Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABD5914.5                           33 END     1           2        3                Hypothetical protein MGC147595 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 93%

 1012074161 Xt7.1-CABH7497.5 - 41 ESTs
                                                                       .-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABH7497.5                      GCTTGCAGTGACAAAGCTGGAGCGTTCGGGACCGTCTGGAAGTTTCTTGTGGGAGGAGACACCGGACCGTGACTCGGCAAGACGGGACAGTGAGTCAGCAATGGGGAGCGGGTACATAAGAGAGGCGGGGGGGAGGCCGGAGTTTCGAGACGATACCGGCGGCAACAGGTTGCTCAAAGGCAATTGGCATATTTACAGGTTTATACAATGGAATTTCCAGATCTAGGACATCATTGTTCAGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAATCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACTGAATGAAGATGAAGCACTAAAGAAGGCACTGGAACTGTCTTTACTGGAGACAGGAGTCAATAACTTACTGACATTAAGCCCACAGGATGAAGATGGGGAACTGGAGCAGGCTTTAGCTGCCAGCAGGGAGGAATATAGGCTATTCCAGAGGAAAGCTGTAAAAGCCACAGGAAAGTGACATAATGTTCAACAATATCTACCTTGAGCATTTAGATTGTTGATGTAAATCTGACTTTTTTATGAGGTTGTTTTTATCGTTGTTACTATATGTGGAGACGTTACTTATAGAGAAGCACTTTCATATTTATTTGCTAATCCTTTTTTTTTTTTTTTTTGTACTCGTCGTGTGTTTTATTTTCTTCTCATAGATTTTTGTACATAAGGAGCTTCTTTATAGGAACAATAAAGTGCTATTTTTAGTAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008226613                            AGTGACAAAGCTGGAGCGTTCGGGACCGTCTGGAAGTTTCTTGTGGGAGGAGACACCGGACCGTGACTCGGCAAGACGGGACAGTGAGTCAGCAATGGGGAGCGGGTACATAAGxxxxGxGGGGGGGAGGCCGGAGTTTCGAGACGATACCGGCGGCAACAGGTTGCTCAAAGGCAATTGGCATATTTACAGGTTTATACAATGGAATTTCCAGATCTAGGACATCATTGTTCAGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAATCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACTGAATGAAGATGAAGCACTAAAGAAGGCACTGGAACTGTCTTTACTGGAGACAGGAGTCAATAACTTACTGACATTAAGCCCACAGGATGAAGATGGGGAACTGGAGCAGGCTTTAGCTGCCAGCAGGGAGGAATATAGGCTATTCCAGAGGAAAGCTGTAAAAGCCACAGGAAAGTGACATAATGTTCAACAATATCTACCTTGAGCATTTAGATTGTTGATGTAAATCTGACTTTTTTATGAGGTTGTTTTTATCGTTGTTACTATATGTGGAGACGTTACTTATAGAGAAGCACTTTCATATTTATTTGCTAATCCTTTTTTTTTTTTTTTTTTTACTCGTxxxxTxTTTTATTTTCTTxTxxxxGATTTTTGTACATAAGGAGCTTCTTTATAGGAACAATAAAGTGCTATTTTTAGTAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                           2     2     3     4     3     4     3     4     3     5     3     5     3     5     3     5     3     5     3     5     3     6     6     6     6     6     7    12    15    17    17    19    17    19    18    19    19    20    19    20    20    20    20    20    20    20    20    20    20    20    21    21    21    21    21    21    23    24    23    24    24    24    24    24    25    25    25    25    26    26    26    26    26    27    26    28    27    28    27    28    29    30    28    30    28    30    30    31    29    31    30    32    31    32    31    32    32    33    30    33    34    35    30    33    30    32    31    31    30    32    32    32    32    32    31    32    30    32    33    34    31    34    24    24    23    23    22    23    23    24    23    24    21    22    18    20    15    18    16    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    16    18    17    18    17    18    17    18    14    18    16    17    16    17    16    17    15    17    16    17    12    17    15    16    14    16    13    15    13    15    11    14     3    14     4    14     3    13     3    13     3    13     3    13     3    12     2     8     3     4
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACATAAGGAGCTTCTTTATAGGAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------C
                                               BLH ATG     207     749                      
                                               BLH MIN     207      89                      
                                               BLH MPR     204      89                      
                                               BLH OVR     207      34                      
                                               CDS MIN     207      18                      
                                               EST CLI     158      18                      
                                               ORF LNG     207       1                      
                                                                                                                                                                                                                                                                                                           PROTEIN --- Ci ==== 3e-015     FAA00178.1 TPA: zinc finger protein [Ciona intestinalis] ====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                        PROTEIN === Ce ==== 4e-037     NP_506479.1 arsenite inducible RNA associated protein, Arsenite Inducible Protein AIP-1(22.8 kD) (aip-1) [Caenorhabditis elegans] =======================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PROTEIN === Dm ==== 2e-049     NP_608778.1 CG12795-PA [Drosophila melanogaster] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PREDICTED = Gg ==== 2e-060     XP_422896.1 PREDICTED: similar to Hypothetical protein MGC66295 [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PREDICTED = Sp ==== 2e-061     XP_793584.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PREDICTED = Mm ==== 4e-066     NP_081122.1 RIKEN cDNA 1110060O18 [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PREDICTED = Hs ==== 2e-066     NP_620157.1 hypothetical protein BC018415 [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PREDICTED = Dr ==== 2e-076     NP_956811.1 hypothetical protein MGC66295 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PROTEIN === Xl ==== 9e-123     AAH77523.1 MGC83152 protein [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PROTEIN === ?? ==== 9e-123     NP_001086833.1 MGC83152 protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PROTEIN === Xt ==== 2e-152     CAJ82157.1 novel protein containing AN1-like Zinc finger and Ubiquitin interaction motif [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABH7497.5                                                                                           TGA------------------TGA------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------TGA---------------ATGTAA---TGA---------------------------------------------------------------------------------------------------------------------------------------------------TAA------------TAG------TAA
                                                                   ORF                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  0   1   1           Egg  FL                     TEgg137l07.FL-Sanger                                                             AAGTTTCTTGTGGGAGGAGACACCGGACCGTGACTCGGCAAGACGGGACAGTGAGTCAGCAATGGGGAGCGGGTACATAAGGAGAGGCGGGGGGGAGGCCGGAGTTTCGAGACGATACCGGCGGCAACAGGTTGCTCAAAGGCAATTGGCATATTTACAGGTTTATACAATGGAATTTCCAGATCTAGGACATCATTGTTCAGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAATCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACTGAATGAAGATGAAGCGCTAAAGAAGGCACTGGAACTGTCTTTACTGGAGACAGGAGTCAATAACTTACTGACATTAAGCCCACAGGATGAAGATGGGGAACTGGAGCAGGCTTTAGCTGCCAGCAGGGAGGAATATAGGCTATTCCAGAGGAAAGCTGTAAAAGCCACAGGAAAGTGACATAATGTTCAACAATATCTACCTTGAGCATTTAGATTGTTGATGTAAATCTGACTTTTTTATGAGGTTGTTTTTATCGTTGTTACTATATGTGGAGACGTTACTTATAGAGAAGCACTTTCATATTTATTTGCTAATCCTTTTTTTTTTTTTTTTTTTGTACTCGTGTGTTTTATTTTCTTCTCATATGGGATTTTTGTACATAAGGAGCTTCTTTATAGGAACAATAAAGTGCTATTTTTAGTAATGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas6      in                         ANBT3246.5p CGGAAGTAGAAGCAGGCGAAAGCTTGCAGTGACAAAGCTGGAGCGTTCGGGACCGTCTGGAAGTTTCTTGTGGGAGGAGACACCGGACCGTGACTCGGCAAGACGGGACAGTGAGTCAGCAATGGGGAGCGGGTACATAAGGAGAGGCGGGGGGAGGCCGGAGTTTCGAGACGATACCGGCGGCAATAGGTTGCTCAAAGGCAATTGGCATATTTACAGGTTTATACAATGGAATTTCCAGATCTAGGACATCATTGTTCAGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAATCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas6      in                         ANBT3246.3p                      GCTTGCAGTGACAAAGCTGGAGCGTTCGGGACCGTCTGGAAGTTTCTTGTGGGAGGAGACACCGGACCGTGACTCGGCAAGACGGGACAGTGAGTCAGCAATGGGGAGCGGGTACATAAGGAGAGGCGGGGGGAGGCCGGAGTTTCGAGACGATACCGGCGGCAATAGGTTGCTCAAAGGCAATTGGCATATTTACAGGTTTATACAATGGAATTTCCAGATCTAGGACATCATTGTTCAGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAATCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCC
  5   1   2       bld Egg  5g                        TEgg140i05.p1kSP6                       CTTGCAGTGACAAAGCAGGAGCTTTCGGGACCGTCTGGAAGTTTCTTGTGGGAGGAGACACCGGACCGTGACTCGGCAAGACGGGACAGTGAGTCAGCAATGGGGAGCGGGTACATAAGGAGAGGCAGGGGGAGGCCGGAGTTTCGAGACGATACCGGCGGCAACAGGTTGCTCAAAGGCAATTGGCATATTTACAGGTTTATACAATGGAATTTCCAGATCTAGGACATCATTGTTCAGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAGTCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCC
  5   1   2       bld Egg  5g3  in                   TEgg018f16.p1kSP6                         GCAGTGACAAAGCTGGAGCGTTCGGGACCGTCTGGAAGTTTCTTGTGGGAGGAGACACCGGACCGTGACTCGGCAAGACGGGACAGTGAGTCAGCAATGGGGAGCGGGTACATAAGGAGAGGCGGGGGGGAGGCCGGAGTTTCGAGACGATACCGGCGGCAACAGGTTGCTCAAAGGCAATTGGCATATTTACAGGTTTATACAATGGAATTTCCAGATCTAGGACATCATTGTTCAGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAATCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGG
  5   1   2       bld Egg  FL                        TEgg137l07.p1kSP6                                                            AAGTTTCTTGTGGGAGGAGACACCGGACCGTGACTCGGCAAGACGGGACAGTGAGTCAGCAATGGGGAGCGGGTACATAAGGAGAGGCGGGGGGGAGGCCGGAGTTTCGAGACGATACCGGCGGCAACAGGTTGCTCAAAGGCAATTGGCATATTTACAGGTTTATACAATGGAATTTCCAGATCTAGGACATCATTGTTCAGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAATCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCT
  5   1   2       bld TpA  5g                        TTpA013c11.p1kSP6                                                                                                                                       CATAAGGAGAGGCGGGGGGGAGGCCGGAGTTTCGAGACGATACCGGCGGCAACAGGTTGCTCAAAGGCAATTGGCATATTTACAGGTTTATACAATGGAATTTCCAGATCTAGGACATCATTGTTCAGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAATCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACTGAATGAAGATGAAGCGCTAAAGAAGGCACTGGAACTGTCTTTACTGGAGACAGGAGTCAATAACTTACTGACATTAAGCCCACAGGATGAAGATGGGGAACTGGAGCAGGCTTTAGCTGCCAGCAGGGAGGAATATAGGCTATTCCAGAGGAAAGCTGTAAAAGCCACAGGAAAGTGACATAATGTTTTCACATATCTACCTTGAGCATT
  5   1   2       bld Egg  5g3  in                   TEgg041m03.p1kSP6                                                                                                                                                                        GAGACGATACCGGCGGCAACAGGTTGCTCAAAGGCAATTGGCATATTTACAGGTTTATACAATGGAATTTCCAGATCTAGGACATCATTGTTCAGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAATCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAAT
  5   1   2       bld Egg       in                   TEgg051p08.p1kSP6                                                                                                                                                                          AATCCCCGGGGCGGCAATAGGTTGCTCAAAGGCAATTGGCATATTTACAGGTTTATACAATGGAATTTCCAGATCTAGGACATCATTGTTCAGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAATCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAAT
  3   1   2       bld Egg       in                    TEgg051p08.q1kT7                                                                                                                                                                          AATCCCCGGGGCGGCAATAGGTTGCTCAAAGGCAATTGGCATATTTACAGGTTTATACAATGGAATTTCCAGATCTAGGACATCATTGTTCAGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAATCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg  5g3  in                   TEgg013m07.p1kSP6                                                                                                                                                                           CCGGGGCCCGGGCCCCGGGGTTGCTCAAAGGCAATTGGCATATTTACAGGTTTATACAATGGAATTTCCAGATCTAGGACATCATTGTTCAGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAGTCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAG
  5   1   2       bld Gas0 5g                              dad17a05.y1                                                                                                                                                                              CCGGGGGCGGCAACAGGTTGCTCAAAGGCAATTGGCATATTTACAGGTTTATACAATGGAATTTCCAGATCTAGGACATCATTGTTCAGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAGTCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTTATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGGAATCCAAT
  5   1   2       bld Egg  5x3  out                  TEgg005b01.p1kSP6                                                                                                                                                                               CGGCAACAGAGCTGCTCAAAGGCAATTGTGCATATCTTACGGGTCTTATACAATGAGAATTTCCAGATCTAAGACATCATTGTATCTGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCAAGGAACTTTTCTGGAAAGATCACATCACATATGACCAACACGAGTGTTCAGCTGCCTATAACAAGAATGTGCTGGGTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGCAAACAAAGGAGAAATGGCACACATTGCTGTTATCCAGCACATTGACAGAAATTGCACCTCAAGTCACAAGCAAAAGATTTTCACAAACCGATGCTTCGAGGCAGGCTGCACAAAGAAAGAGCTAATGAGAGTTATATGTGACCTTTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGACATTTCTAAATCTGGGATGGCAGCCCTGAGCACATCTAAAGTAGCTTCTCAAGATTAT
  5   1   2       bld Egg  5g3  in                   TEgg067l14.p1kSP6                                                                                                                                                                                    GCGGCAACAGGTTGCTCAAAGGCAATTGGCATATTTACAGGTTTATACAATGGAATTTCCAGATCTAGGACATCATTGTTCAGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAGTCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAAT
  5   1   2       bld Egg  5g3  in                   TEgg005c12.p1kSP6                                                                                                                                                                                     CGGCAACAGGTTGCTCAAAGGCAATTGGCATATTTACAGGTTTATACAATGGAATTTCCAGATCTAGGACATCATTGTTCAGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAGTCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAAT
  5   1   2       bld Egg  5g                        TEgg131o20.p1kSP6                                                                                                                                                                                          ACAGGTTGCTCAAAGGCAATTGGCATATTTACAGGTTTATACAATGGAATTTCCAGATCTAGGACATCATTGTTCAGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAGTCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACTGAATGAAGATGA
  5   1   2       bld Egg  5g   ?                    TEgg031a21.p1kSP6                                                                                                                                                                                            GAGGTAGATCATAGGCAATTGGCATATTTACAGGATTATACATGGAATTTCCAGATCTAGGACATCATTGTTCAAAAGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAGTCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACCACTGTAAAACTGGAAAACCGGCCA
  5   1   2       bld Egg  5g3  in                   TEgg030f16.p1kSP6                                                                                                                                                                                             GGTTGCTCAAAGGCAATTGGCATATTTACAGGTTTATACAATGGAATTTCCAGATCTAGGACATCATTGTTCAGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAGTCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAGAGATCC
  5   1   2       bld Egg  5g3  in                   TEgg035i13.p1kSP6                                                                                                                                                                                               TTGCTCAAAGGCAATTGGCATATTTACAGGTTTATACAATGGAATTTCCAGATCTAGGACATCATTGTTCAGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAGTCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACT
  5   1   2       bld Egg  5g                        TEgg094h17.p1kSP6                                                                                                                                                                                               TTGCTCAAAGGCAATTGGCATATTTACAGGTTTATACAATGGAATTTCCAGATCTAGGACATCATTGTTCAGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAGTCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACTGAATGAAG
  5   1   0       chi Fat1      in                         CABC7071.5p                                                                                                                                                                                                                        ATTTCATACAACATTGTAGTAAATGTTAATAAGACATTCAGATTAATTTAAGGTGTTTTAATTGATGTGGATATGGGGGCTTTATGATCATAAACTTGTAGATTAGTAACCCTGTTTTTGAAAATGTATGCAATGGTATGCATTCACTGAGAATTACTTATGTCCTGATCAATACTCTAGTAATCCTGCATGTTTCACAAATGCAATATAGAAAAATTAAATGTAAGGAAAGCTTATGTAATATGACTTATTCCACTATGTATAGCTTTTTGTATTCCTTTGTCAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTAATGTAACTAACCCTTCTCACTAAAATATGTAGTTTGTTACTAAATATATGTTTGAACTAAATGCTGTTCCTTTATTGGCTTTATTTAATGAGTAGGAGAACTTTTACATGGGATGTTTGCTTTTTCCTAAGTGCTTTGTATATTGCATGAGACATTTTGAGATTTATCTCTGACTTTTGCCAGACAATGATTATCATAAACCCATACACTGCAAAATAATTGCTAAGCCCAATGGGTTAATTTTGAACTTTGGAGCCTCATATGCTAAAGTATTTTGGGCTCTTTTTGCCTTCAAAATTTCATAATCTTTCAAACCCATTTG
  5   1   2      seed Mus1                                 CABH7497.5p                                                                                                                                                                                                                                        GAATTTCCAGATCTAGGACATCATTGTTCAGAGGCTACATGCAAGCAACTTGATTTCCTTCCCCTAAAATGTGATGCCTGCGAGGAACTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAATCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACTGAATGAAGATGAAGCGCTAAAGAAGGCACTGGAACTGTCTTTACTGGAGACAGGAGTCAATAACTTACTGACATTAAGCCCACAGGATGAAGATGGGGAACTGGAGCAGGCTTTAGCTGCCAGCAGGGAGGAATATAGGCTATTCCAGAGGAAAGCTGTAAAAGCCACAGGAAAGTGACATAATGTTCAACAATATCTACCTTGAGCATTTAGATTGTTGATGTAAATCTGACTTTTTTATGAGGTTGTTTTTATCGTTGTTACTATATGT
  5   1   2       bld Tad5      in                         XZT64049.5p                                                                                                                                                                                                                                                                                                                               CTTTTCTGTAAAGATCACATCACATATGACCAACACAAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAATCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACTGAATGAAGATGAAGCGCTAAAGAAGGCACTGGAACTGTCTTTACTGGAGACAGGAGTCAATAACTTACTGACATTAAGCCCACAGGATGAAGATGGGGAACTGGAGCAGGCTTTAGCTGCCAGCAGGGAGGAATATAGGCTATTCCAGAGGAAAGCTGTAAAAGCCACAGGAAAGTGACATAATGTTCAACAATATCTACCTTGAGCATTTAGATTGTTGATGTAAATCTGACTTTTTTATGAGGTTGTTTTTATCGTTGTTACTATATGTGGAGACGTTACTTATAGAGAAGCACTTTCATAT
  5   1   2       bld Egg       in                   TEgg021a01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                   AAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAATCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAAT
  3   1   2       bld Egg       in                    TEgg021a01.q1kT7                                                                                                                                                                                                                                                                                                                                                                   AAGTGTTCAGCTGCCTATAAGAAGAATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAATCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGGAAATCC
  5   1   2       bld Egg                            TEgg119m12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                    AAGTGTTCAGCTGCCTATAAGAAGATGTGCTGGTTCCTGTTTGTCCACTATGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAATCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAAT
  5   1   2       bld Gas8                                 st106f21.5p                                                                                                                                                                                                                                                                                                                                                                                                                      TGTGGCACTCCAGTTCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAATCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg067l14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCAGTAAACAAAGGAGAAATGGCAGACATTGCTGTTAGTCAGCACATTGACAGAAATTGCACCTCAAGTCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACTGAATGAAGATGAAGCACTAAAGAAGGCACTGGAACTGTCTTTACTGGAGACAGGAGTCAATAACTTACTGACATTAAGCCCACAGGATGAAGATGGGGAACTGGAGCAGGCTTTAGCTGCCAGCAGGGAGGAATATAGGCTATTCCAGAGGAAAGCTGTAAAAGCCACAGGAAAGTGACATAATGTTCAACAATATCTACCTTGAGCATTTAGATTGTTGATGTAAATCTGACTTTTTTATGAGGTTGTTTTTATCGTTGTTACTATATGTGGAGACGTTACTTATAGAGAAGCACTTTCATATTTATTTGCTAATCCTTTTTTTTTTTTTTTTGTACTCGTGTGTTTTATTTTCTTCTCATATGGGATTTTTGTACATAAGGAGCTTCTTTATAGGAACAATAAAGTGC
  3  -1   2       chi Hrt1                                CAAQ12832.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTCGTCTCCTATAGGGCGAGAGGCTGCACCTCAAATCACAAGCAAAAGATTTTCACAAACCGATGCTTCAAGGCAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACTGGTAAGAACATTTTATATTGAATTTTAGTACTGTGACATTACTACAGATATCTGCCAAATGGAAGGAAACGATAAACATAGAATATTCTAAAGCATGCACTTCCACACTGGTGTGGTTATTAAAAGGTACCACCCCAGTGAAGTCATCCTTCCCAGGACAGTGAATATGAACATAATTGCTAAATTTCTACAGAATGGAAGTAGATGCACATGACTAGCAGTACTGAGTGCACTGTAACATTTTGTATAAACCCTTTTCTTTTAAATCATCCCATACATGGCCCACTAGAATGGCTGAATTGGATCATGACATAACAAAATGTTGCAGCCTTTGCTAGGTCTGGGGAAACTGCTTCcagtgtcggactggcccaccaggataccaggaaaactcccggtgggcccaggtgtcagtgggccctcctgctcctgaccatttggcctgtttcatggtcattccctatttctgaatgggaacaaagaggagaaatagatggaagaatagatgctag
  3   1   2       chi Fat1      in                         CABC7071.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATGAATACAGAGCTGAACTTCTCCTGTGGTATACTGTCCCTTTACCCTACCTATAGTTCAAGATGAATACTGTTGATTGAATGTATTTATCATGCTGCTTTGTTGGAAGCAACAGGTCTTATTTATATAAGTATATTGGAGTGTATATGAATCTATTTCAGTACAGTAAATATTTATTTCTTTATAGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACTGAATGAAGATGAAGCACTAAAGAAGGCACTGGAACTGTCTTTACTGGAGACAGGAGTCAATAACTTACTGACATTAAGCCCACAGGATGAAGATGGGGAACTGGAGCAGGCTTTAGCTGCCAGCAGGGAGGAATATAGGCTATTCCAGAGGAAAGCTGTAAAAGCCACAGGAAAGTGACATAATGTTCAACAATATCTACCTTGAGCATTTAGATTGTTGATGTAAATCTGACTTTTTTATGAGGTTGTTTTTATCGTTGTTACTATATGTGGAGACGTTACTTATAGAGAAGCACTTTCATATTTATTTGCTAATCCTTTTTTTTTTTTTTTTTGTACTCGTGTGTTTTATTTTCTTCTCATATGGGATTTTTGTACATAAGGAGCTTCTTTATAGGAACAATAAAGTGCTATTTTTAGTAATGT
  3   1   2       bld Egg  5g3  in                    TEgg041m03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGCAAAGGATTTTCACAAACAGATGCTTCAAGGCAGGGTGCAAAAAGAAAGAGCTAATAAAAGTTTTTTGTGCCCATTGTCCCAATAATTTTTGCCTATCGCACAGACATCCTTGGGGCCCCGACTGTAAAACGGGAAACCCGGCCATTTCTAAATTTGGGTTGGCACCCCTGAGCAGATTTAAAGAAGCTTCCCAAGATTATAGCTTGAAAGTCACCGAAGCCCCAAAATTTCCAAGACCCAAAACATTTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGTTTTGCGGGCCCGAAAGTGATCAGTGTAGAGATCCAGAATGGACGGAATGAAGATGAAGCGTTAAAGAAGGCACTGGAACTTTCTTTACTGGAGACAGGAGTCAATAACTTACTGCCATTAAGCCCCCAGGATGAAGATGGGGAACGGGAGCAGGCTTTTGCTCCCAGCAGGGAGGAAAATAGGCTATTCCAGGGGAAAGCTGTAAAAGCCCCAGGAAAGGGACAAAATGTTCAACAATATTTCCCTTGAGCATTTAGATGGTGGAGGTAAATCTGACTTTTTTATGAGGTGGTTTTTATCGTGGTTACTATATGGGGAGACGTTACTTATAGAGAAGCCCTTTCATATTTATTTGCTAACCCTTTTTTTTTTTTTTTTTTTGGTACTCGGGTGTTTTATTTTCTTCTCATATGGGATTTTTGCACATAAGGAGCTTCTTTATAGGAAACAAAAAAAAGGTATTTTTGGTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Egg  5g3  in                    TEgg035i13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGGCTGCAAAAAGAAAGAGCTAATGAAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACTGAATGAAGATGAAGCACTAAAGAAGGCACTGGAACTGTCTTTACTGGAGACAGGAGTCAATAACTTACTGACATTAAGCCCACAGGATGAAGATGGGGAACTGGAGCAGGCTTTAGCTGCCAGCAGGGAGGAATATAGGCTATTCCAGAGGAAAGCTGTAAAAGCCACAGGAAAGTGACATAATGTTCAACAATATCTACCTTGAGCATTTAGATTGTTGATGTAAATCTGACTTTTTTATGAGGTTGTTTTTATCGTTGTTACTATATGTGGAGACGTTACTTATAGAGAAGCACTTTCATATTTATTTGCTAATCCTTTTTTTTTTTTTTTTTGTACTCGTGTGTTTTATTTTCTTCTCATATGGGATTTTTGTACATAAGGAGCTTCTTTATAGGAACAATAAAGTGCTATTTTTAGTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg013m07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGTTATATGTGACCATTGTCACAATAACTTCTGCCTATAGCACAGACATCCTTTGGACCAGGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCCCAAAATCTACAAGAACCAAAACTTCGGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACTGAATGAAGATGAAGCACTAAAGAAGGCACTGGAACTGTCTTTACTGGAGACAGGAGTCAATAACTTACTGACATTAAGCCCACAGGATGAAGATGGGGAACTGGAGCAGGCTTTAGCTGCCAGCAGGGAGGAATATAGGCTATTCCAGAGGAAAGCTGTAAAAGCCACAGGAAAGTGACATAATGTTCAACAATATCTCCCTTGAGCATTTAGATTGTTGATGTAAATCTGACTTTTTTATGAGGTTGTTTTTATCGTTGTTACTAAACGTGGAGACGTTACTTATAGAGAAGCTCCTTATGTACAAAAATCCCATATGAGAAGAAAATAAAACACACGAGTCAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT64049.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCTATCGCACAGACATCCTTTGGACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATTTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAAGGAAGCCCCAAAATTTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTTTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACTGAATGAAGATGAAGCGCTAAAGAAGGCACTGGAACTGTCTTTACTGGAGACAGGAGTCAATAACTTACTGACATTAAGCCCCCAGGATGAAGATGGGGAACTGGAGCAGGCTTTAGCTGCCAGCAGGGAGGAATATAGGCTATTCCAGAGGAAAGCTGTAAAAGCCCCAGGAAAGTGACATAATGTTCAACAATATCTCCCTTGAGCATTTAGATTGTTGATGTAAATCTGACTTTTTTATGAGGTTGTTTTTATCGTTGTTACTATATGGGGAGACGTTACTTATAGAGAAGCACTTTCATATTTATTTGCTAATCCTTTTTTTTTTTTTTTTTTTGGTACTCGGGTGTTTTATTTTCTTCTCATAGGGGATTTTTGTACATAAGGAGCTTCTTTATAGGAACAATAAAGTGCTATTTTTGGT
  3   1   2       bld Egg  5g3  in                    TEgg018f16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACCACGACTGTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATTTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATTTGGAAGTGTGAAATCCAATAAAAAAAAAACCATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACTGAATGAAGATGAAGCGCTAAAGAAGGCACTGGAACTGTCTTTACTGGAGACAGGAGTCAATAACTTACTGACATTAAGCCCCCAGGATGAAGATGGGGAACTGGAGCAGGCTTTAGCTGCCAGCAGGGAGGAATATAGGCTATTCCAGAGGAAAGCTGTAAAAGCCCCAGGAAAGTGACATAATGTTCAACAATATCTACCTTGAGCATTTAGATTGTTGATGTAAATCTGACTTTTTTATGAGGTTGTTTTTATCGTTGTTACTATATGTGGAGCCGTTACTTATAGAGAAGCACTTTCATATTTATTTGCTAATCCTTTCTTTTTTTTTTTTTTTTGTATTCGTGTGTTTTATTTTCTTCTACATATGGGATTTTTGTACATAAGGAGCTTCTTTATAGGAACAATAAAGTGCTATTTTTAGTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg005c12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTAAAACTGGAAAACCGGTCATTTCTAAATCTGGGTTGGCAGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACTGAATGAAGATGAAGCACTAAAGAAGGCACTGGAACTGTCTTTACTGGAGACAGGAGTCAATAACTTACTGACATTAAGCCCACAGGATGAAGATGGGGAACTGGAGCAGGCTTTAGCTGCCAGCAGGGAGGAATATAGGTTATTCCAGAGGAAAGCTGTAAAAGCCACAGGAAAGTGACATAATGTTCAACAATATCTACCTTGAGCATTTAGATTGTTGATGTAAATCTGACTTTTTTATGAGGTTGTTTTTATCGTTGTTACTATATGTGGAGACGTTACTTATAGAGAAGCACTTTCATATTTATTTGCTAATCCTTTTTTTTTTTTTTTTTTGTACTCGTGTGTTTTATTTTCTTCTCATATGGGATTTTTGTACATAAGGAGCTTCTTTATAGGAACAATAAAGTGCTATTTTTAGTAATGTAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Gas                            TGas019o07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCCCTGAGCAGATCTAAAGTAGCTTCTCAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACTGAATGAAGATGAAGCGCTAAAGAAGGCACTGGAACTGTCTTTACTGGAGACAGGAGTCAATAACTTACTGACATTAAGCCCACAGGATGAAGATGGGGAACTGGAGCAGGCTTTAGCTGCCAGCAGGGAGGAATATAGGCTATTCCAGAGGAAAGCTGTAAAAGCCACAGGAAAGTGACATAATGTTCAACAATATCTACCTTGAGCATTTAGATTGTTGATGTAAATCTGACTTTTTTATGAGGTTGTTTTTATCGTTGTTACTATATGTGGAGACGTTACTTATAGAGAAGCACTTTCATATTTATTTGCTAATCCTTTTTTTTTTTTTTTTTTTTTGTACTCGTGTGTTTTATTTTCTTCTCATATGGGATTTTTGTACATAAGGAGCTTCTTTATAGGAACAATAAAGTGCTTTTTTAGTAATGTAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg030f16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTTTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACTGAATGAAGATGAAGCACTAAAGAAGGCACTGGAACTGTCTTTACTGGAGACAGGAGTCAATAACTTACTGACATTAAGCCCCCAGGATGAAGATGGGGAACTGGAGCAGGCTTTAGCTGCCAGCAGGGAGGAATATAGGCTATTCCAGAGGAAAGCTGTAAAAGCCCCAGGAAAGTGACATAATGTTCAACAATATCTCCCTTGAGCATTTAGATTGTTGATGTAAATCTGACTTTTTTATGAGGTTGTTTTTATCGTTGTTACTATATGTGGAGACGTTACTTATAGAGAAGCACTTTCATATTTATTTGCTAATCCTTTTTTTTTTTTTTTTTGTACTCGTGTGTTTTATTTTCTTCTCACATGGGATTTTTGTACATAAGGAGCTTCTTTATAGGAACAATAAAGTGCTATTTTTAGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  FL   out                   TEgg005f01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGATTATAGCTTGAAAGTCAACGAAGCCACAAAATCTACAAGACCCAAAACATGTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTTTGCGGGACCGAAAGTGATCAGTGTTGAGATCCAGAATGGACTGAATGAAGATGAAGCGCTAAAGAAGGCTCTGGAACTGTCTTTACTGGAGACAGGAGTCAATAACTTACTGACATTAAGCCCACAGGATGAAGATGGGGAACTGGAGCAGGCTTTAGCTGCCAGCAGGGAGGAATATAGGCTATTCCAGAGGAAAGTTGTATAAGCCCCAGGAAAGTGACATAATGTTCAGCAATATCTCCCTGGAGCATTTAGATTGTTGATGTAAATCTGACTTTTTTATGAGGTCGTTTTTATCGTTGTTACTATACCCGGAGACGTTACTTATAGAGAAGCACTTTCATATTTATTTGCTAATCCTTTTGATTTTTTTTTTTTGTACTCGTGTGTTTTATTTTCTTCTCATATGGGATTGTGGTACATAAGGAGCTTCTTTATAGGATCAATAAAGTGCTATTTTTAGTAATGTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg027l13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACTGAATGAAGATGAAGCACTAAAGAAGGCACTGGAACTGTCTTTACTGGAGACAGGAGTCAATAACTTACTGACATTAAGCCCACAGGATGAAGATGGGGAACTGGAGCAGGCTTTAGCTGCCAGCAGGGAGGAATATAGGCTATTCCAGAGGAAAGCTGTAAAAGCCCCAGGAAAGTGACATAATGTTCAACAATATCTACCTTGAGCATTTAGATTGTTGATGTAAATCTGACTTTTTTATGAGGTTGTTTTTATCGTTGTTACTAAATGTGGAGACGTTACTTATAGAGAAGCACTTTCATATTTATTTGCTAATCCTTTTTTTTTTTTTTTTTTTTTTTTTTGTACTCGTGTGTTTTATTTTCTTCTCATATGGGATTTTTGTACATAAGGAGCTTCTTTATAGGAACAATAAAGTGCTATTTTTAGTAATGTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg       in                   TEgg027l13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAATCTACAAGAACCAAAACATCTGGAAGTGTGAAATCCAATAAAAAAAAAAACATTTTTCCTGGCTCTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACTGAATGAAGATGAAGCACTAAAGAAGGCACTGGAACTGTCTTTACTGGAGACAGGAGTCAATAACTTACTGACATTAAGCCCACAGGATGAAGATGGGGAACTGGAGCAGGCTTTAGCTGCCAGCAGGGAGGAATATAGGCTATTCCAGAGGAAAGCTGTAAAAGCCACAGGAAAGTGACATAATGTTCAACAATATCTACCTTGAGCATTTAGATTGTTGATGTAAATCTGACTTTTTTATGAGGTTGTTTTTATCGTTGTTACTAAATGTGGAGACGTTACTTATAGAGAAGCACTTTCATATTTATTTGCTAATCCTTTTTTTTTT
  5   1   2       bld Gas                            TGas019l06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTGCGGGACCGAAAGTGATCAGTGTAGAGATCCAGAATGGACTGAATGAAGATGAAGCGCTAAAGAAGCACTGGAACTGTCTTTACTGGAGACAGGAGTCAATAACTTACTGACATTAAGCCCACAGGATGAAGATGGGGAACTGGAGCAGGCTTTAGCTGCCAGCAGGGAGGAATATAGGCTATTCCAGAGGAAAGCTGTAAAAGCCACAGGAAAGTGACATAATGTTCAACAATATCTACCTTGAGCATTTAGATTGTTGATGTAAATCTGACTTTTTTATGAGGTTGTTTTTATCGTTGTTACTATATGTGGAGACGTTACTTATAGAGAAGCACTTTCATATTTATTTGCTAATCCTTTTTTTTTTTTTTTTTTTTGGACTCGTGTGTTTTATTTTCTTCTCATATGGGATTTTTGTACATAAGGAGCTTCTTTATAGGAACAATAAAGTGCTATTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)