Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 50%

 1012074224 Xt7.1-CABG8439.3 - 43 ESTs
                                                                       ......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABG8439.3                                     CGACTTTCAATGAAAAAAAGACTTGCAGCCAACGCATGGAAAACTTTGGACGCTTTCTATGGAATCCAGATACTTCAGAGTTTATGGGAAGAACATTTGCTAAGTGGGTGTACATCAGTCTTTACTATGCTGCATTCTACGTAATTATGATTGGAATCTTTGCACTCTCTATATATTCCCTGATGAAAACTATGAACCCATTTGTACCAGATTATCAGGATGAACTGAAATCGCCAGGTGTGACAATGAGACCGGATCCCTATGGCGATGAAGTTATTGAACTCTTTTATAACAAGGCTGAAAACTCAACATACCTCCCACTTGTAACCAGTCTGTGTGACTTTCTCTCAGTTTACAACAAAACAGTTCAAGAAAAGATGAATGCAAACTGCTCTGACAATACAAGAATGTCTTGTGCTAACCCCAAAGAGAATTCTAAGTCCTGCCAGTTTACTACAGACATGTTGGGGAATTGCTCTTGGGAGCATGATCACACGTTTGGCTATAAATCTGGAACGCCGTGTCTTTTTATAAAGATGAACAGGATAATAAATTTTGTTCCAGGTAACAAGACAGTTCCTCTTGTGAACTGTTCAGCTGAGCACGGAGATCTTGGAGATGTACATTACTATCCAGGCAATGACACTTATGGGACAATTGGCTTTCAGTACTTTCCATATTGTGGAAAGAAAATGCAGCCCAACTACACCAATCCTTTGGTAGCAGTGAAACTGCTTAATCCACCACTAAACAAAGAACTGAGTGTAGTTTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACACGACCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAGATAAACCTGGTTCATCTAGTGCAAATTAAGTCATTCTAAGAATTACCTGGGAATCACAATATCCTACAATAAAACAACAAGCAGTGCTTCTGTCCTTGTTAACCTGAAGAAAACAATGGACCAATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTTAAAACTGGAAAAAA
                                                  Xt7.1-CHK-1008226404                                           TCAATGAAAAAAAGACTTGCAGCCAACGCATGGAAAACTTTGGACGCTTTCTATGGAATCCAGATACTTCAGAGTTTATGGGAAGAACATTTGCTAAGTGGGTGTACATCAGTCTTTACTATGCTGCATTCTACGTAATTATGATTGGAATCTTTGCACTCTCTATATATTCCCTGATGAAAACTATGAACCCATTTGTACCAGATTATCAGGATGAACTGAAATCGCCAGGTGTGACAATGAGACCGGATCCCTATGGCGATGAAGTTATTGAACTCTTTTATAACAAGGCTGAAAACTCAACATACCTCCCACTTGTAACCAGTCTGTGTGACTTTCTCTCAGTTTACAACAAAACAGTTCAAGAAAAGATGAATGCAAACTGCTCTGACAATACAAGAATGTCTTGTGCTAACCCCAAAGAGAATTCTAAGTCCTGCCAGTTTACTACAGACATGTTGGGGAATTGCTCTTGGGAGCATGATCACACGTTTGGCTATAAATCTGGAACGCCGTGTCTTTTTATAAAGATGAACAGGATAATAAATTTTGTTCCAGGTAACAAGACAGTTCCTCTTGTGAACTGTTCAGCTGAGCACGGAGATCTTGGAGATGTACATTACTATCCAGGCAATGACACTTATGGGACAATTGGCTTTCAGTACTTTCCATATTGTGGAAAGAAAATGCAGCCCAACTACACCAATCCTTTGGTAGCAGTGAAACTGCTTAATCCACCACTAAACAAAGAACTGAGTGTAGTTTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACACGACCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAGATAAACCTGGTTCATCTAGTGCAAATTAAGTCATTCTAAGAATTACCTGGGAATCACAATATCCTACAATAAAACAACAAGCAGTGCTTCTGTCCTTGTTAACCTGAAGAAAACAATGGACCAATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTTAAAACTGGAAAAAAAAAAAA
                                                      consensus depths                                          2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     5     4     5     5     7     6     7     6     7     6     7     6     7     7     8     7     8     7     8     8     9     9    10     9    10     9    10    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    12    10    12    10    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    10    12    10    12    10    12    11    14    11    14    11    15    11    15    11    15    11    15    11    16    10    15    10    15    10    15    10    15    10    15    10    15    10    15    10    15    10    15    10    15    10    15    11    19    10    19    11    21    14    25    14    25    16    26    16    27    25    27    25    27    25    27    25    28    24    28    24    28    24    28    24    28    24    27    24    27    26    29    25    28    22    25    24    27    24    27    25    28    27    30    26    29    26    29    26    29    26    29    26    29    25    28    25    28    25    28    26    28    24    28    24    28    24    28    24    28    24    28    24    28    24    27    24    27    24    27    24    27    26    29    26    29    28    31    28    31    28    31    28    31    28    31    29    31    29    31    29    31    28    30    28    30    25    29    25    28    25    28    25    28    24    26    24    26    24    26    24    26    24    26    24    26    24    26    24    26    24    26    24    26    24    26    21    26     7    12
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------A--
                                               BLH ATG      -4      80                                     
                                                                                        PREDICTED - Sp ---- 4e-018     XP_779915.1 PREDICTED: similar to CG8663-PA, isoform A isoform 1 [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                  PROTEIN --- Dm ---- 3e-022     NP_477167.1 Nervana 1 CG9258-PA [Drosophila melanogaster] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                            PROTEIN --- Ce ---- 2e-022     NP_510300.1 nervous system antigen like (35.7 kD) (XO384) [Caenorhabditis elegans] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                               PROTEIN --- Dr ---- 1e-050     NP_571913.1 ATPase, Na+/K+ transporting, beta 2b polypeptide [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                       PROTEIN --- Mm ==== 4e-082     NP_033854.1 ATPase, H+/K+ transporting, beta polypeptide, gastric specific; H+,K+-ATPase[Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                       PREDICTED - Hs ==== 7e-085     XP_001133764.1 PREDICTED: similar to Potassium-transporting ATPase subunit beta (Proton pump beta chain) (Gastric H(+)/K(+) ATPase beta subunit) [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                       PROTEIN === Gg ==== 4e-094     NP_989749.1 H+ K+ ATPase beta subunit [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                       PROTEIN === Xl ==== 8e-166     AAH78532.1 MGC85366 protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                       PROTEIN === ?? ==== 8e-166     NP_001087304.1 MGC85366 protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                       PROTEIN === Xt ==== 8e-179     AAH75354.1 ATPase, H+/K+ exchanging, beta polypeptide [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABG8439.3                                 ATG------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------ATG---------------------------------ATG------ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------TGA------------------------------------ATGTAA---------------------------ATG------------------TGA------------------TGAATG---------------------TAA------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATGATG---TGA---------------------TAA------------------------------------------------------------------TGA------------------------------------ATG---------------TGA---------TAATAA------------------------TAA---------------------------TGA---------ATG---TAG---------------------TGATAA---------------------------------------ATGTAA---------------------------------ATG------------------------------TAG------------------------------------------------------------TGA---------------------------------------------TAA
                                                                   ORF                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       bld AbdN FL                            IMAGE:7005547 TGTAAAAAGGGTTCTAACTNTGCTGGAGAGAAATGGCGACTTTCAATGAAAAAAAGACTTGCAGCCAACGCATGGAAAACTTTGGACGCTTTCTATGGAATCCAGATACTTCAGAGTTTATGGGAAGAACATTTGCTAAGTGGGTGTACATCAGTCTTTACTATGCTGCATTCTACGTAATTATGATTGGAATCTTTGCACTCTCTATATATTCCCTGATGAAAACTATGAACCCATTTGTACCAGATTATCAGGATGAACTGAAATCGCCAGGTGTGACAATGAGACCGGATCCCTATGGCGATGAAGTTATTGAACTCTTTTATAACAAGGCTGAAAACTCAACATACCTCCCACTTGTAACCAGTCTGTGTGACTTTCTCTCAGTTTACAACAAAACAGTTCAAGAAAAGATGAATGCAAACTGCTCTGACAATACAAGAATGTCTTGTGCTAACCCCAAAGAGAATTCTAAGTCCTGCCAGTTTACTACAGACATGTTGGGGAATTGCTCTTGGGAGCATGATCACACGTTTGGCTATAAATCTGGAACGCCGTGTCTTTTTATAAAGATGAACAGGATAATAAATTTTGTTCCAGGTAACAAGACAGTTCCTCTTGTGAACTGTTCAGCTGAGCACGGAGATCTTGGAGATGTACATTACTATCCAGGCAATGACACTTATGGGACAATTGGCTTTCAGTACTTTCCATATTGTGGGAAAGAAATGCAGCCCCACTACCACAAATCCTTTTGGTAGCAGTGAAACTGCCTTATCCCACCACTAAACAAAGAAACTGATTGGTATTTTGTAAAAGTTTCTGGAACTTGGCATTCCCTTCGGAACAACCCCCAAGAACCCCTTTTGAAG
  5   1   2       bld Sto1      in                        CABG10124.5p                                     CGACTTTCAATGAAAAAAAGACTTGCAGCCAACGCATGGAAAACTTTGGACGCTTTCTATGGAATCCAGATACTTCAGAGTTTATGGGAAGAACATTTGCTAAGTGGGTGTACATCAGTCTTTACTATGCTGCATTCTACGTAATTATGATTGGAATCTTTGCACTCTCTATATATTCCCTGATGAAAACTATGAACCCATTTGTACCAGATTATCAGGATGAACTGAAATCGCCAGGTGTGACAATGAGACCGGATCCCTATGGCGATGAAGTTATTGAACTCTTTTATAACAAGGCTGAAAACTCAACATACCTCCCACTTGTAACCAGTCTGTGTGACTTTCTCTCAGTTTACAACAAAACAGTTCAAGAAAAGATGAATGCAAACTGCTCTGACAATACAAGAATGTCTTGTGCTAACCCCAAAGAGAATTCTAAGTCCTGCCAGTTTACTACAGACATGTTGGGGAATTGCTCTTGGGAGCATGATCACACGTTTGGCTATAAATCTGGAACGCCGTGTCTTTTTATAAAGATGAACAGGATAATAAATTTTGTTCCAGGTAACAAGACAGTTCCTCTTGTGAACTGTTCAGCTGAGCACGGAGATCTTGGAGATGTACATTACTATCCAGGCAATGACACTTATGGGACAATTGGCTTTCAGTACTTTCCATATTGTGGAAAGAAAATGCAGCCCAACTACACCAATCCTTTGGTAGCAGTGAAACTGCTTAATCCACCACTAAACAAAGAACTGAGTGTAGTTTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACACGACCCCTATGA
  5   1   2       bld Sto1      in                         CABG8439.5p                                                                                                                                                                                                   TTTGCACTCTCTATATATTCCCTGATGAAAACTATGAACCCATTTGTACCAGATTATCAGGATGAACTGAAATCGCCAGGTGTGACAATGAGACCGGATCCCTATGGCGATGAAGTTATTGAACTCTTTTATAACAAGGCTGAAAACTCAACATACCTCCCACTTGTAACCAGTCTGTGTGACTTTCTCTCAGTTTACAACAAAACAGTTCAAGAAAAGATGAATGCAAACTGCTCTGACAATACAAGAATGTCTTGTGCTAACCCCAAAGAGAATTCTAAGTCCTGCCAGTTTACTACAGACATGTTGGGGAATTGCTCTTGGGAGCATGATCACACGTTTGGCTATAAATCTGGAACGCCGTGTCTTTTTATAAAGATGAACAGGATAATAAATTTTGTTCCAGGTAACAAGACAGTTCCTCTTGTGAACTGTTCAGCTGAGCACGGAGATCTTGGAGATGTACATTACTATCCAGGCAATGACACTTATGGGACAATTGGCTTTCAGTACTTTCCATATTGTGGAAAGAAAATGCAGCCCAACTACACCAATCCTTTGGTAGCAGTGAAACTGCTTAATCCACCACTAAACAAAGAACTGAGTGTAGTTTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACACGACCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAGATAAACCTGGTTCATCTAGTGCAAATTAAGTCATTCTAAGAATTACCTGGGAATCACAATATCCTACAATAAAACAACAAGCAGTGCTTCTGTCCTTGTTAACCTGAAGAAACAATGGACCAATCATTTCACATCGTTTTCCATGTAACAGTCTCAG
  5   1   2       bld AbdN                               IMAGE:7021133                                                                                                                                                                                                                                                                                            GAGACCGGATCCCTATGGCGATGAAGTTATTGAACTCTTTTATAACAAGGCTGAAAACTCAACATACCTCCCACTTGTAACCAGTCTGTGTGACTTTCTCTCAGTTTACAACAAAACAGTTCAAGAAAAGATGAATGCAAACTGCTCTGACAATACAAGAATGTCTTGTGCTAACCCCAAAGAGAATTCTAAGTCCTGCCAGTTTACTACAGACATGTTGGGGAATTGCTCTTGGGAGCATGATCACACGTTTGGCTATAAATCTGGAACGCCGTGTCTTTTTATAAAGATGAACAGGATAATAAATTTTGTTCCAGGTAACAAGACAGTTCCTCTTGTGAACTGTTCAGCTGAGCACGGAGATCTTGGAGATGTACATTACTATCCAGGCAATGACACTTATGGGACAATTGGCTTTCAGTACTTTCCATATTGTGGAAAGAAAATGCAGCCCAACTACACCAATCCTTTGGTAGCAGTGAAACTGCTTAATCCACCACTAAACAAAGAACTGAGTGTAGTTTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACACGACCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAGATAAACCTGGTTCATCTAGTGCAAATTAAGTCATTCTAAGAATTACCTGGGAATCACAATATCCTACAATANAACAACAAGCAGTGCTTCTGTCCTTGTTAACCTGAAGAAAACAATGGACCAATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAAATGTCAGATCTCAAATACTTTAAGGTAAAAGTAATGTCCAATATTAAAATGGTATA
  3  -1   2       bld Sto1      in                         CABG3674.3p                                                                                                                                                                                                                                                                                                                                     TATAACAAGGCTGAAAACTCAACATACCTCCCACTTGTACCAGTCTGTGTGACTTTCTCTCAGTTTACAACAAAACAGTTCAAGAAAAGATGAATGCAAACTGCTCTGACAATACAAGAATGTCTTGTGCTAACCCCAAAGAGAATTCTAAGTCCTGCCAGTTTACTACAGACATGTTGGGGAATTGCTCTTGGGAGCATGATCACACGTTTGGCTATAAATCTGGAACGCCGTGTCTTTTTATAAAGATGAACAGGATAATAAATTTTGTTCCAGGTAACAAGACAGTTCCTCTTGTGAACTGTTCAGCTGAGCACGGAGATCTTGGAGATGTACATTACTATCCAGGCAATGACACTTATGGGACAATTGGCTTTCAGTACTTTCCATATTGTGGAAAGAAAATGCAGCCCAACTACACCAATCCTTTGGTAGCAGTGAAACTGCTTAATCCACCACTAAACAAAGAACTGAGTGTAGTTTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACACGACCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAGATAAACCTGGTTCATCTAGTGCAAATTAAGTCATTCTAAGAATTACCTGGGAATCACAATATCCTACAATAAAACAACAAGCAGTGCTTCTGTCCTTGTTAACCTGAAGAAAACAATGGACCAATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCCAAATGTTAAT
  5   1   2       bld Sto1      in                        CABG10106.5p                                                                                                                                                                                                                                                                                                                                                    ACTCAACATACCTCCCACTTGTAACCAGTCTGTGTGACTTTCTCTCAGTTTACAACAAAACAGTTCAAGAAAAGATGAATGCAAACTGCTCTGACAATACAAGAATGTCTTGTGCTAACCCCAAAGAGAATTCTAAGTCCTGCCAGTTTACTACAGACATGTTGGGGAATTGCTCTTGGGAGCATGATCACACGTTTGGCTATAAATCTGGAACGCCGTGTCTTTTTATAAAGATGAACAGGATAATAAATTTTGTTCCAGGTAACAAGACAGTTCCTCTTGTGAACTGTTCAGCTGAGCACGGAGATCTTGGAGATGTACATTACTATCCAGGCAATGACACTTATGGGACAATTGGCTTTCAGTACTTTCCATATTGTGGAAAGAAAATGCAGCCCAACTACACCAATCCTTTGGTAGCAGTGAAACTGCTTAATCCACCACTAAACAAAGAACTGAGTGTAGTTTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACACGACCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAGATAAACCTGGTTCATCTAGTGCAAATTAAGTCATTCTAAGAATTACCTGGGAATCACAATATCCTACAATAAAACAACAAGCAGTGCTTCTGTCCTTGTTAACCTGAAGAAAACAATGGACCAATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCANATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTA
  5   1   2       bld Sto1      in                         CABG1878.5p                                                                                                                                                                                                                                                                                                                                                    CCGAGGAACATACCTCCCACTTGTAACCAGTCTGTGTGACTTTCTCTCAGTTTACAACAAAACAGTTCAAGAAAAGATGAACGCAAACTGCTCTGACAATACAAGAATGTCTTGTGCTAACCCCAAAGAGAATTCTAAGTCCTGCCAGTTTACTACAGACATGCTGGGGAATTGCTCTTGGGAGCATGATCACACGTTTGGCTATAAATCTGGAACGCCGTGTCTTTTTATAAAGATGAACAGGATAATAAATTTTGTTCCAGGTAACAAGACAGTTCCTCTTGTGAACTGTTCAGCTGAGCACGGAGATCTTGGAGATGTACATTACTATCCAGGCAATGACACTTATGGGACAATTGGCTTTCAGTACTTTCCATATTGTGGAAAGAAAATGCAGCCCAACTACACCAATCCTTTGGTAGCAGTGAAACTGCTTAATCCACCACTAAACAAAGAACTGAGTGTAGTTTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACACGACCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAGATAAACCTGGTTCATCTAGTGCAAATTAAGTCATTCTAAGAATTACCTGGGAATCACAATATCCTACAATAAAACAACAAGCAGTGCTTCTGTCCTTGTTAACCTGAAGAAAACAATGGACCAATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCANATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCCAATGTTAAT
  3  -1   2       bld Sto1      in                         CABG6668.3p                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAGATGAATGCAAACTGCTCTGACAATACAAGAATGTCTTGTGCTAACCCCAAAGAGAATTCTAAGTCCTGCCAGTTTACTACAGACATGTTGGGGAATTGCTCTTGGGAGCATGATCACACGTTTGGCTATAAATCTGGAACGCCGTGTCTTTTTATAAAGATGAACAGGATAATAAATTTTGTTCCAGGTAACAAGACAGTTCCTCTTGTGAACTGTTCAGCTGAGCACGGAGATCTTGGAGATGTACATTACTATCCAGGCAATGACACTTATGGGACAATTGGCTTTCAGTACTTTCCATATTGTGGAAAGAAAATGCAGCCCAACTACACCAATCCTTTGGTAGCAGTGAAACTGCTTAATCCACCACTAAACAAAGAACTGAGTGTAGTTTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACACGACCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAGATAAACCTGGTTCATCTAGTGCAAATTAAGTCATTCTAAGAATTACCTGGGAATCACAATATCCTACAATAAAACAACAAGCAGTGCTTCTGTCCTTGTTAACCTGAAGAAAACAATGGACCAATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGT
  5   1   2       bld Sto1      in                         CABG1338.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAGAATGTCTTGTGCTAACCCCAAAGAGAATTCTAAGTCCTGCCAGTTTACTACAGACATGTTGGGGAATTGCTCTTGGGAGCATGATCACACGTTTGGCTATAAATCTGGAACGCCGTGTCTTTTTATAAAGATGAACAGGATAATAAATTTTGTTCCAGGTAACAAGACAGTTCCTCTTGTGAACTGTTCAGCTGAGCACGGAGATCTTGGAGATGTACATTACTATCCAGGCAATGACACTTATGGGACAATTGGCTTTCAGTACTTTCCATATTGTGGAAAGAAAATGCAGCCCAACTACACCAATCCTTTGGTAGCAGTGAAACTGTTTAATCCACCACTAAACAAAGAACTGAGTGTAGTTTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACACGACCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAGATAAACCTGGTTCATCTAGTGCAAATTAAGTCATTCTAAGAATTACCTGGGAATCACAATATCCTACAATAAAACAACAAGCAGTGCTTCTGTCCTTGTTAACCTGAAGAAAACAATGGACCAATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATAC
  5   1   2       bld Sto1      ?                          CABG7083.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTGTGCTAACCCCAAAGAGAATTCTAAGTCCTGCCAGTTTACTACAGACATGTTGGGGAATTGCTCTTGGGAGCATGATCACACGTTTGGCTATAAATCTGGAACGCCGTGTCTTTTTATAAAGATGAACAGGATAATAAATTTTGTTCCAGGTAACAAGACAGTTCCTCTTGTGAACTGTTCAGCTGAGCACGGAGATCTTGGAGATGTACATTACTATCCAGGCAATGACACTTATGGGACAATTGGCTTTCAGTACTTTCCATATTGTGGAAAGAAAATGCAGCCCAACTACACCAATCCTTTGGTAGCAGTGAAACTGCTTAATCCACCACTAAACAAAGAACTGAGTGTAGTTTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACACGACCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAGATAAACCTGGTTCATCTAGTGCAAATTAAGTCATTCTAAGAATTACCTGGGAATCACAATATCCTACAATAAAACAACAAGCAGTGCTTCTGTCCTTGTTAACCTGAAGAAAACAATGGACCAATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTG
  5   1   2       bld Sto1      in                         CABG1461.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGACATGTTGGGGAATTGCTCTTGGGAGCATGATCACACGTTTGGCTATAAATCTGGAACGCCGTGTCTTTTTATAAAGATGAACAGGATAATAAATTTTGTTCCAGGTAACAAGACAGTTCCTCTTGTGAACTGTTCAGCTGAGCACGGAGATCTTGGAGATGTACATTACTATCCAGGCAATGACACTTATGGGACAATTGGCTTTCAGTACTTTCCATATTGTGGAAAGAAAATGCAGCCCAACTACACCAATCCTTTGGTAGCAGTGAAACTGCTTAATCCACCACTAAACAAAGAACTGAGTGTAGTTTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACACGACCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAGATAAACCTGGTTCATCTAGTGCAAATTAAGTCATTCTAAGAATTACCTGGGAATCACAATATCCTACAATAAAACAACAAGCAGTGCTTCTGTCCTTGTTAACCTGAAGAAAACAATGGACCAATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAANAGTAGATATACGGAAACCTTTTACACAAGC
  5   1   2       bld AbdN                               IMAGE:7023183                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCTTGTGAACTGTTCATGCTGAAGCACGGAGAATCTTGGAGATGTACATTACTATCCAGGCAATGACACTTATGGGACAATTGGCTTTCAGTACTTTCCATATTGTGGAAAGAAAATGCATCCCAACTACACCAATCCTTTGGTAGCAGTGAAACTGCTTAATCCACCACTAAACAAAGAACTGAGTGTAGTTTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACACGACCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAGATAAACCTGGTTCATCTAGTGCAAATTAAGTCATTCTAAGAATTACCTGGGAATCACAATATCCTACAATAAAACAACAAGCAGTGCTTCTGTCCTTGTTAACCTGAAGAAAACAATGGACCAATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAAATTCTTTTTTTTTTTTATTTTCATGTTACTATACCCACCACTATAGCAATAATTTCCCTTAAGAAACTGGATTTAATATTAATATACCCAGGGGGGT
  5   1   2       bld Sto1      in                         CABG9506.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGTGAAACTGCTTAATCCACCACTAAACAAAGAACTGAGTGTAGTTTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACACGACCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAGATAAACCTGGTTCATCTAGTGCAAATTAAGTCATTCTAAGAATTACCTGGGAATCACAATATCCTACAATAAAACAACAAGCAGTGCTTCTGTCCTTGTTAACCTGAAGAAAACAATGGACCAATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACA
  5   1   2       bld Sto1      in                        CABG10716.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGGGCTTAATCCACCACTAAACAAAGAACTGAGTGTAGTTTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACACGACCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAGATAAACCTGGTTCATCTAGTGCAAATTAAGTCATTCTAAGAATTACCTGGGAATCACAATATCCTACAATAAAACAACAAGCAGTGCTTCTGTCCTTGTTAACCTGAAGAAAACAATGGACCAATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTA
  3  -1   2       bld Sto1      in                         CABG7495.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGAACTGAGTGTAGTTTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACACGACCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAGATAAACCTGGTTCATCTAGTGCAAATTAAGTCATTCTAAGAATTACCTGGGAATCACAATATCCTACAATAAAACAACAAGCAGTGCTTCTGTCCTTGTTAACCTGAAGAAAACAATGGACCAATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGGT
  5   1   2       bld Sto1      in                         CABG6823.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACAACCCACACGACCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAGATAAACCTGGTTCATCTAGTGCAAATTAAGTCATTCTAAGAATTACCTGGGAATCACAATATCCTACAATAAAACAACAAGCAGTGCTTCTGTCCTTGTTAACCTGAAGAAAACAATGGACCAATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGAT
  5   1   2       bld Sto1      in                          CABG660.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAGATAAACCTGGTTCATCTAGTGCAAATTAAGTCATTCTAAGAATTACCTGGGAATCACAATATCCTACAATAAAACAACAAGCAGTGCTTCTGTCCTTGTTAACCTGAAGAAAACAATGGACCAATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAANAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGA
  5  -1   2       bld Sto1      in                         CABG3674.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCTTGTTTAACCTGAAGAAAACAATGGACCATCATTTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATATGTTTTTCACTTGCAAGCACTGATATATTATTATTNTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTAAAACTGAAAAAAAACCTCGTGCCGAATTGAATCG
  3   1   2       bld Sto1      in                         CABG8439.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCCTTGTTAACCTGAAGAAAACAATGGACCAATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTAAAACGGAAAAAAAAAAAAA
  3   1   2       bld Sto1      in                        CABG10716.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCCTTGTTAACCTGAAGAAAACAATGACCAATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACCAGTTTTAAAACTGG
  3   1   2       bld Sto1      in                         CABG6823.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCCTTGTTACCCTGAGAAAAACAATGGACCAATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACCAGTTTTAAAACTGGAAAAAA
  3   1   2       bld Sto1      in                        CABG10124.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATGGACCAATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATATGTTTTTCACTTGCAAGCACTGATATATTATTATTNTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTAAAACGAAAAAAAGCCTCT
  3   1   2       bld Sto1      in                          CABG660.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAATGACCAATCATTTCACATCGTTTCCCATGTANCAGTCTCAGATAGGGAGCAACCAGAATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTTAAAACTGGAAAAAAAAAAAAAAAG
  3   1   2       bld Sto1      in                         CABG1461.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCATTTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGNGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTTAAAACTGGT
  5  -1   2       bld Sto1      in                         CABG6668.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTTAAAACTG
  3   1   2       bld Sto1      in                         CABG9506.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTTAAAACTGAAAA
  3   1   2       bld Sto1      in                         CABG1878.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCATTTCACATCGTTTTCCATGTAACAGTCTCAGATAGGGAGCAACCAGAATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGNGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTAAAACGG
  3   1   2       bld Sto1      in                        CABG10106.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGTAACAGTCTCAGATAGGGAGCAACCAGAATATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTTAAAACGG
  3   1   2       bld Sto1      in                         CABG1338.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TANCAGTCTCAGATAGGGAGCACCCAGAATATGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTAAAACGGAAAAAAAAAAGCCTCT
  5   1   2      seed Sto1                                 CABG9460.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAATTCGGCACGAGGGTTTTTCACTTGCAAGCACTGATATATTATTATTTTGACATGAATGTCAGATCTCAAATACTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTTAAAACTG
  5  -1   2       bld Sto1      in                         CABG7495.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTGGACATGAATGTCAGATCTCCAAATATTTAAGGTAAAGTAATGTCATATTAAAATGTATAAATATATGCAATACTCTCTTTTTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTGTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGCGCATCTGTTAAATAAACAGTTTTAAAACTGG
  3  -1   2       bld Sto1      in                         CABG1597.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTTAAAACTGGAAAAAAAAAAAAAAAAA
  5  -1   2       bld Sto1      in                         CABG1597.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTGGTTGGGTTATGTTCTATACTTCCAATGTTTAATGGAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTTAAACGG
  3   1   2       bld Sto1      in                         CABG4445.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTAAAACGGAAAAAA
  5   1   2       bld Sto1      in                         CABG4445.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGTTCTAAACTGCTGCGGCCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTTAAAACTGGAAAAAA
  3   1   2       bld Sto1      in                         CABG4566.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACCAGTTTTAAAACTGG
  5   1   2       bld Sto1      in                         CABG4566.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTTTGTGTAAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTGATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTTAAAACTGGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Sto1      in                         CABG5513.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTTATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTTAAAACTGG
  5   1   2       bld Sto1      in                         CABG5513.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAAGTAGATATACGGAAACCTTTTACACAAGCTCCCCTAAAAACTTAAATGGTAACAAAGACAGGGCAGATATGATGCGTTTATACTTTATAGGCTTCTTTAATTAAACAATTCTTTTTTTTTTTATTTCATGTTACTATACCAACCACTATAGCAATATTTCCCTTAGGAACTGATTTAATATTATATACCATGGGGTTAATTCTCTAAACATGTGTATATGTTTTTTCTGATATAACCTATAATAACCAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTTAAAACTGGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Sto1      in                         CABG3695.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTAAAACGAAAAAAA
  5   1   2       bld Sto1      in                         CABG3695.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAAACTTTATTTTACTTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTTAAAACTGAAAAAAA
  3   1   2       bld Sto1      in                         CABG7988.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTTAAACTGG
  5   1   2       bld Sto1      in                         CABG7988.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTGTCTTAATGCACTTGGCCATTCAGAGATAATTGCTGATTGGTTGCTATGGCATAGATTCCTAAATTGTATATATTTTGATAAGCACAACACTTGTCAGATAAATACAAGCCCTTCGTCTCCATGTAAAAAAGGGGTAAACAAAGGATCAAAATATTGGACATGTATTTGAAGGATGAAGAAGGTTGTAAGATCTAGAGACATTTTTATTGTCGACATTTTGATTCAGCAACGAAGTGTAAAGGGTCTTGTGGAAACTGAACTGACACTGTATATGAAAATGCATTTTGCTGTGCATCTGTTAAATAAACAGTTTTAAAACTGGAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)