Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 297.0    0Xt7.1-TGas141a20.3.5                      227 PI      82        269      607                hairy2 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 94%

 1012074191 Xt7.1-CABK7497.3 - 50 ESTs
                                                                       ....-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABK7497.3                                                                                               GGGCGGCTCAGTGTCAGGCAGGGCGGCTCAGTAACAGGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTGGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGATTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTTCCTATTTTTTGGAAGTTTTACTTGTATGTAATAAAAACGCACATTTGTATTTTCTCG
                                                  Xt7.1-CHK-1008225714                                                                                                     CTCAGTGTCAGGCAGGGCGGCTCAGTAACAGGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTGGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGATTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTTCCTATTTTTTGGAAGTTTTACTTGTATGTAATAAAAACGCACATTxxxxTTTTCTCGAATTTG
                                                      consensus depths                                                                                                    4     5     8     8    11    13    16    17    17    20    22    24    22    24    23    24    23    24    23    24    23    24    23    24    23    24    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    23    25    23    25    24    26    24    26    24    26    24    26    24    26    24    26    22    25    22    25    22    25    23    26    25    29    25    29    27    31    28    32    29    33    29    33    30    33    30    33    30    33    30    33    30    34    31    35    30    35    30    35    29    35    29    34    28    33    29    34    29    34    29    33    30    34    31    34    30    33    30    32    30    32    30    32    30    32    29    31    29    31    29    33    31    33    31    32    28    29    28    29    26    29    25    28    24    28    25    27    25    26    25    26    25    26    24    24    24    24    24    24    24    24    24    24    24    24    24    24    23    23    23    23    23    23    23    23    23    23    22    22    22    22    22    22    20    21    19    20    19    20    19    20    19    19    19    19    18    19    18    18    16    16    15    16    12    14     9    13     5     8
                                                                   SNP                                                                                                           A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ------C-----
                                               BLH ATG     196     921                                                                                               
                                               BLH MIN     193     111                                                                                               
                                               BLH MPR       4     111                                                                                               
                                               BLH OVR     196      33                                                                                               
                                               CDS MIN     196     111                                                                                               
                                               EST CLI       6      14                                                                                               
                                               ORF LNG     196       1                                                                                               
                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ce ---- 6e-013     NP_500281.1 abnormal cell LINeage LIN-22, Helix Loop Helix containing protein,antero-posterior patterning factor, hairy and enhancer of split homolog (19.5kD) (lin-22) [Caenorhabditis elegans] ===================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Sp ---- 2e-039     NP_001001768.1 hairy and enhancer of split [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 4e-040     NP_476923.1 deadpan CG8704-PA [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ci ---- 5e-044     BAE06388.1 transcription factor protein [Ciona intestinalis] ==========================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Bf ==== 9e-056     AAQ93671.1 hairy E protein [Branchiostoma floridae] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Gg ==== 4e-092     NP_001005848.1 c-hairy1B [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 2e-109     NP_032261.1 hairy and enhancer of split 1; hairy and enhancer of split 1, (Drosophila) [Musmusculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                         PROTEIN --- Dr ---- 6e-110     NP_571154.1 hairy-related 6 [Danio rerio] --------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 2e-112     NP_005515.1 hairy and enhancer of split 1; transcription factor HES-1; hairy homolog(Drosophila) [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 2e-149     AAH70988.1 LOC397813 protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === ?? ==== 2e-149     NP_001081396.1 hairy1 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xt ==== 2e-153     AAY96799.1 hairy1 [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABK7497.3                                                                                                                              TAA------------------------------------------------------------------------------------------------------------------TAA---------------------------------TGA---TAG---ATG------------ATG------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------ATG------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------TAA------ATG---------------------------TAG------------------ATGTGATAGTGA------TGA---------------------------------TGA---ATG---------------------------------------------------------ATGATG---------------------------------------------------------ATGTAATAA
                                                                   ORF                                                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  0   1   1           BrSp FL                   EC2BBA18AC12.FL-Pollet                                                                                   GAGTATCAGGCAGGGCGGCTCAGTGTCAGGCAGGGCGGCTCAGTAACAGGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTAGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGATTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTTCCTATTTTttgGAAGTTTTACTTgTAGTAaTaaaAACgca
  5   1   1           Neu0 FL                     IMAGE:6995964.FL-MGC                                                                                                                    GGCGGCTCAGTGTCAGGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTGGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGACTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTTCCTATTTTTTGGAAGTTTTACTTGTATGTAATAAAAACGCACATTGTATTTTCTCGAATTTGTAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Neu  FL                     TNeu075p11.FL-Sanger                                                                                                                                             CCCGGGGAATCCCCGGGGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTAGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTAGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGATTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTTCCTATTTTTTGGAAGTTTTACTTGTATGTAATAAAAACGCACATTGTATTTTCTCGAATTTGTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas  5g                        TGas027f04.p1kSP6 GGAAAGAAGTTTGGGAAGTTTCACACGAGCCGTTCGCGTGCGGTTAGCGCTATATAAAGAGGGAGCCAGGCGGAGGGCAGCTCAGTATCAGGCAGGGCGGCTCAGTGTCAGGCAGGGCGGCTCAGTAACAGGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTG
  5   1   2       bld In66 5g                         IMAGE:8965928.5p                                                           ATAATTTTTAAAAAAATCCCTACATATAATTAAAAACGTCCCCTCAGTGTCAGGCAGGGCGGCTCAGTAACAGGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTAGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTTCAGCTCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATGCATGCAGATGGGTGGTCCACCAGTAGAAGCTGCAAGTGTATGAGCTCAGCTGTGCAGCTCCGATGACAGTTGGCTCTGATCAAGCCAGCTCCCTCCCACCGATTCGTCATTCCTGTGGTTCACCA
  5   1   2       bld BrSp FL   in                     EC2BBA18AC12.g1                                                                                 GGGAGTATCAGGCAGGGCGGCTCAGTGTCAGGCAGGGCGGCTCAGTAACAGGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTAGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCA
  5   1   2       bld HeRe 5g                          EC2CAA32BB06.g1                                                                                    AGTATCAGGCAGGGCGGCTCAGTATCAGGCAGGGCGGCTCAGTAACAGGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCTTTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGACTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGA
  5   1   2   12  bld Gas7 5g3  in                         XZG34143.5p ............................................................................................CAGGGCGGCTCAGTGTCAGGCAGGGCGGCTCAGTAACAGGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTAGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCNAAGTGTATGGAGGCTTCCAGCTTGTGCCAG
  5   1   2       bld 1030 5g                         IMAGE:7091725.5p                                                                                                     GTCAGTATCAGGCAGGGCGGCTCAGTGTCAGGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTGGGGCATCTTGCCNACTGCATGAATCAGATNCATGCCATGAATTATCCTACCCAGCC
  5   1   2       bld Egg  5g                        TEgg121b10.p1kSP6                                                                                                      CGGGGGTCAGGCAGGGCGGCTCAGTAACAGGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTAGGGCATCTTGCCAACTG
  5   1   2       bld 1030 5g                         IMAGE:7094496.5p                                                                                                        AGTATCAGGCAGGGCGGCTCAGTAACAGGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTGGGGCATC
  5   1   2       bld Neu  5g                        TNeu012i05.p1kSP6                                                                                                             CAGGCAGGGCGGCTCAGTAACAGGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACANGATGTCCGGACCCGACTCTTAGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGC
  5   1   2       bld Neu  5g                        TNeu096p09.p1cSP6                                                                                                              AGGCAGGGCGGCTCATTAACAGGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTGCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGAGGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCAC
  5   1   2       bld Neu0 FL                            IMAGE:6995964                                                                                                                    GGCGGCTCAGTGTCAGGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTGGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTTGCCTTTCCTGATCACAAACCCCAGCCTTCCCCTCACAACGGAATCCCGTCATTTCCTG
  5   1   2   32  bld Gas7 5x3  out                        XZG48964.5p ...................................................................................................................GGCGGCTCAGTGCCAGGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATGTAAGTTCTGCGCTACATGTACCACTGGAACAACCTGGGCTACTCAATAATTCCTCTCACTCACTTCTATACATCATTACTGAAGTGCCACCAACCGATCCATTCAGCCAGCTCATGAGATATGTTCAGCTACCCTCTATCTTTCTACAGCAGCCCCTGGCTAGCCTGCCAGTTCTCCCATTCCCATAGGTACCATCTATTGGTGTAGCTTCTGTACCAGTCTATTATCTCCCTATAACATCACCCTGTGCTATAGTTCCATATATTCATTTCTCTGCAGGACCCCCTTAGCTGCTGAACAACCCACTGACTATGGGGGGGGGGGG
  5   1   2   42  bld Tad5 5x                              XZT39600.5p ....................................................................................................................GCGGCTCAGTAACAGGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGGTAAAAGCCGTGGCTAAACTCTCACCCGGGGCGCTTGGATGTTCTTTAGTTTTGCCAGAATATGAGCGCTCACTGTCTCCTTATTTCTTCCAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATGTAAGTTCTGCGCTACATGTACCACTGGAACAACCTGGGCTACTCAATAATTCCTCTCACTCACTTCTATACATCATTACTGAAGTGCCACCAACCGATCCATTCAGCCAGCTCATGAGATATGTTCAGCTACCCTCTATCTTTCTACAGCAGCCCCTGGCTAGCCTGCCAGTTCTCCCATTCCCATAGGTACCATCTATTGGTGTAGCTTCTGTACCAGTCTATTATCTCCCTATAACATCACCCTGTGCTATAGTTCCATATATTCATTTCTCTGCAGGACCCCCTTAGCTGCTGAACACCCACTGACTATGGGGGGGGGGGGGGG
  5   1   2      seed HdA  5g                        THdA033d10.p1kSP6                                                                                                                         CTCAGTAACAGGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTAGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCA
  5   1   2       bld Neu  5g                        TNeu051n19.p1cSP6                                                                                                                          TCAGTAACAGGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTGGGGCATCTTGCCAACTGCAT
  5   1   2       bld TpA  5x3  out                  TTpA060h12.p1kSP6                                                                                                                               TAACGGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTAGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGC
  3  -1   2       bld Gas6                                 ANBT3228.3p                                                                                                                                  CCCTTTGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTAGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAATAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCC
  5   1   2   22  bld Tad5 5g                              XZT46660.5p ...................................................................................................................................GGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTGGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTTCTGATCACAAACCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGT
  5   1   2       bld Gas  5g                        TGas012n15.p1kSP6                                                                                                                                      CAGGGCAGGCAGCCAATGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCC
  5   1   2       bld TpA  5g                        TTpA040n22.p1kSP6                                                                                                                                           CAGGCAGCCAAGTGTTCGCTGCGGGACCCTGTTCACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTAGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCCAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCC
  5   1   2   12  bld Gas7 5g3  in                         XZG28885.5p ...............................................................................................................................................GCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTAGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGGAGCTGCACCCCACCCTGCCTATGGACAGCC
  5   1   2       bld Neu  FL   in                   TNeu075p11.p1cSP6                                                                                                                                                    AATCCCCGGGGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTAGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGA
  5   1   2       bld Ovi1      out                        CABI1561.5p                                                                                                                                                          CGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTGGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCANCACGNATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGT
  5   1   2   10  bld Ovi1 5g3  in                         CABI4175.5p .........................................................................................................................................................CGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCATTGGATTGCCAGTTCCGTTCTTGCATTTATAACTCGGAGTTTTAATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTGGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGC
  5   1   2       bld Gas7 5x3  in                          XZG5832.5p                                                                                                                                                                                                                                                    TATACCTTGGTGTTCAGTTGGTGGTGCCATCTCTGTGAGTGTAGAAGATGCCAGCTGATCTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACTCCGGCCAGCATGAGCAATACCCCGGATAAACCCAAAACAGCCTCTGAGCATAGAAAGGTAAAAGCCGTGGCTAAACTCTCACCCGGGGCGCTTGGATGTTCTTTAGTTTTGCCAGAATATGAGCGCTCACTGTCTCCTTATTTCTTCCAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGA
  5   1   2       bld HeRe      in                     EC2CAA10DG02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                GGAGAAGAGAAGGAGAGCCAGGATTAACGAGAGCCTCGGCCAGCTCAAAACCCTCATCCTGGATGCTCTCAAGAAAGATAGCTCCCGGCACTCTAAGCTGGAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTGGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGATTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTG
  3   1   2       bld Spl1      out                        CABK7497.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGAAGGCCGATATACTGGAGATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTGGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGACTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTTCCTATTTTTTGGAAGTTTTACTTGTATGTAATAAAAACGCACCATTGTATTTTCTCG
  3   1   2       bld TbA                             TTbA023a19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTATTATAAGGCAGTATAATAATGTTCTGTTATCCTCTGTTCTCTCNGTAGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTAGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTTTCCTTCAGTAATGCCATCAGTCACAGCTGATTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTTCCTATTTTTTGGAAGTTTTACTTGTATGTAATAAAAACGCCACATTGTTTTTCTCGAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5                                 XZT40388.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTGGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGACTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTTCCTATTTTTTGGAAGTTTTACTTGTATGTAATAAAAACGGCACATTGTATTTTCTCG
  3   1   2       bld Ovi1 5g3  in                         CABI4175.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGACAGTGAAGCACCTGAGGAACCTGCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTGGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGACTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTTCCTATTTTTTGGAAGTTTTACTTGTATGTAATAAAAACGCCACATTGTATTTTCTCGAATTTC
  3   1   2       bld BrSp FL   in                     EC2BBA18AC12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGGAACCTGCAGCGGGTGCCGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTAGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGATTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTTCCTATTTTTTGGAAGTTTTACTTGTAGT
  3   1   2       bld Gas7 5g3  in                         XZG28885.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTAGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGATTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTTCCTATTTTTTGGAAGTTTTACTTGTATGTAATAAAAACGGCACATTGTATTTTCTCGAATTTGTAAAAAAAAAAAAAAAAGG
  3   1   2       bld HeRe      in                     EC2CAA10DG02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCGGGTGCAGATGACTGCTGCACTGAGCACAGACCTTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTGGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGATTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTTCCTATTTTTTGGAAGTTTTACTTGTAGTAATAAAAAC
  5   1   2       bld Gas6      in                         ANBT1247.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTGGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGACTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTTCCTATTTTTTGGAAGTTTTACTTGTATGTAATAAAAACGCACATTGTATTTTCTCGAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas                            TGas012c13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGCACTGAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTAGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGATTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATAT
  3  -1   2       bld Hrt1      in                         CAAQ4693.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGCACAGACCCTTCAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTGGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGACTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATCATGTCCTTGNCATCATAA
  3   1   2       bld Gas7 5g3  in                         XZG34143.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGTGCTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTAGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGATTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTTCCTATTTTTTGGAAGTTTTACTTGTATGTAATAAAAACGCACATTGTATTTTCTCGAATTTGTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas6      in                         ANBT1247.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAGCTGGATTCAGGGAGTGCATGGATGAAGTAACTCGATTCCTGTCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTGGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGACTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTTCCTATTTTTTGGAAGTTTTACTTGTATGTAATAAAAACGCACATTGTATTTTCTCG
  3   1   2       bld Neu  FL   in                    TNeu075p11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTAACTCGATTCCTGTCAACTCGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTAGGGTATCTTGCCAATTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGATGCACCCCACTCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGATTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTTCCTATTTTTTGGAAGTTTTACTTGTAAGTAGTAAAAACGCACCATTGTATTTTCGTCGAATTTGATAAAAAANAAAAAAAAAAAA
  3   1   2       bld HeRe      in                      EC2CAA9AH09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTGGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGATTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTT
  5   1   2       bld HeRe      in                      EC2CAA9AH09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCTTGGGGCATCTTGCCAACTGCATGAATCAGATCAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGATTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGT
  5   1   2       chi HeRe      in                     EC2CAA45CH03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATCAGGCAGGGCGGCTCAGTATCAGGCAGGGCGGCTCAGTAACAGGCAGGGCAGGCAGCCAAGTGTTCGCTGCGGGACCTTGCCACACTCTCTTCCCTATCGGACGTTCTTGCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGATTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATACTAACCCTCATGTGAT
  5   1   2       bld Hrt1      in                         CAAQ4693.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAATGCCATGAATTATCCTACCCAGCCCCAGATCCCTGCTGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGACTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGGAATCAAAGAATAAGGAGAATTCCGTGTGCACAACGAAAACTCCTTAT
  3   1   2       bld Kid1      in                         CABA5076.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGGTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAAGCCAGCCTTTCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTTTCCTTCAGTAATGCCATCAGTCACAGCTGATTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAAATGTTCT
  5   1   2       bld Kid1      in                         CABA5076.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCAGCTGCACCCCACCCTGCCTATGGACAGCCTTTGGTCCAGCTCCAAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGATTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTTCCTATTTTTTGGAAGTTTTACTTGTATGTAATAAAAACGCACATTGTATTTTCTCGAANAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld HeRe      in                     EC2CAA45CH03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCCAGCTCCCATTGCATGCAAGATGGGTGGTCCACCAGTAGAAGTTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGATTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTTCCTATTTTTGGAAGTTTTACTTGTA
  3   1   2       bld Gas       in                    TGas124e11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGATTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTTCCTATTTTTTGGAAGTTTTACTTGTATGTAATAAAAACGCACATTGTATTTTCTCGAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas       in                   TGas124e11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGTAGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGATTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTTCCTATTTTTTGGAAGTTTTACTTGTATGTAATAAAAACGCACATTGTATTTTCTCG
  3   1   2       bld Gas7 5x3  in                          XZG5832.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCAGCCCCAGATGGACAGTTTGCTTTCCTGATCACAAACCCAGCCTTCCCTCACAACGGATCCGTCATTCCTGTGTACACCAACTCCAATGTGGGCACTGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAGCTGACTCCGTTTGGAGGCCCTGGTAAAGGGAAATGACTTTGGGACTTCTGTTAGCTGGAACTTAGTTACAAATAGTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACCATGGAATGCTC
  5   1   2       bld Neu                            TNeu094e16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTAACCCTCATGTGATAGTGAGAATGCTGATGCACTATATCTGTATATAGGAAATGTTCATATTGAATTATGTCCTTGTATTATAAGATTAATGAGATTTCGTTTTGTACACGAAATAATGCTATTATTATGATGCCAAAGACATGGAATGCTCTTAAATTGTTCTTCCTATTTTTTGGAAGTTTTACTTGTATGTGATAAAAACGCACATTGTATTTTCTCGAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)