCAACCCACCTCTGACTGCCGGCCCCAGCTTACCCACAAAAACTTATTTTACTGAAGCAGGAAGTGTTTGCTGACGCTTCCCTGCTCAGCTCTCTTGTACAGTGTGACAGGAGCAATAGACCCTTTCTGCCTCAGTATATTAAGCTGTTGTTGCTGTTCTGCCAGGGCCGACAGGGGGTTACACATTCATGATAGCAGCAGCATCAAACTGCTCATATCATAAAATCTACAACAAAATTAATATTGTAAATTGCGAACAGGCACACTGAGCTGTTTTGCTTAAGTTTCATGTCCCCTTTAACAGCGAAGCTTTACAATTATCCAGGGTCATGCACTAACACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATG
  5   1   2       bld Fat1      in                          CABC800.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTTTCCAGTTTTTTTTAGCCCAGGCGCCGGCTGGATAGAGCAGCAAAAGCTGCCCTATCCAGAGCGGTCATCTCAGGGAACACAGGGAACGTATGGGGCTAAGCTCCACCTTCCACAAGGCAGGACACTGTGACACAAAGTGTCCTGTTTCTAGGAGTTGGACCCCCCATGTCTCTAGTGAGACCCTAGAGGAAATCATCGGACAGTGATTAGCACTGACACCTGGGCAAAACCTGGAGCAGGACTACCTGCCTCCTTACGGGTTAATCCCCCTAATCTAAATAGCCACCAGGGGTCTGCACGTAGCCTGCTCATGTCTATACTGTAATACAGAAGGCCTGGCTTGTAAGGGGTGTGGGAGTGAGTATGCTGCTCAGCCCTCTTGCTCTTCCTGCTGCTGTGCTTCTGCTCCTTACCCTCCCAAAACATCCATCCACTTTCAACCCACCTCTGACTGCCGGCCCCAGCTTACCCACAAAAACTTATTTTACTGAAGCAGGAAGTGTTTGCTGACGCTTCCCTGCTCAGCTCTCTTGTACAGTGTGACAGGAGCAATAGACCCTTTCTGCCTCAGTATATTAAGCTGTTGTTGCTGTTCTGCCAGGGCCGACAGGGGGTTACACATTCATGATAGCAGCAGCATCAAACTGCTCATATCATAAAATCTACAACAAAATTAATATTGTAAATTGCGAACAGGCACACTGAGCTGTTTTGCTTAAGTTTCATGTCCCCTTTTACAGCGAAGCTTTACAATTATCCAGGGTCATGCACTAACACTAACCCAGCCAAGTTTG
  5   1   2       bld Gas                            TGas043g24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCACTTCCACAAGCAGGACACTGTGACACAAAGTGTCCTGTTTCTAGGAGTTGGACCCCCCATGTCTCTAGTGAGACCCTAGAGGAAATCATCGGACAGTGATTAGCACTGACACCTGGGCAAAACCTGGAGCAGGACTACCTGCCTCCTTACGGGTTAATCCCCCTAATCTAAATAGCCACCAGGGGTCTGCACGTAGCCTGCTCATGTCTATACTGTAATACAGAAGGCCTGGCTTGTAAGGGGTGTGGGAGTGAGTATGCTGCTCAGCCCTCTTGCTCTTCCTGCTGCTGTGCTTCTGCTCCTTACCCTCCCAAAACATCCATCCACTTTCAACCCACCTCTGACTGCCGGCCCCAGCTTACCCACAAAAACTTATTTTACTGAAGCAGGAAGTGTTTGCTGACGCTTCCCTGCTCAGCTCTCTTGTACAGTGTGACAGGAGCAATAGACCCTTTCTGCCTCAGTATATTAAGCTGTTGTTGCTGTTCTGCCAGGGCCGACAGGGGGTTACACATTCATGATAGCAGCAGCATCAAACTGCTCATATCATAAAATCTACAACAAAATTAATATTGTAAATTGCGAACAGGCACACTGAGCTGTTTTGCTTAAGTTTCATGTCCCCTTTA
  5   1   2       bld Tail      in                         CBSW3414.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCGAATCATCGGACAGTGATTAGCACTGACACCTGGGCAAAACCTGGAGCAGGACTACCTGCCTCCTTACGGGTTAATCCCCCTAATCTAAATAGCCACCAGGGGTCTGCACGTAGCCTGCTCATGTCTATACTGTAATACAGAAGGCCTGGCTTGTAAGGGGTGTGGGAGTGAGTATGCTGCTCAGCCCTCTTGCTCTTCCTGCTGCTGTGCTTCTGCTCCTTACCCTCCCAAAACATCCATCCACTTTCAACCCACCTCTGACTGCCGGCCCCAGCTTACCCACAAAAACTTATTTTACTGAAGCAGGAAGTGTTTGCTGACGCTTCCCTGCTCAGCTCTCTTGTACAGTGTGACAGGAGCAATAGACCCTTTCTGCCTCAGTATATTAAGCTGTTGTTGCTGTTCTGCCAGGGCCGACAGGGGGTTACACATTCATGATAGCAGCAGCATCAAACTGCTCATATCATAAAATCTACAACAAAATTAATATTGTAAATTGCGAACAGGCACACTGAGCTGTTTTGCTTAAGTTTCATGTCCCCTTTAACAGCGAAGCTTTACAATTATCCAGGGTCATGCACTAACACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAA
  3   1   2       bld Tbd0      in                       IMAGE:6976470                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAAATTTTGTTAGTATAAAAAGAATCCACTGGCCGCCACTCCGCTGTTTCTTTGATGGAAAACATACCACACAAAAGAGGATGGGATTGTGAAAGGTGGAACACACGAAGAAATGGTGANGAGTGTCGCCTACAATAGGGGGGGTGTTAGAGGGTAATGTGTATATCTAGCCCGGGGGGGTATATGATTTCACGTGTGAGAGAATAATTATTTCTTAACCACCCCGCCACGACGGAGGAAAAATGTATATCGTCCTTCCACCAAAATTTATTTGTGACCCAAAAAAAGCATATAAGCACACATGTGAGTTGGAGCGAAATCTTTTGTATTTTTGTCCACCCCTACGTTATATTGAGGAAGAAGGGGGGGAAGAGATAAANAGGGTAGTTGTATATGGTAGGGAAAAAACGGGAGCTTCNTTCTTTTTGGAAAAATCGATTTATGTTATAAAAAGCTTTTGTTTAGAGCGGCGGCGCACGACGATTTTTTTTGTACAAAAAGGCGGACAATCAGTATTGTTTGTTTATATAACCCCCCCGTATTTTCGTATTAAAAACGCCGAATATTATAGAAACCCCCACCCCACAATTTTTATTTTTTTCTTAAAAGACCCGCCTTAAATATATTTTGGGAAGCCCCCTGGAGGGGTTATAAAAGTTATATCCCCCTTTTTGGGCCAATTTCCCCTATTAGAAATTTTGGTTTCCCCCTTTGTGTTATGGGAACCCGCCCAACAAGGGGGGGGCAGGAAAGACCTTTGAATTAGGCTTGGGCGTTTTTCTGAGTACTTTTCAGTGGGAGGAAAGGGAGCCAGTTTTCTCCATAGTGACCCAAGTAAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAAATGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTGTGTTTCCAAAATGATTTAAACTTATTGGAAATAGTTTTCCACGAATGGAATAACCATCGAATGGAAGCGCCCGCGGGCGAAAGAGAAGAAAAGTNNNNNNGANNNNCCTTGCAA
  5   1   2       bld Te3       in                        CAAM14708.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTCTATACTGTAATACAGAAGGCCTGGCTTGTAAGGGGTGTGGGAGTGAGTATGCTGCTCAGCCCTCTTGCTCTTCCTGCTGCTGTGCTTCTGCTCCTTACCCTCCCAAAACATCCATCCACTTTCAACCCACCTCTGACTGCCGGCCCCAGCTTACCCACAAAAACTTATTTTACTGAAGCAGGAAGTGTTTGCTGACGCTTCCCTGCTCAGCTCTCTTGTACAGTGTGACAGGAGCAATAGACCCTTTCTGCCTCAGTATATTAAGCTGTTGTTGCTGTTCTGCCAGGGCCGACAGGGGGTTACACATTCATGATAGCAGCAGCATCAAACTGCTCATATCATAAAATCTACAACAAAATTAATATTGTAAATTGCGAACAGGCACACTGAGCTGTTTTGCTTAAGTTTCATGTCCCCTTTAACAGCGAAGCTTTACAATTATCCAGGGTCATGCACTAACACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGNGTAGGTA
  5   1   2       bld Tad5                                 XZT39059.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTACCCACAAAAACTTATTTTACTGAAGCAGGAAGTGTTTGCTGACGCTTCCCTGCTCAGCTCTCTTGTACAGTGTGACAGGAGCAATAGACCCTTTCTGCCTCAGTATATTAAGCTGTTGTTGCTGTTCTGCCAGGGCCGACAGGGGGTTACACATTCATGATAGCAGCAGCATCAAACTGCTCATATCATAAAATCTACAACAAAATTAATATTGTAAATTGCGAACAGGCACACTGAGCTGTTTTGCTTAAGTTTCATGTCCCCTTTAACAGCGAAGCTTTACAATTATCCAGGGTCATGCACTAACACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGATTATTAACGGGTAGGGTGGGTTCTAATTTATTGGGT
  5   1   2       bld Brn3      in                         CAAK8953.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGCTGACGCTTCCCTGCTCAGCTCTCTTGTACAGTGTGACAGGAGCAATAGACCCTTTCTGCCTCAGTATATTAAGCTGTTGTTGCTGTTCTGCCAGGGCCGACAGGGGGTTACACATTCATGATAGCAGCAGCATCAAACTGCTCATATCATAAAATCTACAACAAAATTAATATTGTAAATTGCGAACAGGCACACTGAGCTGTTTTGCTTAAGTTTCATGTCCCCTTTAACAGCGAAGCTTTACAATTATCCAGGGTCATGCACTAACACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGA
  3   1   2      seed Lun1      in                         CABD9769.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TACAGTGTGACAGGAGCAATAGACCCTTTCTGCCTCAGTATATTAAGCTGTTGTTGCTGTTCTGCCAGGGCCGACAGGGGGTTACACATTCATGATAGCAGCAGCATCAAACTGCTCATATCATAAAATCTACAACAAAATTAATATTGTAAATTGCGAACAGGCACACTGAGCTGTTTTGCTTAAGTTTCATGTCCCCTTTAACAGCGAAGCTTTACAATTATCCAGGGTCATGCACTAACACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTATTGGAAATATGTTTTCCTTTCTGAATAAATGTATATTCAGTAAATC
  3   1   2       bld Brn3      in                         CAAK8953.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCTCAGTATATTAAGCTGTTGTTGCTGTTCTGCCAGGGCCGACAGGGGGTTACACATTCATGATAGCAGCAGCATCAAACTGCTCATATCATAAAATCTACAACAAAATTAATATTGTAAATTGCGAACAGGCACACTGAGCTGTTTTGCTTAAGTTTCATGTCCCCTTTAACAGCGAAGCTTTACAATTATCCAGGGTCATGCACTAACACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTATTGGAAATATGTTTTCCTTTCTGAATAAATGTATATTCAGTAAATC
  3   1   2       bld Lun1      in                         CABD9926.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCTCAGTATATTAAGCTGTTGTTGCTGTTCTGCCAGGGCCGACAGGGGGTTACACATTCATGATAGCAGCAGCATCAAACTGCTCATATCATAAAATCTACAACAAAATTAATATTGTAAATTGCGAACAGGCACACTGAGCTGTTTTGCTTAAGTTTCATGTCCCCTTTAACAGCGAAGCTTTACAATTATCCAGGGTCATGCACTAACACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTATTGGAAATATGTTTTCCTTTCTGAATAAATGTATATTCAGTAAATC
  5   1   2       bld Gas7      in                             XZG4.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCTTTTTTTCgcttgagtggctgcccccatggctacacagcagcttatttatgtggactatggtagtgttcctgaggcaaacaccccagttttaccggtgcagggccacagtacattatgtttccattactttaaaacactGTTACTGTTCCTTTAAGTTTCATGTCCCCTTTAACAGCGAAGCTTTACAATTATCCAGGGTCATGCACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGCAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACTGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTAT
  3   1   2       bld Tad5      in                         XZT38645.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGCCGACAGGGGGTTACACATTCATGATAGCAGCAGCATCAAACTGCTCATATCATAAAATCTACAACAAAATTAATATTGTAAATTGCGAACAGGCACACTGAGCTGTTTTGCTTAAGTTTCATGTCCCCTTTAACAGCGAAGCTTTACAATTATCCAGGGTCATGCACTAACACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTATTGGAAATATGTTTTCCTTTCTGAATAAATGTATATTCAGT
  3   1   2       bld Int1      in                        CAAP12497.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGGGGTTACACATTCATGATAGCAGCAGCATCAAACTGCTCATATCATAAAATCTACAACAAAATTAATATTGTAAATTGCGAACAGGCACACTGAGCTGTTTTGCTTAAGTTTCATGTCCCCTTTAACAGCGAAGCTTTACAATTATCCAGGGTCATGCACTAACACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTATTGGAAATATGTTTTCCTTTCTGAATAAATGTATATTCAGTAAATC
  3   1   2       bld Fat1      in                          CABC800.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGGGGTTACACATTCATGATAGCAGCAGCATCAAACTGCTCATATCATAAAATCTACAACAAAATTAATATTGTAAATTGCGAACAGGCACACTGAGCTGTTTTGCTTAAGTTTCATGTCCCCTTTAACAGCGAAGCTTTACAATTATCCAGGGTCATGCACTAACACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTATTGGAAATATGTTTTCCTTTCTGAATAAATGTATATTCAGTAAATC
  3   1   2       bld Te3       in                         CAAM5841.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TACACATTCATGATAGCAGCAGCATCAAACTGCTCATATCATAAAATCTACAACAAAATTAATATTGTAAATTGCGAACAGGCACACTGAGCTGTTTTGCTTAAGTTTCATGTCCCCTTTAACAGCGAAGCTTTACAATTATCCAGGGTCATGCACTAACACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTATTGGAAATATGTTTTCCTTTCTGAATAAATGTATATTCAGTAAATC
  3   1   2       bld Tbd1      in                        CBXT19073.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGCAGCATCAAACTGCTCATATCATAAAATCTACAACAAAATTAATATTGTAAATTGCGAACAGGCACACTGAGCTGTTTTGCTTAAGTTTCATGTCCCCTTTAACAGCGAAGCTTTACAATTATCCAGGGTCATGCACTAACACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTATTGGAAATATGTTTTCCTTTCTGAATAAATGTATATTCAGTAAATCAAAAAAAAAAAAAAA
  5   1   2       bld Neu                            TNeu011g11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAATCTACAACAAAATTAATATTGTAAATTGCGAACAGGCACACTGAGCTGTTTTGCTTAAGTTTCATGTCCCCTTTAACAGCGAAGCTTTACAATTATCCAGGGTCATGCACTAACACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAA
  3   1   2       bld Tail      in                         CBSW3414.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCACACTGAGCTGTTTTGCTTAAGTTTCATGTCCCCTTTAACAGCGAAGCTTTACAATTATCCAGGGTCATGCACTAACACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTATTGGAAATATGTTTTCCTTTCTGAATAAATGTATATTCAGTAAATCAAAAAAAAAAAAAAA
  3   1   2       bld Eye       in                         CCAX7813.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACTGAGCTGTTTTGCTTAAGTTTCATGTCCCTTTAACAGCGAAGCTTTACAATTATCCAGGGTCATGCACTAACACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTTTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTTTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTATTGGAAATATGTTTTCCTTTCTGAATAAATGTATATTCAGTAAATC
  3   1   2       bld Gas7      in                             XZG4.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTTAAGTTTCATGTCCCCTTTAACAGCGAAGCTTTACAATTATCCAGGGTCATGCACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGCAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACTGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAACCTTATTGGAAATATGTTTTTCTTT
  3   1   2       bld Tad5      in                         XZT52409.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAGGGTCATGCACTAACACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTTTACCATAACCCAGTTCTTTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTTTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTTTCATAGTGACCCAGTGAGTATTTTTTTTGTCCCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCCCCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGGGGGTTTTAATTTATTGGGTGTTATCCCAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTATTGGAAATATGTTTTCCTTTCTGAATAAATGTATTTTCGGT
  3   1   2       bld Te3       in                        CAAM14708.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAACACTAACCCAGCCAAGTTTGCCGTAGCACTTGAACCCGGGGCAGCCAATCAAATAATTACTTTCCTTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTTTACCATAACCCAGTTTTTTAACCTAATTGACCTGGGGTAATATCCCTTTGCATTCCTTTGAATTGCTCCCCTTGTATGGGCCGCCCCATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTTTAGTACTTTCAGGGGGGGAAAGGGGCAGGTTTTTCATAGTGACCCAGGGAGTATTTTTTTTGTTCCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGGTGAAGGGTTCCCCGTACATAGGGGACGGGGGTAACATTTTGTATATTTTTGGAACTGCCCCCGGATTTCCAGCAGCGTTTTTGGCTGCAGGCTAAAGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGGGGGTTTGTCAGCTGATCAGAGAATTTTTAACGGGGGGGGGGGGGTTTTAATTTATTGGGGGTTATCCCAGGTCAGGGGAGGTACCCTTTCCATTTTGTTTCCAAAAAGATTTAAACTTATTGGAAAAATGTTTTCCTTTCTGAAAAAAAGGATATTCAGTAAATCAAATTGGGGTTCTCTTGGAAAAAAAC
  3   1   2       bld Eye       in                         CCAX4551.g3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTAACCCAGCCAAGTTTGCGTAGCACTTGAACCCGGGCAGCCAATCAAATAATTACTTCATTAGATAACTAACAGCTGATTAATGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTATTGGAAATATGTTTTCCTTTCTGAATAAATGTATATTCAGTAAATC
  5   1   2       bld Tbd0      in                       IMAGE:6976470                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCTGGTACNCTGGTCCGGAATTCCCTGGGATGCCAATCAAATAATTACTTTCATTAGATAACTAACAGCTGATTAATTGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTTTTGGAAATATGTTTTCCTTTTTGAATAAATGTATATTCAGTAAATCAAACCCCCCCAACCAGAACACAAAGNNNAAGAAACCATATAAAAACACCACGCCGGACCAAAAAACCTAGGAACGCCCACCCCCCCCCAACTCCCGGGGGGGGGGCATCCCAAAAAATTACCTCCGGGGGGGGGCCCAATTTTATAACTAANNANCGGTTTTTTTTTGAAAACGAGAGGGCCCNTTTGGGGGGCGCCCCTTCTTCCGGNNGAGGGCTCGGGGCCCGCCGGTTTTTAAACCCTCCCTTTACACGGAAAAAAAAAGGNNAAGAGGGGGGGTATATTTTTGTGGAAAGAAAATCTTNCCCGGTGCGGGGGGGAACCA
  5   1   2       bld Gas                           TGas083a10.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTAATTGCCGTCAGCAGTTTGCCTTCTACCATAACCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGCACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCACGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGAATATTCTTGGAACTGCCACCGGATCT
  3   1   2       bld Tad5      in                         XZT13247.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCTTCCATAACCCAGTTTTTTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATGGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTTTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTTCCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATGGCGTCCGTGTGTAACATTTTGTATATTCTGGGAACTGCCACCGGATCTCCAGCAGCTTTTTTGGCGGCAGGCTAATGGTTATACTGTATTATAAAAGGATGGAGCTTCTATAGAAGCGGGTTTGTCAGCTGATCAGAGATTTTTTAACGGGTTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTATGGGAAATATGTTTTCCTTTCGGAATAAA
  3   1   2       bld Te3       in                         CAAM5836.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTATTGGAAATATGTTTTCCTTTCTGAATAAATGTATATTCAGTAAATC
  5   1   2       bld Te3       in                         CAAM5836.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCAGTTCTCTAACCTAATTGACCTGGGTTAATATCCCTTTGCATTCCTTTGAATTGCTCCCATTGTATGGGCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTATTGGAAATATGTTTTCCTTTCTGAATAAATGTATATTCAGTAAATCAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te4       in                        CAAN12464.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTATTGGAAATATGTTTTCCTTTCTGAATAAATGTATATTCAGTAAATC
  5   1   2       bld Te4       in                        CAAN12464.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCGCCACATGGGGGCAGAAGACTTGTATAGGCTGGGCTTTTCTAGTACTTTCAGTGGAGGAAAGGAGCAGGTTTCTCATAGTGACCCAGTGAGTATTTCTTTTGTACCAGGGGTAGGTAAGAGGGTCCCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTATTGGAAATATGTTTTCCTTTCTGAATAAATGTATATTCAGTAAATCAAAAAAAAAAAAAAA
  3   1   2       bld Te3       in                         CAAM9184.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTATTGGAAATATGTTTTCCTTTCTGAATAAATGTATATTCAGTAAATC
  5   1   2       bld Te3       in                         CAAM9184.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTCAAGCTCCCCCTAAGCTGAAGTGTTCCCTGTACATAGTGTACGTGTGTAACATTTTGTATATTCTTGGAACTGCCACCGGATCTCCAGCAGCGTTTTTGGCTGCAGGCTAATGGTTATACTGTATTATAAAATGATGGAGCTTCTATAGAAGCGGGTCTGTCAGCTGATCAGAGAATTATTAACGGGGTAGGGTGGGTTCTAATTTATTGGGTGTTATCACAGGTCAGGGGAGCTACACTTTCCATTCTGTTTCCAAAATGATTTAAACTTATTGGAAATATGTTTTCCTTTCTGAATAAATGTATATTCAGTAAATCAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)