Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012074170 Xt7.1-XZT38209.5 - 62 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT38209.5 CGCACTCCCCCGATCCCTTGGCGGCAGCGCTGCTTCTTTTGTTTGGAGGCGCCACATCCTTAGAACCGAACCGGATCGGGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCTGAGGAAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAGCAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAAGCATTGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCTGTCGTCCTAATAAAACTTTTAAGATTTTAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008224844       CCCCCGATCCCTTGGCGGCAGCGCTGCTTCTTTTGTTTGGAGGCGCCACATCCTTAGAACCGAACCGGATCGGGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCTGAGGAAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAGCAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAAGCATxxxxTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCTGTCGTCCTAATAAAAxTTTxxAxxTxTTAAAAAAAAAAA
                                                      consensus depths      2     2     3     3     6     6     7     8    10    11    15    15    19    19    20    20    23    23    23    23    23    23    23    23    24    24    24    24    24    24    24    24    24    24    24    24    23    24    24    24    24    24    24    24    24    24    23    24    23    23    23    23    23    23    23    23    23    23    23    23    24    24    24    24    24    24    24    25    24    25    24    26    24    26    25    26    24    26    24    26    25    27    25    26    26    26    26    27    26    27    26    27    24    27    26    28    26    28    26    28    26    28    26    28    26    28    26    28    23    25    23    25    23    25    23    25    23    25    22    24    20    23    20    23    21    24    19    24    18    25    20    22    21    23    22    27    22    27    24    27    24    27    23    25    20    21    21    22    21    22    20    22    21    22    21    22    20    22    23    24    23    24    24    25    23    26    23    25    23    25    24    25    26    27    27    28    27    28    28    28    25    27    26    28    27    28    26    28    27    30    28    30    26    30    29    30    27    29    28    29    25    28    26    27    27    27    28    29    28    29    27    29    24    29    23    29    25    29    24    29    25    29    24    29    22    28    23    28    24    28    24    26    23    24    22    24    22    25    19    25    22    25    11    24     9    23    10    24    10    24    10    23    10    22    10    21     9    20     3    11     6     6
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -T----------
                                               BLH ATG     245     606 
                                               BLH MIN     230      84 
                                               BLH MPR     164      84 
                                               BLH OVR     245     876 
                                               EST CLI      43       8 
                                               ORF LNG     245      27 
                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ce ---= 4e-023     NP_001022652.1 HP1 Like (heterochromatin protein) family member (hpl-2) [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Dm ==== 9e-045     NP_572521.2 CG7041-PA [Drosophila melanogaster] ===============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 3e-051     XP_001180493.1 PREDICTED: similar to Chromobox homolog 1 (HP1 beta homolog Drosophila ) [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                           PROTEIN --- Dr ---- 2e-084     NP_956040.1 chromobox homolog 1 (Drosophila HP1 beta); wu:fe14b09 [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                            PROTEIN === Gg ==== 5e-095     NP_989663.1 chromobox homolog 1 (HP1 beta homolog Drosophila ) [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                            PREDICTED = Mm ==== 1e-095     XP_995453.1 PREDICTED: similar to Chromobox protein homolog 1 (Heterochromatin protein 1 homolog beta) (HP1 beta) (Modifier 1 protein) (M31) (Heterochromatin protein p25) isoform 6 [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                            PROTEIN === Hs ==== 9e-096     NP_006798.1 chromobox homolog 1 (HP1 beta homolog Drosophila ); heterochromatin protein p25beta; chromobox homolog 1 (Drosophila HP1 beta) [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 4e-100     AAH74418.1 MGC84435 protein [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                            PROTEIN === ?? ==== 4e-100     NP_001086279.1 MGC84435 protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                            PROTEIN === Xt ==== 2e-104     CAJ82321.1 chromobox homolog 1 (HP1 beta homolog Drosophila ) [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT38209.5                                                                                                                                                                                                                              TAA---------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------TAG------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------TAGTGA------------------TGA------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------TAA------------------------TGA---------------------------TGA------------------------------------TAG------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  0   1   1           Egg  FL                     TEgg130i17.FL-Sanger                                                                                              AATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCTGAGGAAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAGCAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAAGCATGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCTGTCGTCCTAATAAAACTTTTAGATTTATAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld TbA  5g3  in                   TTbA007l12.p1kSP6 CGCACTCCCCCGATCCCTTGGCGGCAGCGCTGCTTCTTTTGTTTGGAGGCGCCACATCCTTAGAACCGAACCGGATCGGGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAAAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTG
  5   1   2      seed TbA  5g                        TTbA069i02.p1kSP6 CGCACTCCCCCGATCCCTTGGCGGCAGCGCTGCTTCTTTTGTTTGGAGGCGCCACATCCTTAGAACCGAACCGGATCGGGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCTGAGGAAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCAC
  5   1   2       bld Neu  5g                        TNeu142j21.p1cSP6             ATCCCTTGGCGGCAGCGCTGCTTCTTTTGTTTGGAGGCGCCACATCCTTAGAACCGAACCGGATCGGGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCG
  5   1   2       bld TpA  5g                        TTpA037l08.p1kSP6                 CTTGGCGGCAGCGCTGCTTCTTTTGTTTGGAGGCGCCACATCCTTAGAACCGAACCGGATCGGGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCTGAGGAAAGATGACAGAAAGACGAGAAAAACTAAGTGCCCCCCAACATTCACCNACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACG
  5   1   2   12  bld Tad5 5g3  in                         XZT47200.5p ................CTTGGCGGCAGCGCTGCTTCTTTTGTTTGGAGGCGCCACATCCTTAGAACCGAACCGGATCGGGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGA
  5   1   2   12  bld Tad5 5g3  in                         XZT33275.5p ...................GGCGGCAGCGCTGCTTCTTTTGTTTGGAGGCGCCACATCCTTAGAACCGAACCGGATCGGGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCCGAGGAAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCNCACAATTCACCAACGATCCACAGTTAGCGG
  5   1   2       bld Gas8 5g                              st104o03.5p                                 CTTCTTTTGTTTGGAGGCGCCACATCCTTAGAACCGAACCGGATCGGGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAA
  5   1   2       bld Tad5      in                           XZT829.5p                                   TTCTTTTGTTTGGAGGCGCCCATCCTTAGAACCGAACCGGATCGGGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTTCTGAGGAGATGACNNAGAAGACGA
  5   1   2       bld TbA  5g                        TTbA004g14.p1kSP6                                          TTTGGAGGCGCCACATCCTTAGAACCGAACCGGATCGGGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCCGAGGAAGATGACAAGAAAGACGAG
  5   1   2       bld Gas8 5g3  in                         st110m04.5p                                            TGGAGGCGCCACATCCTTAGAACCGAACCGGATCGGGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCTTTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCANAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTAC
  5   1   2   12  bld Tad5 5g3  in                         XZT38209.5p ..............................................AGGCGCCACATCCTTAGAACCGAACCGGATCGGGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCTGAGGAAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGG
  5   1   2       bld TpA  5g3  in                   TTpA058n12.p1kSP6                                                  CGCCACATCCTTAGAACCGAACCGGATCGGGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCTGAGGAAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACG
  5   1   2       bld TbA  5g                        TTbA046d06.p1kSP6                                                    CCACATCCTTAGAACCGAACCGGATCGGGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAAT
  5   1   2   10  bld Liv1 5g3  in                        CAAR12466.5p ...................................................CCACATCCTTAGAACCGAACCGGATCGGGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCTGAGGAAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCAACAATTCACAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACT
  5   1   2       bld TbA  5g3  in                   TTbA015o20.p1kSP6                                                       CATCCTTAGAACCGAACCGGATCGGGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAAGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGG
  5   1   2   20  bld Limb 5g                             CBSU7700.fwd .................................................................CCGAACCGGATCGGGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGCTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGTAGAAACCACGGGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCCGGGGAGATGACAAGAAAGACGAG
  5   1   2       chi Gas7 5g3  in                         XZG56278.5p                                                                   CGAACCGGATCGGGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGCATTCTTACCCTTCTGAGGAAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGAC
  5   1   2   32  bld Tad5 5g                              XZT30957.5p .....................................................................ACCGGATCGGGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCTGAGGAAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGA
  5   1   2   32  bld Gas7 5g                              XZG58815.5p ......................................................................CCGGATCGGGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTATGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCCCGAGGAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCACAATTCACCCACGATCCACAGTTAGCG
  5   1   2   12  bld Gas7 5g3  in                         XZG27004.5p ..............................................................................GGACGCACAGGAATCAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCCGAGGAAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGT
  5   1   2       bld Egg  5g3  in                   TEgg024h13.p1kSP6                                                                                         GGAATAATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGTACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCG
  5   1   2       bld Egg  FL                        TEgg130i17.p1kSP6                                                                                               ATTTGTTCTGTTCATTCAGGGGATCGGAACCCGCTCCAATAGCCGAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGAC
  5   1   2       bld Gas8 5g                              st105o03.5p                                                                                                TTTGTTCTGTTCATTCAGGGGATCGGANCCCGCTCCGNTAGCCGAGAAGAAAGCGAGCTCCNGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCNTTAATCANATGAACTGGCGACCTCCATGGGAANGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCNACGANGAGGAGGAGGAGTACGTGGTGGANAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACTAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGANGGATGAAGTGNAGAAACCACGTGGTTTTGCACGCGGATTGNAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGG
  5   1   2   12  bld Gas7 5g3  in                         XZG24081.5p .......................................................................................................................................GTCTAGAAGAAAGCGAGCTCCAGCCGCGCAGCCGGACCGATCCCAGGCCCCAGGCACCGGGGAGCCCAAGCAAGCGGCGGCTCCATTAAGCAGATAAACTGGCGACCTCCATGGGAAAGAAGCAGAACAAGAAAAAGATGGAAGAGGTTGTCGACGAGGAGGAGGAGGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCCGAGGAAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCCCGCCAGAGTGAGGAAGGGGGAGAGCCGTGAAGGATTCAGTCT
  5   1   2       bld Tad5      in                          XZT6608.5p                                                                                                                                                                                                                                                                                                              GGAGTACGTGGTGGAGAAGGTCCTGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCTGAGGAAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCCTCCTTCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGT
  5   1   2       bld Neu                            TNeu076g06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                  GAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCTGAGGAAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACG
  5   1   2       bld Brn4      ?                         CAAL22003.5p                                                                                                                                                                                                                                                                                                                                                                                                             CCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCCGAGGAAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTTGGGACCCTGT
  5   1   2       bld Egg                            TEgg085l14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                TTGGACTGACCCTTATCGTCTCCCCAAGTTCCTGCAGGCGCATCACTTGGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCCAGAAGAAGAATGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAGATGGAAAAACTCATACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCTGAGGAAGATGACCAGAAAGACGAGAAAAACTAAGTGCCCCCCAACGATTCACCGACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGAATGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGACATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCT
  5   1   2       bld Neu                            TNeu030j13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGAAAACAGAGGCAGGCAAGCGCAAGGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGAAGAAGAAGGATGAAGTGGAGAAACCACGTGGTTTTGCACGCGGATTGGAACCGGAGAGAATCATTGGTGCCACAGACTCCAGCGGAGAGCTGATGTTCCTAATGAAATGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCTGAGGAAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGNCTGTNCTGAATATTNGGTATGTATTATCGGCAGAAATGCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGNATGCTACAAGC
  5   1   2       bld Gas8                                  st10c23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATATGACTGGCTCCAGTGTGTATCTGCTTCTGGGAACCCTGCATGACCCTAAACATAATCCTGTGCATGCTCATTGGGGTGTGCTCCTTATTTGGGGGGATACAGTGCTAAGCAGCAATGGGTACATCCCCCTCCCCCACAGGAAAAACTCAGACGAAGCCGACCTCGTCCCGGCCAAGGAAGCCAACGTTAAGTGCCCCCAGGTGGTGATCTCGTTCTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCCGAGGAAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGT
  5   1   2       bld Egg                            TEgg112j12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGACCGACGGGTGGTGAAAGGGAAAGTGGAGTATCTCCTGAAATGGAAAGGTTTCTCTGACGACGATAACACCTGGGAGCCGGAGGAGAACTTGGACTGTCCCGATCTCATCGCAGAGTTCCTGCAGTCGCAAAAATCCGCGTACGAGTCGGAGAAAACAGAGGCAGGCAAGCGCAAGGCTGACTCCGACACCGAGGTCGGCGAGGAGAGCAAACCCAAGGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCTGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGC
  5   1   2       bld BrSp      in                     EC2BBA23AC08.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTACGAGGAGCGGCTGACGTGGCATTCTTACCCTTCCGAGGAAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTGGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAGCAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACT
  5   1   2       bld Egg                            TEgg085e07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGCTGACGTGGCATTCTTACCCTTCTGAGGAAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAGCAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGT
  3   1   2       bld Gas7 5g3  in                         XZG24081.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGACGTGGCATTCTTACCCTTCCGAGGAAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAGCAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAACGCATGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCTGTCGTCCTAATAAAACTTTTAGATTT
  3   1   2       bld Gas7 5g3  in                         XZG56278.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGGAAGATGACAAGAAAGACGAGAAAAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGATGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAACAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAAGCATGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCTGTCGTCCTAATAAAACTTTTAGATTTATAAAAAAAAAAAAAAAGG
  3   1   2       bld Tad5 5g3  in                         XZT33275.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAGCAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAAGGCATGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCTGTCGTCCTAATAAAACTTTTAGATTT
  3   1   2       bld Liv1 5g3  in                        CAAR12466.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAACTAAGTGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAGCAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAAGCAGTGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCTGTCGTCCTAATAAAACTTTTAGATTTAT
  3   1   2       bld Tad5 5g3  in                         XZT38209.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCCCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAACAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAAGGCATGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCTGTCGTCCTAATAAAACTTTTAGATTTAT
  5   1   2       bld Gas7                                   XZG642.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCCCCCCACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAGCAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTTAAAAAAGCATGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCTGTCGTCCTAATAAAACTTTAGATTTNTAA
  3   1   2       bld BrSp      in                     EC2BBA23AC08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCCAACAATTCACCAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTGGGGGACCCTGTATAAGAACGGTTATGGGAATTTCATTGCTGGGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAGCAGGTGCTGATCCCATTTTTTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTTCCTTTTTTTTTTTTTCCAGGTTTTTTTTTTTGTTTTTTTAAAAAAAGCATGTGTTTTAG
  3   1   2       bld TpA  5g3  in                    TTpA058n12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAACAGGTGCTGATCCCATTTTTTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTTTTTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTTCCTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAAAGCATGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCTGTCGTCCTAATAAAACTTTTAGATTTTAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg                            TEgg122o08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACGATCCACAGTTAGCGGGTGAGATGTATACGCCAGTCACTCACGCCAGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAGCAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGCATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAA
  3   1   2       bld TbA  5g3  in                   TTbA007l12.q1kbT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCAGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTTGCACAGGGGGCACTGCATCCTACAAGGTTCTCCTCCTCCTCCTCCTTCCGGATAGGGTTACAAACTTTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTTTGGGTGAGACGGGGAGGCCCCGGCGGGAGGGGGGACAAAGGGCTTCGATATCATTGTCCCCCTGGAAAGAAGAAAGGCAGTCCAACAGGTAGCTGCAGATCCTTTTGCCTAGGAACTCGCCACGTGGGGTTTTTTGGGGACCCCGTATAAGAACGGTTATGGGAATTTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCCGGAAGCTGAAACAGGTGGTGATCCCATTTTTTAACACTTCCCCAGAATTCCTTCAAGCTGGGGCCCCGGGGTTTTTGCCATCACGCCGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAAGCATGTGTTTTTGGTTTGGGCAAACTTTGTTTTAATGTAAAATAATTCTTGGCATTTTGTCAGTCTGTGGTCCTAATAAAACATTTTGGGTTTCTATCGGGAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA  5g3  in                    TTbA015o20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAACAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAAGACATGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCTGTCGTCCTAATAAAACTTTTAGATTTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                          XZT6608.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAGTGAGGAAGGGGGAGAGCCGTGGAGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAGCAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAACGCATGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCTGTCGTCCTAATAAAACTTTTAGATTTATAAAAAAAAAAAAAAAGGG
  3   1   2       bld Tad5      in                           XZT829.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGGATTCAGTCTGTCCTGAATATTTGGTATGTATTATCGGCAGAAATCCGGGGACACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAACAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAAGCCATGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCTGTCGTCCTAATAAAACT
  5   1   2       bld Neu                            TNeu143d04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTCCCCTTCCTTTCCTCTTTCTTTTCTGCTCTCCCCTTCCTTTCCTCTTTCTTTTCTGCTCTCCCCTTCCTTTCCTCTTTCTTTTCTGCTCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTATTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAAGTAGCTGCAGATCCTTCTGCCTATGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAAGCAGGAAGCTGAAACAAGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAACTGAAGGCCCCGGG
  3   1   2       bld Sto1      in                          CABG672.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAGCAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAAGCATNGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCTGTCGTCCTAATAAAACTTTTAGATTTAT
  5   1   2       bld Sto1      in                          CABG672.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACGTGGACAGGAGGAACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAGCAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAAGCATGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCTGTCGTCCTAATAAAACTTTTAGATTTATAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 5g3  in                         XZG27004.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACCTAGCACAGGGGACACTGCATCCTACAAGCTTCTCCTCCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCCCGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAGCAGGTGCTGATCCCATTTTTTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTTTCTGCCATCACGCTGGGACTACATACAGATTCATTGTATAAACTGTCAGATTGGTAGTTTTTTTTCCTTTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTTTAAAAAAGGCATGTGTTTTAGGTTTGTGCAAACTTCGTTTTAAGGTAAAGTAATTCTTAGCATTTTGTCAGTCGGTCGTCCTAATAAAACTTTTGGATTTTT
  5   1   2       bld Egg       ?                    TEgg010h23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTGGTATGTATTATCGGGGAGAAATCCGGGGACACGTGGATAGTGTTACAGACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGATACGGTGAGGCCACTGCGGGAGGGGGGACAAAGCGCTTCATATATCATTGTCACCCTGTAAACAAGAAAGACAGTCCACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCTGCACGTGGGGCTCTTTGGGGACCCTGTATAACAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGTCACGCAGGAAGCTGAAGCACGTGCTGATCCCATTTTCTAGCACTTCCCCACAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGGGACTACCTAATGATTCATTGTATA
  3   1   2       bld Tad5 5g3  in                         XZT47200.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTCCTCCTCCTTCCCGATAGTGTTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAGCAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTTTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAAGCCATGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCGGTCGTCCTAATAAAACTTTTGGATTTTT
  3   1   2       bld Egg  5g3  in                    TEgg024h13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTACAAACTCTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAGCAGGTGCTGATCCCATTTTTTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAAGCATGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCTGTCGTCCTAATAAAACTTTTAGATTAAAAAAAAAAAA
  5   1   2       bld Neu                            TNeu033d01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCGGGGTGCATTTTTACTGAGTAGCATGTCCATTTAGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAACAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAAGCATGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCTGTCGTCCTA
  5   1   2       bld Gas0                                 dad37g03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGGGCCCGGGGATTCCCCGGGGTGATGTCTGTGGGTGAGACGGTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTGATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAACAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAAGCATGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTT
  5   1   2       bld Egg                            TEgg104o14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGAGGCCACGGCGGGAGGGGGGACAAAGCGCTTCGATATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAGCAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAAGCATGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCTGTCGTCCTAATAAAACTTTTAGATTTAT
  3   1   2       bld Egg       in                    TEgg045h14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGATCATGGTCACCCGGGAAAGAATAAAGCCAGTCCAACAGGAACCTTCAGATCATTAACCCTAGGAACTGGCCTCGTGGGGGTCTTTGGGGACCCAGTATAAGAACGGTTATGGGAATCTCATTGGGGGGGGGGGGGCGGCTGTCCTGGCAGGCAGGAAGGTGAAGCAGGCGTTGATTCCATTTTCTCACAATTTCCCAGAATTCGTTCAAGCGGGGGCCCCGGGGTCTCTGCCATCACGCAGTGAGTACAAACAGATTCATTGTATAAACTGTCATTATTTGCAGTTTTTTTCTCTTCAGTGTTTTCCAGGTGTTTTTTTTAGAAAATTCAAAAAAAGCAGGTGTTTTCGAGTTTGTGCAAAATTGGTAAGAAATGTAAAGTAATTTTTACCATTTGGTCACTCTAGTCGTCCTAATAGATCTTTTAGATTAAAAAAAA
  5   1   2       bld Egg       in                   TEgg045h14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCATTGTCACCCTGGAAAGAAGAAAGACAGTCCAACAGGTAGCTGCAGATCCTTCTGCCTAGGAACTCGCCACGTGGGGCTCTTTGGGGACCCTGTATAAGAACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGCAGCGAACTGAACAGGTGCTGATCCCATTTTCTAACACTTCCCCATAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAAC
  3   1   2       bld Egg       in                    TEgg055k12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAGCAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTTTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAAGACATGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCTGTCGTCCTAATAAAACTTTTAGATTTTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg       in                   TEgg055k12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACGGTTATGGGAATCTCATTGCTGGGTGGGGGGCGGGTGTCCTGGCAGGCAGGAAGCTGAAGCAGGTGCTGATCCCATTTTCTAACACTTCCCCAGAATTCCTTCAAGCTGAGGCCCCGGGGTCTCTGCCATCACGCTGTGACTACATACAGATTCATTGTATAAACTGTCAGATTTGTAGTTTTTTTCCTTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAAGCATGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCTGTCGTCCTAATAAAACTTTTAGATTTAT
  3   1   1       add Gas8 5g3  in                         st110m04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGNAGNTTTTTTCCCTTTTTTTTTTTCCAGGTTTTTTTTTTGTTTTTTTTAAAAAAGCATGTGTTTTAGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTG
  5  -1   2       bld HdA                            THdA027n13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGTTTGTGCAAACTTCGTTTTAATGTAAAGTAATTCTTAGCATTTTGTCAGTCTGTCGTCCTAATAAAACTTTTAGGTTTTTAAAAAAAAAAAAAAAAAAAAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)