Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAO7874.5.5                         23 END     14         22       66                LOC548647 protein [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 686.0    0Xt7.1-TGas140d23.3.5                      117 PI      76        103     1371                LOC548647 protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012074234 Xt7.1-CABK5766.3 - 62 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABK5766.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCAAAAAGGTCTGAAGAATATGCTTGATGAAAATAGAGACCCAGAACTGACTCTAATGTATCAACTCTTTAGTCGGGTCAAAGGTGGTCAGATAATACTACTGCAGCACTGGGGTGAATACATTAAAAACTTTGGAAGTGGATTAGTTATTAATCCCGAAAAAGACAAAGACATGGTTCAGGAGCTCCTGGATTTCAAGGATAACGTAGACCACATAATAGACGTTTGCTTCCAGAAGAATGAGAAGTTTGTCAACACTATGAAAGAATCATTTGAAACTTTTATCAACAGAAGAGCAAACAAGCCAGCAGAACTCATAGCCAAATATGTGGATTCCAAGTTACGTTCTGGAAACAAAGAAGCAACAGATGAAGAACTGGAGAGACTTCTGGATAAAATAATGATTATATTTCGATTCATTCATGGCAAAGATGTTTTTGAAGCATTTTACAAAAAAGATCTGGCTAAAAGACTGCTGGTTGGGAAAAGTGCCTCTGTTGATTCTGAGAAGTCAATGCTATCAAAACTTAAACATGAATGTGGTGCTGCATTTACCAGTAAGCTAGAAGGGATGTTTAAAGATATGGAACTCTCCAAAGATGTAATGGTTCAGTTCAAGCAGCATATGCAAAACCACAGTGACCCAGGTAACATAGACTTGACCGTGAATATACTGACAATGGGATACTGGCCAACCTATACACCAGTGGATGTCCATTTACCAGCAGAGATGGTGAAACTTCAGGAAATATTTAAAACATTTTATTTAGGAAAACATAGTGGCAGAAGACTACAGTGGCAGTCAACACTTGGGCATGCAGTTCTGAAAGCAGATTTTAAAGAAGAGAAAAAAGAACTGCAAGTGTCTCTCTTTCAGACCTTGGTGCTTCTCTTGTTTAATAAGGGAGATGAATTTGGCTTTGAAGAAATTAAAATAACAACTGGAATTGAGGATAATGAACTGAGACGAACGCTGCAGTCCCTTGCATGTGGTAAAGCCAGAGTTTTAAATAAATCACCAAAGAGCAAAGATGTGGAGGATGGAGACAGGTTTTGCTTTAATGCCGACTTCAAGCACAAACTATACAGAATTAAAATCAACCAAATACAAATGAAAGAAACTGTAGAAGAACAAGTGAATACAACAGAAAGGGTGTTCCAAGACCGGCAGTATCAGATTGATGCAGCTATTGTGCGCATAATGAAGATGAGAAAGACCCTTACTCATAATCTTTTGGTCTCTGAGCTTTACAATCAATTGAAATTCCCTGTAAAGCCAGGAGACTTGAAGAAAAGGATTGAATCCCTTATAGACAGAGACTATATGGAAAGAGATAAAGACAATGCAAAACAGTACCATTATCTGGCATGAACAAAAAACCTGGACTTTATCAGAGAACAAATCTGCACCAGTCGCAATAAAGAACCAGTGCATCATTTCTCTCTAGCGTTCCTGCTCTGAGTGACAAGACAATATCTTAATGCCCCATCCCCAATGCACCTTAGAAAATTTGAATTAGTTTTCTGTATCATGTATTCTTGTTTGTGTGGCTGCTTAAAATTGTTGCTAGTTTAATGGCACAAATACATTGCATTTTGTTTTGTTTTTCCTTTTTTTTGTTCTAGCATACTATCTCACACCATAACACCTCAATGCTGCAATATTTATTAGTAGCTATGAGGATTACAATCAGGAGACTAATGTTATTGTGGTTATGTCAGGAAATAAACCAGCTCCAAAACAAAACATTTTCTTTCTATTTAGCTGCATGACCGATTGAGCTAGATCTTCTTAGCAGCAATCTACTTATAATGAAAAGGAATTTTCTCAGCCAAACTGATTTCTTCGTTATGCCTTTAACTCTCCAGAATTTGAGTTTGTGCGGGGGTGCATCTAGTGCAATATACACAAAAGGAACCCATTCCCTTCAGCAGGGGAGCAATGTGTTGTGTTCTCAATACGTTACCAAAGTCTGTTCCCTATGTGCCTAACTTAGGGGACATTTTCGTACACAGACAGAAAACTGCTTCCTAGTCAGTCAACCAGTCATTTCTTCATCCAAACACACACCAGCTTCTGGTTATTCAAAGACACACCCGTCCACAAAGAGATCTGTATGCACTTGACTACATCCATACCTAAGTTACCTATTCAGTAATACACATTATCCACCAACATGCCTATCCAACTGTGTGCACACCCACCATCCATATTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAGCCATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCTATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAATGAATTCGCTTGTTTACAGTAAACAATGTAAGCTATGGGCATTTGCTTTTGCTAATAAAATATTTAAAGCAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008224852                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGGTCTGAAGAATATGCTTGATGAAAATAGAGACCCAGAACTGACTCTAATGTATCAACTCTTTAGTCGGGTCAAAGGTGGTCAGATAATACTACTGCAGCACTGGGGTGAATACATTAAAAACTTTGGAAGTGGATTAGTTATTAATCCCGAAAAAGACAAAGACATGGTTCAGGAGCTCCTGGATTTCAAGGATAACGTAGACCACATAATAGACGTTTGCTTCCAGAAGAATGAGAAGTTTGTCAACACTATGAAAGAATCATTTGAAACTTTTATCAACAGAAGAGCAAACAAGCCAGCAGAACTCATAGCCAAATATGTGGATTCCAAGTTACGTTCTGGAAACAAAGAAGCAACAGATGAAGAACTGGAGAGACTTCTGGATAAAATAATGATTATATTTCGATTCATTCATGGCAAAGATGTTTTTGAAGCATTTTACAAAAAAGATCTGGCTAAAAGACTGCTGGTTGGGAAAAGTGCCTCTGTTGATTCTGAGAAGTCAATGCTATCAAAACTTAAACATGAATGTGGTGCTGCATTTACCAGTAAGCTAGAAGGGATGTTTAAAGATATGGAACTCTCCAAAGATGTAATGGTTCAGTTCAAGCAGCATATGCAAAACCACAGTGACCCAGGTAACATAGACTTGACCGTGAATATACTGACAATGGGATACTGGCCAACCTATACACCAGTGGATGTCCATTTACCAGCAGAGATGGTGAAACTTCAGGAAATATTTAAAACATTTTATTTAGGAAAACATAGTGGCAGAAGACTACAGTGGCAGTCAACACTTGGGCATGCAGTTCTGAAAGCAGATTTTAAAGAAGAGAAAAAAGAACTGCAAGTGTCTCTCTTTCAGACCTTGGTGCTTCTCTTGTTTAATAAGGGAGATGAATTTGGCTTTGAAGAAATTAAAATAACAACTGGAATTGAGGATAATGAACTGAGACGAACGCTGCAGTCCCTTGCATGTGGTAAAGCCAGAGTTTTAAATAAATCACCAAAGAGCAAAGATGTGGAGGATGGAGACAGGTTTTGCTTTAATGCCGACTTCAAGCACAAACTATACAGAATTAAAATCAACCAAATACAAATGAAAGAAACTGTAGAAGAACAAGTGAATACAACAGAAAGGGTGTTCCAAGACCGGCAGTATCAGATTGATGCAGCTATTGTGCGCATAATGAAGATGAGAAAGACCCTTACTCATAATCTTTTGGTCTCTGAGCTTTACAATCAATTGAAATTCCCTGTAAAGCCAGGAGACTTGAAGAAAAGGATTGAATCCCTTATAGACAGAGACTATATGGAAAGAGATAAAGACAATGCAAAACAGTACCATTATCTGGCATGAACAAAAAACCTGGACTTTATCAGAGAACAAATCTGCACCAGTCGCAATAAAGAACCAGTGCATCATTTCTCTCTAGCGTTCCTGCTCTGAGTGACAAGACAATATCTTAATGCCCCATCCCCAATGCACCTTAGAAAATTTGAATTAGTTTTCTGTATCATGTATTCTTGTTTGTGTGGCTGCTTAAAATTGTTGCTAGTTTAATGGCACAAATACATTGCATTTTGTTTTGTTTTTCCTTTTTTTTGTTCTAGCATACTATCTCACACCATAACACCTCAATGCTGCAATATTTATTAGTAGCTATGAGGATTACAATCAGGAGACTAATGTTATTGTGGTTATGTCAGGAAATAAACCAGCTCCAAAACAAAACATTTTCTTTCTATTTAGCTGCATGACCGATTGAGCTAGATCTTCTTAGCAGCAATCTACTTATAATGAAAAGGAATTTTCTCAGCCAAACTGATTTCTTCGTTATGCCTTTAACTCTCCAGAATTTGAGTTTGTGCGGGGGTGCATCTAGTGCAATATACACAAAAGGAACCCATTCCCTTCAGCAGGGGAGCAATGTGTTGTGTTCTCAATACGTTACCAAAGTCTGTTCCCTATGTGCCTAACTTAGGGGACATTTTCGTACACAGACAGAAAACTGCTTCCTAGTCAGTCAACCAGTCATTTCTTCATCCAAACACACACCAGCTTCTGGTTATTCAAAGACACACCCGTCCACAAAGAGATCTGTATGCACTTGACTACATCCATACCTAAGTTACCTATTCAGTAATACACATTATCCACCAACATGCCTATCCAACTGTGTGCACACCCACCATCCATATTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAGCCATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCTATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAATGAATTCGCTTGTTTACAGTAAACAATGTAAGCTATGGGCATTTGCTTTTGCTAATAAAATATTTAAAGCAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     3     2     3     2     3     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     4     5     5     5     5     5     4     5     5     5     4     5     5     5     5     5     4     5     4     5     4     5     3     4     3     5     4     5     3     5     4     5     5     6     6     6     5     6     6     6     6     6     6     6     7     7     8     8     8     8     8     8     8     8     7     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     9    10    11    11    11    11    10    11    10    11    11    11    11    11    11    11    10    11    10    11    11    11    11    11    11    11    10    11    10    10     9     9     9     9     9     9     9     9     9     9    10    10    11    11    11    12    12    14    13    16    13    16    14    17    14    17    14    17    14    17    15    18    16    20    16    20    16    20    15    20    15    20    15    20    14    21    14    20    13    18    12    18    13    19    14    19    14    19    14    19    13    19    12    19    12    18    12    18    12    18    12    19    12    19    12    19    12    19    13    19    13    19    13    19    13    19    13    19    12    19    12    18    14    18    14    18    13    19    15    19    17    19    15    18    16    18    16    17    15    17    16    17    16    17    16    17    16    17    15    17    15    17    15    16    14    15    12    14    12    14    13    14    13    14    13    14    13    14    13    14    11    12    11    11    12    12    12    12    12    12    10    10     6     6     6     6     6     6     6     6     5     6     5     6     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     4     5     4     6     4     6     6     7     6     7     6     7     7     8     7     8    11    12    12    14    13    15    14    15    14    15    15    15    15    15    16    17    18    18    19    19    21    21    20    20    21    21    20    20    21    21    23    23    24    24    24    24    24    24    24    24    24    24    24    24    24    25    24    25    24    25    23    24    23    24    23    24    24    24    24    24    24    24    24    24    24    24    25    25    25    25    25    25    25    26    26    26    25    26    25    26    26    26    26    26    26    26    25    25    25    25    24    24    24    24    24    24    24    24    24    24    24    24    24    24    25    25    25    25    25    25    23    25    24    25    23    24    24    24    24    24    24    24    23    23    23    23    21    22    20    20    20    20    19    20    19    20    19    20     4     7     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------G
                                                                                                              PROTEIN --- Sc ---- 1e-038     NP_010150.1 acts together with Cdc4p and Cdc34p to control the G1-S phase transition,assists in mediating the proteolysis of the Cdk inhibitor Sic1p in late G1;Cdc53p [Saccharomyces cerevisiae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 1e-089     NP_495525.2 cullin (96.5 kD) (cul-4) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ---- 5e-094     XP_001179111.1 PREDICTED: similar to MGC80402 protein isoform 1 [Strongylocentrotus purpuratus] -----------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 2e-179     NP_610352.2 CG8711-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          AAI00245.1 MGC115611 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 0          NP_001090088.1 hypothetical protein LOC735163 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_420335.2 PREDICTED: similar to Cullin-4B (CUL-4B) [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 0          XP_685615.1 PREDICTED: similar to Cullin-4B (CUL-4B) isoform 1 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Hs ---- 0          NP_003580.1 cullin 4A [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Mm ---- 0          NP_666319.1 cullin 4A [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                      PROTEIN --- Xt ---- 0          AAI23910.1 LOC548647 protein [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABK5766.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATG---------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---------ATG------------------ATG------------------ATG---------------------------------------------------ATG------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------TGA---------------------------------------------------------------------------------------TGA---------------------------------ATG---------------------------------ATG---------------------------------------TAA---------------------------------------------------------------------------------------------TAGTAG---TGA------------------TAA------------------------TAA---------------------------------TAG------------------TAG------------------------TAATGA------------------------------------------TAA------------TGA------------------------------------------------------------------ATG---------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG---------------TAA---------------------------------------------------------TAA------------------------------------------------------------------------------------ATG---------TAA---------------------------------------------TAA---------------------ATG------------------------------------------------------TAA---------------ATGTGA---TAA------------TAA------------------------------------------------------------TAA------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   2       bld TbA       in                   TTbA034j22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGTTAGTGACAGAATGGTTCAGAATCAAAACAATTGATGGAATCTTAAAGCTTATTGAGCAAGAACGCTCTGGGGAGGCTGTAGATCGGAGCTTGCTGAGAAGTTTATTGGGCATGTTGTCGGACTTACAAGTGTACAAAGAGTCATTTGAGACAAAGTTCTTAGAGGAGACAAATTGTTTGTATGCTGCTGAAGGACAAAGGCTCATGCAAGAAAGAGAGGTACCTGAATATCTCCATCATGTGAACAGGCGTTTAGAAGAAGAGGTAGACAGAGTTATTACATATTTGGAACCATGGGAACACATAAACCACTGATTGCTTGTGTGGAAAAACAGCTCTTAGGCGAACATTTAACTGCTATCCTTGCAAAAAGGTCTGAAGAATATGCTTGATGAAAATAGAGACCCAGAACTGACTCTAATGTATCAACTCCTTTAGTCGGGTCAAAGGTGGTCAGATAATACTACTGCAGCACTGGGGTGAATACATTAAAAACTTTGGAAGTGGATTAGTTATTAATCCCGAAAAAGACAAAGACATGGTTCAGGAGCTCCTGGATTTCAAGGATAACGTAGACCACATAATAGACGTTTGCTTCCAAAGGAATGAGAAGTTTGTCAACACTATGAAAGAATCCATTTGAAACTTTTATCAACAGAAGAGCAAACAAG
  5   1   2       bld Te1       in                         CBWN8928.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAACAGCTCTTAGGCGAGCATTTAACTGCTATCTTGCAAAAAGGTCTGAAGAATATGCTTGATGAAAATAGAGACCCAGAACTGACTCTAATGTATCAACTCTTTAGTCGGGTCAAAGGTGGTCAGATAATACTACTGCAGCACTGGGGTGAATACATTAAAAACTTTGGAAGTGGATTAGTTATTAATCCCGAAAAAGACAAAGACATGGTTCAGGAGCTCCTGGATTTCAAGGATAACGTAGACCACATAATAGACGTTTGCTTCCAGAAGAATGAGAAGTTTGTCAACACTATGAAAGAATCATTTGAAACTTTTATCAACAGAAGAGCAAACAAGCCAGCAGAACTCATAGCCAAATATGTGGATTCCAAGTTACGTTCTGGAAACAAAGAAGCAACAGATGAAGAACTGGAGAGACTTCTGGATAAAATAATGATTATATTTCGATTCATTCATGGCAAAGATGTTTTTGAAGCATTTTACAAAAAAGATCTGGCTAAAAGACTGCTGGTTGGGAAAAGTGCCTCTGTTGATTCTGAGAAGTCAATGCTATCAAAACTTAAACATGAATGTGGTGCTGCATTTACCAGTAAGCTAGAAGGGATGTTTAAAGATATGGAACTCTCCAAAGATGTAATGGTTCAGTTCAAGCAGCATATGCAAAACCACAGTGACCCAGGTAACATAGACTTGACCGTGAATATACTGACAATGGGATACTGGCCAACCTATACACC
  3  -1   2       bld Ovi1      in                         CABI4897.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGCTATCTTGCAAAAAGGTCTGAAGAATATGCTTGATGAAAATAGAGACCCAGAACTGACTCTAATGTATCAACTCTTTAGTCGGGTCAAAGGTGGTCAGATAATACTACTGCAGCACTGGGGTGAATACATTAAAAACTTTGGAAGTGGATTAGTTATTAATCCCGAAAAAGACAAAGACATGGTTCAGGAGCTCCTGGATTTCAAGGATAACGTAGACCACATAATAGACGTTTGCTTCCAGAAGAATGAGAAGTTTGTCAACACTATGAAAGAATCATTTGAAACTTTTATCAACAGAAGAGCAAACAAGCCAGCAGAACTCATAGCCAAATATGTGGATTCCAAGTTACGTTCTGGAAACAAAGAAGCAACAGATGAAGAACTGGAGAGACTTCTGGATAAAATAATGATTATATTTCGATTCATTCATGGCAAAGATGTTTTTGAAGCATTTTACAAAAAAGATCTGGCTAAAAGACTGCTGGTTGGGAAAAGTGCCTCTGTTGATTCTGAGAAGTCAATGCTATCAAAACTTAAACATGAATGTGGTGCTGCATTTACCAGTAAGCTAGAAGGGATGTTTAAAGATATGGAACTCTCCAAAGATGTAATGGTTCAGTTCAAGCAGCATATGCAAAACCACAGTGACCCAGGTAACATAGACTTGACCGTGAATATACTGACAATGGGATACTGGCCAACCTATACACCAGTGGATGTCCATTTACCAGCAGAGATGGTGAAACTTCAGGANATATTTAAAACATTTTATTTAGGAAAACATAGTGGCAGAAGACTACAGTGGCAGTCAACACTTGGGCATGCAGTTCTGAAAGCAGATTTTAAAG
  5   1   2       bld Te5       in                        CAAO12211.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCCAGAACTGACTCTAATGTATCAACTCTTTAGTCGGGTCAAAGGTGGTCAGATAATACTACTGCAGCACTGGGGTGAATACATTAAAAACTTTGGAAGTGGATTAGTTATTAATCCCGAAAAAGACAAAGACATGGTTCAGGAGCTCCTGGATTTCAAGGATAACGTAGACCACATAATAGACGTTTGCTTCCAGAAGAATGAGAAGTTTGTCAACACTATGAAAGAATCATTTGAAACTTTTATCAACAGAAGAGCAAACAAGCCAGCAGAACTCATAGCCAAATATGTGGATTCCAAGTTACGTTCTGGAAACAAAGAAGCAACAGATGAAGAACTGGAGAGACTTCTGGATAAAATAATGATTATATTTCGATTCATTCATGGCAAAGATGTTTTTGAAGCATTTTACAAAAAAGATCTGGCTAAAAGACTGCTGGTTGGGAAAAGTGCCTCTGTTGATTCTGAGAAGTCAATGCTATCAAAACTTAAACATGAATGTGGTGCTGCATTTACCAGTAAGCTAGAAGGGATGTTTAAAGATATGGAACTCTCCAAAGATGTAATGGTTCAGTTCAAGCAGCATATGCAAAACCACAGTGACCCAGGTAACATAGACTTGACCGTGAATATACTGACAATGGGATACTGGCCAACCTATACACCAGTGGATGTCCATTTACCAGCAGAGATGGTGAAACTTCAGGAAATATTTAAAACATTTTATTTAGGAAAACATAGTGGCAGAAGACTACAGTGGCAGTCAACACTTTGGCATGCAGTTCTGAAAGCAGA
  5   1   2       bld Gas7      out                        XZG19464.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGATTAATCCAGAGAAAGATAAGACAATGGTACAGGAGCTGTTGGATTTTAAAGATAAAGTGGACCATGTAATTGATGTCTGCTTCCTAAAGAACGAGAAGTTTGTCAATGCCATGAAAGAAGCATTTGAAACTTTCATTAACAAACGACCAAATAAACCTGCTGAATTAATTGCAAAATATGTTGATTCTAAACTTCGGACTGGGAACAAAGAAGCCACGGACGAAGAACTTGAGAAGATGTTGGATAAAATTATGATCATTTTTAGGTTCATTTATGGAAAGGATGTATTTGAGGCCTTCTACAAGAAAGATTTGGCAAAGAGGCTGCTAGTTGGTAAAAGTGCATCGGTAGATGCTGAAAAATCTATGCTTTCCAAATTGAAGCATGAATGCGGAGCTGCATTTACCAGCAAACTTGAAGGAATGTTTAAAGACATGGAGCTGTCTAAAGACATAATGGTTCACTTTAAGCAGTACATGCAGAACCAGAATGTCCCTGGCAACATTGAGCTTACAGTAAATATTCTAACAATGGGGTACTGGCCAACATATGTGCCTATGGAAGTTCATCTACCACCAGAGATGGTGAAACTACAGGAGATTTTTAAGACCTTTTACCTGGGAAAGCACAGTGGTAGAAAGCTACAATGGCAATCAACTCTAGGGCAGTGTGTT
  3   1   2       bld Te5       out                        CAAO7874.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCAGAACTCATAGCCAAATATGTGGATTCCAAGTTACGTTCTGAAACAAAGAAGCACNAGATGAAGAACTGGAGAGACTTCTGGATAAAATAATGATTATATTTCGATTCATTCATGGCAAAGATGTTTTTGAAGCATTTTACAAAAAAGATCTGGCTAAAAGACTGCTGGTTGGGAAAAGTGCCTCTGTTGATTCTGAGAAGTCAATGCTATCAAAACTTAAACATGAATGTGGTGCTGCATTTACCAGTAAGCTAGAAGGGATGTTTAAAGATATGGAACTCTCCAAAGATGTAATGGTTCAGTTCAAGCAGCATATGCAAAACCACAGTGACCCAGGTAACATAGACTTGACCGTGAATATACTGACAATGGGATACTGGCCAACCTATACACCAGTGGATGTCCATTTACCAGCAGAGATGGTGAAACTTCAGGAAATATTTAAAACATTTTATTTAGGAAAACATAGTGGCAGAAGACTACAGTGGCAGTCAACACTTGGGCATGCAGTTCTGAAAGCAGATTTTAAAGAAGAGAAAAAAGAACTGCAAGTGTCTCTCTTTCAGACCTTGGTGCTTCTCTTGTTTAATAAGGGAGATGAATTTGGCTTTGAAGAAATTAAAATAACAACTGGAATTGAGGATAATGAACTGAGACGAACGCTGCAGTCCCTTGCATGTGGTAAAGCCAGAGTTTTAAATAAATCACCAAAGAGCAAAGATGTGGAGGATGGAGACAGGTTTTGCTTTAATGCCGACTTCAAGCACAAACTATACAGAATTAAAATCAACCAAATAC
  5   1   2       bld Kid1      in                         CABA8157.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAACAAAGAAGCAACAGATGAAGAACTGGAGAGACTTCTGGATAAAATAATGATTATATTTCGATTCATTCATGGCAAAGATGTTTTTGAAGCATTTTACAAAAAAGATCTGGCTAAAAGACTGCTGGTTGGGAAAAGTGCCTCTGTTGATTCTGAGAAGTCAATGCTATCAAAACTTAAACATGAATGTGGTGCTGCATTTACCAGTAAGCTAGAAGGGATGTTTAAAGATATGGAACTCTCCAAAGATGTAATGGTTCAGTTCAAGCAGCATATGCAAAACCACAGTGACCCAGGTAACATAGACTTGACCGTGAATATACTGACAATGGGATACTGGCCAACCTATACACCAGTGGATGTCCATTTACCAGCAGAGATGGTGAAACTTCAGGAAATATTTAAAACATTTTATTTAGGAAAACATAGTGGCAGAAGACTACAGTGGCAGTCAACACTTGGGCATGCAGTTCTGAAAGCAGATTTTAAAGAAGAGAAAAAAGAACTGCAAGTGTCTCTCTTTCAGACCTTGGTGCTTCTCTTGTTTAATAAGGGAGATGAATTTGGCTTTGAAGAAATTAAAATAACAACTGGAATTGAGGATAATGAACTGAGACGAACGCTGCAGTCCCTTGCATGTGGTAAAGCCAGAGTTTTAAATAAATCACCAAAGAGCAAAGATGTGGAGGATGGAGACAGGTTTTGCTTTAATGCCGACTTCAAGCACAAACTATACAGAATTAAAATCAACCAAATACAAATGAAAGAAACTGTAGAAGAACAAGTGAATACAACAGAAAGGGTGTTCCAAGACCGGCAGTATCAGATTGATGCAGCTATTGTGCGCATAATGAAGATGAGAA
  3   1   2       bld Te1       in                         CBWN8928.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAGATGTTTTTGAAGCATTTTACAAAAAAGATCTGGCTAAAAGACTGCTGGTTGGGAAAAGTGCCTCTGTTGATTCTGAGAAGTCAATGCTATCAAAACTTAAACATGAATGTGGTGCTGCATTTACCAGTAAGCTAGAAGGGATGTTTAAAGATATGGAACTCTCCAAAGATGTAATGGTTCAGTTCAAGCAGCATATGCAAAACCACAGTGACCCAGGTAACATAGACTTGACCGTGAATATACTGACAATGGGATACTGGCCAACCTATACACCAGTGGATGTCCATTTACCAGCAGAGATGGTGAAACTTCAGGAAATATTTAAAACATTTTATTTAGGAAAACATAGTGGCAGAAGACTACAGTGGCAGTCAACACTTGGGCATGCAGTTCTGAAAGCAGATTTTAAAGAAGAGAAAAAAGAACTGCAAGTGTCTCTCTTTCAGACCTTGGTGCTTCTCTTGTTTAATAAGGGAGATGAATTTGGCTTTGAAGAAATTAAAATAACAACTGGAATTGAGGATAATGAACTGAGACGAACGCTGCAGTCCCTTGCATGTGGTAAAGCCAGAGTTTTAAATAAATCACCAAAGAGCAAAGATGTGGAGGATGGAGACAGGTTTTGCTTTAATGCCGACTTCAAGCACAAACTATACAGAATTAAAATCAACCAAATACAAAAAAAAAAAAAAA
  5   1   2       bld Egg                            TEgg139i23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTGAAGCATTTTACAAAAAAGATCTGGCTAAAAGACTGCTGGTTGGGAAAAGTGCCTCTGTTGATTCTGAGAAGTCAATGCTATCAAAACTTAAACATGAATGTGGTGCTGCATTTACCAGTAAGCTAGAAGGGATGTTTAAAGATATGGAACTCTCCAAAGATGTAATGGTTCAGTTCAAGCAGCATATGCAAAACCACAGTGACCCAGGTAACATAGACTTGACCGTGAATATACTGACAATGGGATACTGGCCAACCTATACACCAGTGGATGTCCATTTACCAGCAGAGATGGTGAAACTTCAGGAAATATTTAAAACATTTTATTTAGGAAAACATAGTGGCAGAAGACTACAGTGGCAGTCAACACTTGGGCATGCAGTTCTGAAAGCAGATTTTAAAGAAGAGAAAAAAGAACTGCAAGTGTCTCTCTTTCAGACCTTGGTGCTTCTCTTGTTTAATAAGGGAGATGAATTTGGCTTTGAAGAAATTAAAATAACAACTGGAATTGAGGATAATGAACTGAGACGAACGCTGCAGTCCCTTGCATGTGGTAAAGCCAGAGTTTTAAATAAATCACCAAAGAGCAAAGATGTGGAGGATGGAGACAGGTTTTGCTTTAATG
  5   1   2       bld Kid1      in                         CABA7839.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAAACTTAAACATGAATGTGGTGCTGCATTTACCAGTAAGCTAGAAGGGATGTTTAAAGATATGGAACTCTCCAAAGATGTAATGGTTCAGTTCAAGCAGCATATGCAAAACCACAGTGACCCAGGTAACATAGACTTGACCGTGAATATACTGACAATGGGATACTGGCCAACCTATACACCAGTGGATGTCCATTTACCAGCAGAGATGGTGAAACTTCAGGAAATATTTAAAACATTTTATTTAGGAAAACATAGTGGCAGAAGACTACAGTGGCAGTCAACACTTGGGCATGCAGTTCTGAAAGCAGATTTTAAAGAAGAGAAAAAAGAACTGCAAGTGTCTCTCTTTCAGACCTTGGTGCTTCTCTTGTTTAATAAGGGAGATGAATTTGGCTTTGAAGAAATTAAAATAACAACTGGAATTGAGGATAATGAACTGAGACGAACGCTGCAGTCCCTTGCATGTGGTAAAGCCAGAGTTTTAAATAAATCACCAAAGAGCAAAGATGTGGAGGATGGAGACAGGTTTTGCTTTAATGCCGACTTCAAGCACAAACTATACAGAATTAAAATCAACCAAATACAAATGAAAGAAACTGTAGAAGAACAAGTGAATACAACAGAAAGGGTGTTCCAAGACCGGCAGTATCAGATTGATGCAGCTATTGTGCGCATAATGAAGATGAGAAAGACCCTTACTCATAATCTTTTGGTCTCTGAGCTTTACAATCAATTGAAATTCCCTGTAAAGCCAGGAGACTTGAAGAANAGGATTGAATCCCTTATAGACAGAGACTATATGGAAAGAGATAAAGACAATGCAAAACAGTACCATTATCTGGCATGAAC
  5   1   2       bld Tad5      in                         XZT39756.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGGTAACATAGACTTGACCGTGAATATACTGACAATGGGATACTGGCCAACCTATACACCAGTGGATGTCCATTTACCAGCAGAGATGGTGAAACTTCAGGAAATATTTAAAACATTTTATTTAGGAAAACATAGTGGCAGAAGACTACAGTGGCAGTCAACACTTGGGCATGCAGTTCTGAAAGCAGATTTTAAAGAAGAGAAAAAAGAACTGCAAGTGTCTCTCTTTCAGACCTTGGTGCTTCTCTTGTTTAATAAGGGAGATGAATTTGGCTTTGAAGAAATTAAAATAACAACTGGAATTGAGGATAATGAACTGAGACGAACGCTGCAGTCCCTTGCATGTGGTAAAGCCAGAGTTTTAAATAAATCACCAAAGAGCAAAGATGTGGAGGATGGAGACAGGTTTTGCTTTAATGCCGACTTCAAGCACAAACTATACAGAATTAAAATCAACCAAATACAAATGAAAGAAACTGTAGAAGAACAAGTGAATACAACAGAAAGGGTGTTCCAAGACCGGCAGTATCAGATTGATGCAGCTATTGTGCGCATAATGAAGATGAGAAAGACCCTTACTCATAATCTTTTGGTCTCTGAGCTTTACAATCAATTGAAATTCCCTGTAAAGCCAGGAGACTTGAAGAAAAGGATTGAATCCCTTATAGACAGAGACTATATGGAAAGAGATAAAGACAATGCAAAACAGTACCATTATCTGGCATGAACAAAAAAACCTGGACTTTATCAGAGAACAAATCTGCACCAGTCGCAATAAAGAACAGTGCATCATTTCTCTCTAGCNGTCCTGCTCTGAGTG
  3   1   2       bld Te5       in                        CAAO12211.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAACATAGACTTGACCGTGAATATACTGACAATGGGATACTGCCCAACCTATACACCAGTGGATGTCCATTTACCAGCAGAGATGGTGAAACTTCAGGAAATATTTAAAACATTTTATTTAGGAAAACATAGTGGCAGAAGACTACAGTGGCAGTCAACACTTGGGCATGCAGTTCTGAAAGCAGATTTTAAAGAAGAGAAAAAAGAACTGCAAGTGTCTCTCTTTCAGACCTTGGTGCTTCTCTTGTTTAATAAGGGAGATGAATTTGGCTTTGAAGAAATTAAAATAACAACTGGAATTGAGGATAATGAACTGAGACGAACGCTGCAGTCCCTTGCATGTGGTAAAGCCAGAGTTTTAAATAAATCACCAAAGAGCAAAGATGTGGAGGATGGAGACAGGTTTTGCTTTAATGCCGACTTCAAGCACAAACTATACAGAATTAAAATCAACCAAATACAAATGAAAGAAACTGTAGAAGAACAAGTGAATACAACAGAAAGGGTGTTCCAAGACCGGCAGTATCAGATTGATGCAGCTATTGTGCGCATAATGAAGATGAGAAAGACCCTTACTCATAATCTTTTGGTCTCTGAGCTTTACAATCAATTGAAATTCCCTGTAAAGCCCGGAGACTTGAAGAAAAGGATTGAATCCCTTATAGACAGAGACTATATGGAAAGAGATAAAGACAATGCAAAACAGTACCATTATCTGGCATGAACAAAAAAACCTGGACTTTATCAGAGAACAAATCTGCACCAGTCGCAATAAAGAACCAGTGCATCATT
  3   1   2       bld Kid1      in                         CABA8157.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTATACACCAGTGGATGTCCATTTACCAGCAGAGATGGTGAAACTTCAGGAAATATTTAAAACATTTTATTTAGGAAAACATAGTGGCAGAAGACTACAGTGGCAGTCAACACTTGGGCATGCAGTTCTGAAAGCAGATTTTAAAGAAGAGAAAAAAGAACTGCAAGTGTCTCTCTCTCAGACCTTGGTGCTTCTCTTGTTTAATAAGGGAGATGAATTTGGCTTTGAAGAAATTAAAATAACAACTGGAATTGAGGATAATGAACTGAGACGAACGCTGCAGTCCCTTGCATGTGGTAAAGCCAGAGTTTTAAATAAATCACCAAAGAGCAAAGATGTGGAGGATGGAGACAGGTTTTGCTTTAATGCCGACTTCAAGCACAAACTATACAGAATTAAAATCAACCAAATACAAATGAAAGAAACTGTAGAAGAACAAGTGAATACAACAGAAAGGGTGTTCCAAGACCGGCAGTATCAGATTGATGCAGCTATTGTGCGCATAATGAAGATGAGAAAGACCCTTACTCATAATCTTTTGGTCTCTGAGCTTTACAATCAATTGAAATTCCCTGTAAAGCCAGGAGACTTGAAGAAAAGGATTGAATCCCTTATAGACAGAGACTATATGGAAAGAGATAAAGACAATGCAAAACAGTACCATTATCTGGCATGAACAAAAAACCTGGACTTTATCAGAGAACAAATCTGCACCAGTCGCAATAAAGAACCAGTGCATCATTTCTCTCTAGCGTTCCTGCTCTGAGTGACAAGACAATATCTTAATGCCCCATCCCCAATGCACCTTAGAAAATTTGAATTAGTTTTCTGTATCATGTATTCTTGTTTGTGTGGCTGCTTAA
  5   1   2       bld Tad5      in                         XZT18353.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCAGATTTTAAAGAAGAGAAAAAAGAACTGCAAGTGTCTCTCTTTCAGACCTTGGTGCTTCTCTTGTTTAATAAGGGAGATGAATTTGGCTTTGAAGAAATTAAAATAACAACTGGAATTGAGGATAATGAACTGAGACGAACGCTGCAGTCCCTTGCATGTGGTAAAGCCAGAGTTTTAAATAAATCACCAAAGAGCAAAGATGTGGAGGATGGAGACAGGTTTTGCTTTAATGCCGACTTCAAGCACAAACTATACAGAATTAAAATCAACCAAATACAAATGAAAGAAACTGTAGAAGAACAAGTGAATACAACAGAAAGGGTGTTCCAAGACCGGCAGTATCAGATTGATGCAGCTATTGTGCGCATAATGAAGATGAGAAAGACCCTTACTCATAATCTTTTGGTCTCTGAGCTTTACAATCAATTGAAATTCCCTGTAAAGCCAGGAGACTTGAAGAAAAGGATTGAATCCCTTATAGACAGAGACTATATGGAAAGAGATAAAGACAATGCAAAACAGTACCATTATCTGGCATGAACAAAAAAACCTGGACTTTATCAGAGAACAAATCTGCACCAGTCGCAATAAAGAACCAGTGCATCATTTCTCTCTAGCGTTCCTGCTCTGAGTGACAAGACAATATCTTAATGCCCCATCCCCAATGCACCTTAGAAAATTTGAATTAGTTTTCTGTATCATGTATTCTTGTTTGTGTGGCTGCTTAAAATTGTTGCTAGTTTAATGGCACAAATACATTGCATTTTGTTTTGTTTTTCCTTTTTTTTTGTCTAGCATACTATCTCACACCATAACACCTCAANTGCTGCATATTTATTAGTAGCTAT
  5   1   2       bld Gas       out                  TGas094o07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTTCTCTTGTTTAATAAGGGAGATGAATTTGGCTTTGAAGAAATTAAAATAACAACTGGAATTGAGGATAATGAACTGAGACGAACGCTGCAGTCCCTTGCATGTGGTAAAGCCAGAGTTTTAAATAAATCACCAAAGAGCAAAGATGTGGAGGATGGAGACAGGTTTTGCTTTAATGCCGACTTCAAGCACAAACTATACAGAATTACAATCAACCCCATACAAATGAA
  3   1   2       bld TbA       in                    TTbA034j22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTTTAATAAGGGAGATGAATTTGGCTTTGAAGAAATTAAAATAACAACTGGAATTGAGGATAATGAATTGAGAGGAACGCTGCAGTCCCTTGCATGTGGTAAAGCCAGAGTTTTAAATAAATCACCAAAGAGCAAAGATGTGGAGGATGGAGACAGGTTTTGCTTTAATGCCGACTTCAAGCACAAACTATACAGAATTAAATTCAACCAAATACAAATGAAAGAAACTGTGGAAGAACAAGTGAATACAACAGAAAGGGTGTTCCAAGACCGGCAGTATCAGATTGATGCAGCTATTGTGCGCATAATGAAGATGAGAAAGACCCTTACTCATAATCTTTTGGTTTTTGAGCTTTACAATCAATTGAAATTCCCTGTAAAGCCAGGAGACTTGAAGAAAAGGATTGAATCCCTTATAGACAGAGACTATATGGAAAGAGATAAAGACAATGCAAAACAGTACCATTTTTTGGCATGAACAAAAAACCTGGACTTTATCAGAGAACAAATTTGCACCAGTCGCAATAAAGAACCAGTGCATCATTTTTTTTTAGCGTTCTTGTTTTGAGTGACAAGACAATATTTTAATGCCCCATCCCCAATGCACCTTAGAAAATTTGAATTAGTTTTCTGTATCATGTATTCTGGTTGGGGGGGCGGCTTAAAATTGTTGCTAGTTTAATGGCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te4  5g3  out                        CAAN7518.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGATGAATTTGCCTTTGAAGAAATTAAAATANCAACTGGAATTGAGGATAATGAACTGAGACGAACGCTGCAGTCCCTTGCATGTGGTAAAGCCAGAGTTTTAAATAAATCACCAAAGAGCAAAGATGTGGAGGATGGAGACAGGTTTTGCTTTAATGCCGACTTCAAGCACAAACTATACAGAATTAAAATCAACCAAATACAAATGAAAGAAACTGTAGAAGAACAAGTGAATACAACAGAAAGGGTGTTCCAAGACCGGCAGTATCAGATTGATGCAGCTATTGTGCGCATAATGAAGATGAGAAAGACCCTTACTCATAATCTTTTGGTCTCTGAGCTTTACAATCAATTGAAATTCCCTGTAAAGCCCGGAGACTTGAAGAAAAGGATTGAATCCCTTATAGACAGAGACTATATGGAAAGAGATAAAGACAATGCAAAACAGTACCATTATCTGGCATGAACAAAAAAACCTGGACTTTATCAGAGAACAAATCTGCACCAGTCGCAATAAAGAACCAGTGCATCATTTCTCTCTAGCGTTCCTGCTCTGAGTGACAAGACAATATCTTAATGCCCCATCCCCAATGCACCTTAGAAAATTTGAATTAGTTTTCTGTATCATGTATTCTTGTTTGTGTGGCTGCTTAAAATTGTTGCTAGTTTAATGGCACAAATACATTGCATTTTGTTTTGTTTTTCCTTTTTTTTGTTCTAGCATACTATCTCACACCATAACACCTCAATGCTGCAATATTTATTAGTAGCTATGAGGATTACAATCAGGAGACTAATGTTATTGTGGTTATGTCAGGAAATAAACCAGCTCCAAAAC
  3   1   2       bld Kid1      in                         CABA7839.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCTTTGAAGAAATTAAAATAACAACTGGAATTGAGGATAATGAACTGAGACGAACGCTGCAGTCCCTTGCATGTGGTAAAGCCAGAGTTTTAAATAAATCACCAAAGAGCAAAGATGTGGAGGATGGAGACAGGTTTTGCTTTAATGCCGACTTCAAGCACAAACTATACAGAATTAAAATCAACCAAATACAAATGAAAGAAACTGTAGAAGAACAAGTGAATACAACAGAAAGGGTGTTCCAAGACCGGCAGTATCAGATTGATGCAGCTATTGTGCGCATAATGAAGATGAGAAAGACCCTTACTCATAATCTTTTGGTCTCTGAGCTTTACAATCAATTGAAATTCCCTGTAAAGCCAGGAGACTTGAAGAAAAGGATTGAATCCCTTATAGACAGAGACTATATGGAAAGAGATAAAGACAATGCAAAACAGTACCATTATCTGGCATGAACAAAAAACCTGGACTTTATCAGAGAACAAATCTGCACCAGTCGCAATAAAGAACCAGTGCATCATTTCTCTCTAGCGTTCCTGCTCTGAGTGACAAGACAATATCTTAATGCCCCATCCCCAATGCACCTTAGAAAATTTGAATTAGTTTTCTGTATCATGTATTCTTGTTTGTGTGGCTGCTTAAAATTGTTGCTAGTTTAATGGCACAAATACATTGCATTTTGTTTTGTTTTTCCTTTTTTTTGTTCTAGCATACTATCTCACACCATAACACCTCAATGCTGCAATATTTATTAGTAGCTATGAGGATTACAATCAGGAGACTAATGTTATTGTGGTTATGTCAGGAAATAAACCAGCTCCAAAAC
  3   1   2       bld Tad5 5g3  out                        XZT21052.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGAAATTAAAATAACACTGGGAATTGAGGATAATGAACTGAGACGAACGCTGCAGTCCCTTGCATGTGGTAAAGCCAGAGTTTTAAATAAATCACCAAAGAGCAAAGATGTGGAGGATGGAGACAGGTTTTGCTTTAATGCCGACTTCAAGCACAAACTATACAGAATTAAAATCAACCAAATACAAATGAAAGAAACTGTAGAAGAACAAGTGAATACAACAGAAAGGGTGTTCCAAGACCGGCAGTATCAGATTGATGCAGCTATTGTGCGCATAATGAAGATGAGAAAGACCCTTACTCATAATCTTTTGGTCTCTGAGCTTTACAATCAATTGAAATTCCCTGTAAAGCCAGGAGACTTGAAGAAAAGGATTGAATCCCTTATAGACAGAGACTATATGGAAAGAGATAAAGACAATGCAAAACAGTACCATTATCTGGCATGAACAAAAAAACCTGGACTTTATCAGAGAACAAATCTGCACCAGTCGCAATAAAGAACCAGTGCATCATTTCTCTCTAGCGTTCCTGCTCTGAGTGACAAGACAATATCTTAATGCCCCATCCCCAATGCACCTTAGAAAATTTGAATTAGTTTTCTGTATCATGTATTCTTGTTTGTGTGGCTGCTTAAAATTGTTGCTAGTTTAATGGCACAAATACATTGCATTTTGTTTTGTTTTTCCTTTTTTTTGTTCTAGCATACTATCTCACACCATAACACCTCAATGCTGCAATATTTATTAGTAGCTATGAGGATTACAATCAGGAGACTAATGTTATTGTGGTTATGTCAGGAAATAAACCAGCTCC
  3   1   2       bld Ova1 5g3  out                       CABE10533.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATTAAAATAACAACTGGAATTGAGGATAATGAACTGAGACGAACGCTGCAGTCCCTTGCATGTGGTAAAGCCAGAGTTTTAAATAAATCACCAAAGAGCAAAGATGTGGAGGATGGAGACAGGTTTTGCTTTAATGCCGACTTCAAGCACAAACTATACAGAATTAAAATCAACTAAATACAAATGAAAGAAACTGTAGAAGAACAAGTGAATACAACAGAAAGGGTGTTCCAAGACCGGCAGTATCAGATTGATGCAGCTATTGTGCGCATAATGAAGATGAGAAAGACCCTTACTCATAATCTTTTGGTCTCTGAGCTTTACAATCAATTGAAATTCCCTGTAAAGCCAGGAGACTTGAAGAAAAGGATTGAATCCCTTATAGACAGAGACTATATGGAAAGAGATAAAGACAATGCAAAACAGTACCATTATCTGGCATGAACAAAAAACCTGGACTTTATCAGAGAACAAATCTGCACCAGTCGCAATAAAGAACCAGTGCATCATTTCTCTCTAGCGTTCCTGCTCTGAGTGACAAGACAATATCTTAATGCCCCATCCCCAATGCACCTTAGAAAATTTGAATTAGTTTTCTGTATCATGTATTCTTGTTTGTGTGGCTGCTTAAAATTGTTGCTAGTTTAATGGCACAAATACATTGCATTTTGTTTTGTTTTTCCTTTTTTTTGTTCTAGCATACTATCTCACACCATAACACCTCAATGCTGCAATATTTATTAGTAGCTATGAGGATTACAATCAGGAGACTAATGTTATTGTGGTTATGTCAGGAAATAAACCAGCTCCAAAAC
  5   1   2       chi Lun1      in                         CABD2135.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAAGACCGGCAGTATCAGATTGATGCAGCTATTGTGCGCATAATGAAGATGAGAAAGACCCTTACTCATAATCTTTTGGTCTCTGAGCTTTACAATCAATTGAAATTCCCTGTAAAGGTACATACTGCTTTATTAACCATTCCTATATGATACATTGTTTGGCATAGCTGGTTCTAAATTTATATATATTTATATATATTTATATACTGCAGGACAGACGTTCATAAGTTCCTATTGATACAGACAGACTTTAAGGACTTTGGCAGTTCAACCTGGGCAAGCTTTATGGTGGGAGGACTTGGGCTTTGTATAAGTTATATCCATTTATTTGAATTCTGTTCTTTCAGCCAGGAGACTTGAAGAAAAGGATTGAATCCCTTATAGACAGAGACTATATGGAAAGAGATAAAGACAATGCAAAACAGTACCATTATCTGGCATGAACAAAAAACCTGGACTTTATCAGAGAACAAATCTGCACCAGTCGCAATAAAGAACCAGTGCATCATTTCTCTCTAGCGTTCCTGCTCTGAGTGACAAGACAATATCTTAATGCCCCATCCCCAATGCACCTTAGAAAATTTGAATTAGTTTTCTGTATCATGTATTCTTGTTTGTGTGGCTGCTTAAAATTGTTGCTAGTTTAATGGCACAAATACATTGCATTTTGTTTTGTTTTTCCTTTTTTTTGTTCTAGCATACTATCTCACACCATAACACCTCAATGCTGCAATATTTATTAGTAGCTATGAGGATTACAATCAGGAGACTAATGTTATTGTGGTTATGTCAGGAAATAAACCAGCTCCAAAACAAAACATTTTCTTTCTATTTAGCTGCATGACCGATTGAGCTAGATCTTCTTTAGCAGCATCTACTTTATATGAAA
  5   1   2       bld Fat1      in                         CABC6382.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGGGATAATGAACTGAGACGAACGCTGCAGTCCCTTGCATGTGGTAAAGCCAGAGTTTTAAATAAATCACCAAAGAGCAAAGATGTGGAGGATGGAGACAGGTTTTGCTTTAATGCCGACTTCAAGCACAAACTATACAGAATTAAAATCAACCAAATACAAATGAAAGAAACTGTAGAAGAACAAGTGAATACAACAGAAAGGGTGTTCCAAGACCGGCAGTATCAGATTGATGCAGCTATTGTGCGCATAATGAAGATGAGAAAGACCCTTACTCATAATCTTTTGGTCTCTGAGCTTTACAATCAATTGAAATTCCCTGTAAAGCCAGGAGACTTGAAGAAAAGGATTGAATCCCTTATAGACAGAGACTATATGGAAAGAGATAAAGACAATGCAAAACAGTACCATTATCTGGCATGAACAAAAAACCTGGACTTTATCAGAGAACAAATCTGCACCAGTCGCAATAAAGAACCAGTGCATCATTTCTCTCTAGCGTTCCTGCTCTGAGTGACAAGACAATATCTTAATGCCCCATCCCCAATGCACCTTAGAAAATTTGAATTAGTTTTCTGTATCATGTATTCTTGTTTGTGTGGCTGCTTAAAATTGTTGCTAGTTTAATGGCACAAATACATTGCATTTTGTTTTGTTTTTCCTTTTTTTTGTTCTAGCATACTATCTCACACCATAACACCTCAATGCTGCAATATTTATTAGTAGCTATGAGGATTACAATCAGGAGACTAATGTTATTGTGGTTATGTCAGGAAATAAACCAGCTCCAAAACAAAACATTTTCTTTCTATTTAGCTGCATGACCGATTGAGCTAGATCTTCTTAGCAGCAATCTACTTATAATGAAAAGG
  5  -1   0       chi TbA                            TTbA046m19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTCATTATCATGAATTCCAGTAGATATTTTAATTTTTTCAAAGCCAAATTCATCTCCTTTGTTAAACAAGAGAAGCACCAAGGTCTGAAAGAGAGACAAGTGCAGTTCTTTTTTTTCTTCTTTAAAATCAACCAAATACAAATGAAAGAAACTGTAGAAGATCAAGTGAATACAACAGAAAGGGTGTTCCAAGACCGGCAGTATCAGAATGATGCAGNTATNGTGCGCATAATGAGANGAGAANGNCCCTTACTCATAATCAATTGATTGTAAA
  5   1   2       bld Liv1      in                         CAAR5391.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTAAATAAATCACCAAAGAGCAAAGATGTGGAGGATGGAGACAGGTTTTGCTTTAATGCCGACTTCAAGCACAAACTATACAGAATTAAAATCAACCAAATACAAATGAAAGAAACTGTAGAAGAACAAGTGAATACAACAGAAAGGGTGTTCCAAGACCGGCAGTATCAGATTGATGCAGCTATTGTGCGCATAATGAAGATGAGAAAGACCCTTACTCATAATCTTTTGGTCTCTGAGCTTTACAATCAATTGAAATTCCCTGTAAAGCCAGGAGACTTGAAGAAAAGGATTGAATCCCTTATAGACAGAGACTATATGGAAAGAGATAAAGACAATGCAAAACAGTACCATTATCTGGCATGAACAAAAAACCTGGACTTTATCAGAGAACAAATCTGCACCAGTCGCAATAAAGAACCAGTGCATCATTTCTCTCTAGCGTTCCTGCTCTGAGTGACAAGACAATATCTTAATGCCCCATCCCCAATGCACCTTAGAAAATTTGAATTAGTTTTCTGTATCATGTATTCTTGTTTGTGTGGCTGCTTAAAATTGTTGCTAGTTTAATGGCACAAATACATTGCATTTTGTTTTGTTTTTCCTTTTTTTTGTTCTAGCATACTATCTCACACCATAACACCTCAATGCTGCAATATTTATTAGTAGCTATGAGGATTACAATCAGGAGACTAATGTTATTGTGGTTATGTCAGGAAATAAACCAGCTCC
  5   1   2       bld Gas0                                 dad20d08.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGCACCCTCATCTTGACCCAAAGAAAGCCATCCCCGGGGNAGGAGGATCTTTTGGGGCTTTAAGCCGACTACACCCCAACTATACAGAATAAAACAACCAAAACAAATGAAAGAAATGTAGAAGAACAAGTGAATACACAGAAGGGTGTTCCAAGACCGGCAGTATCAGAATGATGCAGCTATTGTGCGCATAATGTAAGAGAGAAAGACCCTTACTCATAAGCTTTTGGTCTCTGAGCTTTACAATCAATTGAAATTCCCTGTAAAGCCAGGAGACTGGAAGAAAAGGATTGAATCCCTTATAGACAGAGACTATATGGAAAGAGATAAAGACAATGCAAAACAGTACCATAAAACAGCATGAACAAAAAACCTGGACTTTATCAGAGAACAAAACTGCACCAGTCGCAATAAAGAACCAGTGCATCATTTCTCTCTAGCGTTCCTGCTCTGAGTGACAAGACAATATCTTAATGCCCCATCC
  3   1   2       bld Te1  5g3  out                       CBWN14131.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAAGAGCAAAGATGTGGAGGATGGAGACAGGTTTTGCTTTAATGCCGACTTCAAGCACAAACTATACAGAATTAAAATCAACCAAATACAAATGAAAGAAACTGTAGAAGAACAAGTGAATACAACAGAAAGGGTGTTCCAAGACCGGCAGTATCAGATTGATGCAGCTATTGTGCGCATAATGAAGATGAGAAAGACCCTTACTCATAATCTTTTGGTCTCTGAGCTTTACAATCAATTGAAATTCCCTGTAAAGCCAGGAGACTTGAAGAAAAGGATTGAATCCCTTATAGACAGAGACTATATGGAAAGAGATAAAGACAATGCAAAACAGTACCATTATCTGGCATGAACAAAAAACCTGGACTTTATCAGAGAACAAATCTGCACCAGTCGCAATAAAGAACCAGTGCATCATTTCTCTCTAGCGTTCCTGCTCTGAGTGACAAGACAATATCTTAATGCCCCATCCCCAATGCACCTTAGAAAATTTGAATTAGTTTTCTGTATCATGTATTCTTGTTTGTGTGGCTGCTTAAAATTGTTGCTAGTTTAATGGCACAAATACATTGCATTTTGTTTTGTTTTTCCTTTTTTTTGTTCTAGCATACTATCTCACACCATAACACCTCAATGCTGCAATATTTATTAGTAGCTATGAGGATTACAATCAGGAGACTAATGTTATTGTGGTTATGTCAGGAAATAAACCAGCTCCAAAACAAAAAAAAAAAAAAA
  3   1   2       chi Te4  FL   out                        CAAN5699.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAGTGAATCCAACAGAAAGGGTGTTCCAAGACCGGCAGTATCAGATTGATGCAGCTATTGTGCGCATAATGAAGATGAGAAAGACCCTTACTCATAATCTTTTGGTCTCTGAGCTTTACAATCAATTGAAATTCCCTGTAAAGCCAGGAGACTTGAAGAAAAGGATTGAATCCCTTATAGACAGAGACTATATGGAAAGAGATAAAGACAATGCAAAACAGTACCATTATTTGGCATGAACAAAAAACCTGGACTTTATCAGAGAACAAATCTGCACCAGTCGCAATAAAGAACCAGTGCATCATTTCTCTCTAGCGTTCCTGCTCTGAGTGACAAGACAATATCTTAATGCCCCATCCCCAATAAAGAACCAGTGCATCATTTCTCTCTAGCGTTCCTGCTCTGAGTGACAAGACAATATCTTAATGCCCCATCCCCAATGCACCTTAGAAAATTTGAATTAGTTTTCTGTATCATGTATTCTTGTTTGTGTGGCTGCTTAAAATTGTTGCTAGTTTAATGGCACAAATACATTGCATTTTGTTTTGTTTTTCCTTTTTTTTGTTCTAGCATACTATCTCACACCATAACACCTCAATGCTGCAATATTTATTAGTAGCTATGAGGATTACAATCAGGAGACTAATGTTATTGTGGTTATGTCAGGAAATAAACCAGCTCCAAACC
  3   1   2       bld Gas7 5g3  out                        XZG11927.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGAAGAACAAGTGAATACAACAGAAAGGGTGTTCCAAGACCGGCAGTATCAGATTGATGCAGCTATTGTGCGCATAATGAAGATGAGAAAGACCCTTACTCATAATCTTTTGGTCTCTGAGCTTTACAATCAATTGAAATTCCCTGTAAAGCCAGGAGACTTGAAGAAAAGGATTGAATCCCTTATAGACAGAGCCTATATGGAAAGAGATAAAGACAATGCAAAACAGTACCATTATCTGGCATGAACAAAAAAACCTGGACTTTATCAGAGAACAAATCTGCACCAGTCGCAATAAAGAACCAGTGCATCATTTCTCTCTAGCGTTCCTGCTCTGAGTGACAAGACAATATCTTAATGCCCCATCCCCAATGCACCTTAGAAAATTTGAATTAGTTTTCTGTATCATGTATTCTTGTTTGTGTGGCTGCTTAAAATTGTTGCTAGTTTAATGGCACAAATACATGGCATTTGGTTTTGTTTTTCCTTTTTTTTGTTCTAGCATACTATCTCACACCATAACACCTCAATGCTGCAATATTTATTAGTAGCT
  5   1   2       bld Gas                            TGas129c17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TATTGTGCGCATAATGAAGATGAGAAAGACCCTTACTCATAATCTTTTGGTCTCTGAGCTTTACAATCAATTGAAATTCCCTGTAAAGCCAGGAGACTTGAAGAAAAGGACTGAATCCCTTATAGACAGAGACTATATGGAAAGAGATAAAGACAATGCAAAACAGTACCATTATCTGGCATGAACAAAAAAACCTGGACTTTATCAGAGAACAAATCTGCACCAGTCGCAATAAAGAACCAGTGCATCATTTCTCTCTAGCGTTCCTGCTCTGAGTGACAAGACAATATCTTAATGCCCCATCCCCAATGCACCTTAGAAAATTTGAATTAGTTTTCTGTATCATGTATTCTTGTTTGTGTGGCTGCTTAAAATTGTTGCTAGTTTAATGGCACAAATACATTGCA
  3   1   2       bld Tad5      in                         XZT39756.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCTTTACAATCAATTGAAATTCCCTGTAAACCCAGGAGACTTGAAGAAAAGGATTGATTCCTTTATAGACAGGGCCTTTTTGGAAAGAGATAAAGCCAATGCAAACCAGTCCCTTTTTTTGGCATGAACAAAAAAACCTGGACTTTTTCAGAGAACAAATTTGCCCCAGTCGCAATAAAGAACCAGTGCATCATTTCTCTCAAGCGTTCCTGTTTTGAGTGCCAAGACAATTTTTTAATGCCCCATCCCCAATGCCCCTTAGAAAATTTGAATTAGTTTTCTGTACCAGGTATTCTTGTTTGGGGGGCTGCTTAAAATTGTTGCTAGTTTAAGGGCACAAATCCATGGCATTTGGTTTGGTTTTCCCTTTTTTTTGTTCTAGAATACTATCTCACCCCATAACACCTCAATGCTGCAATATTTTTTGGTA
  5   1   2       bld Gas                            TGas048o06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAATCTGCACCAGTCGCAATAAAAAACCAGTGCATCATTTCTCTCTAGCGTTCCTGCTCTGAGTGACAAGACAATATCTTAATGCCCCATCCCCAATGCACCTTAGAAAATTTGAATTAGTTTTCTGTATCATGTATTCTTGTTTGTGTGGCTGCTTAAAATTGTTGCTAGTTTAATGGCACAAATACATTGCATTTTGTTTTGTTTTTCCTTTTTTTTGTTCTAGCATACTATCTCACACCATAACACCTCAATGCTGCAATATTTATTAGTAGCTATGAGGATTACAATCAGGAGACTAATGTTATTGTGGTGATGTCAGGAAATAAACCAGCTCCAAAACAAAACATTTTCTTTCTATTTANCTGCATGACCGATTGAGCTAGATCTTCTTAGCAGCAATCTACTTATAATGAAAAGGAATTTTCTCAGCCAAACTGATTTCTTCGTTATGCCTTTAACTCTCCANAATTTGAGTTTGTGCGGGGGTGCATCTAGTGCAATATACACAAAAGGAACCCATTCCCTTCANCAGGGGAGCAATGTGTTGTGTTCTCAATACGTTACCAAAGTCTGTTCCCTATGTGCCTAACTTANGGGACATTTTCGTA
  5   1   2       bld Ovi1      in                          CABI571.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTAATGCCCCATCCCCAATGCACCTTAGAAAATTTGAATTAGTTTTCTGTATCATGTATTCTTGTTTGTGTGGCTGCTTAAAATTGTTGCTAGTTTAATGGCACAAATACATTGCATTTTGTTTTGTTTTTCCTTTTTTTTGTTCTAGCATACTATCTCACACCATAACACCTCAATGCTGCAATATTTATTAGTAGCTATGAGGATTACAATCAGGAGACTAATGTTATTGTGGTTATGTCAGGAAATAAACCAGCTCCAAAACAAAACATTTTCTTTCTATTTAGCTGCATGACCGATTGAGCTAGATCTTCTTAGCAGCAATCTACTTATAATGAAAAGGAATTTTCTCAGCCAAACTGATTTCTTCGTTATGCCTTTAACTCTCCAGAATTTGAGTTTGTGCGGGGGTGCATCTAGTGCAATATACACAAAAGGAACCCATTCCCTTCAGCAGGGGAGCAATGTGTTGTGTTCTCAATACGTTACCAAAGTCTGTTCCCTATGTGCCTAACTTAGGGGACATTTTCGTACACAGACAGAAAACTGCTTCCTAGTCAGTCAACCAGTCATTTCTTCATCCAAACACACACCAGCTTCTGGTTATTCAAAGACACACCCGTCCACAAAGAGATCTGTATGCACTTGACTACATCCATACCTAAGTTACCTATTCAGTAATACACATTATCCACCAACATGCCTATCCAACTGTGTGCACACCCACCATCCATATTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAG
  5   1   2       bld Gas       in                   TGas059f06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGATACAATCAGGAGACTAATGTTATTGTGGTTATGTCAGGAAATAAACCAGCTCCAAAACAAAACATTTTCTTTCTATTTAGCTGCATGACCGATTGAGCTAGATCTTCTTAGCAGCAATCTACTTATAATGAAAAGGAATTTTCTCAGCCAAACTGATTTCTTCGTTATGCCTTTAACTCTCCAGAATTTGAGTTTGTGCGGGGGTGCATCTAGTGCAATATACACAAAAGGAACCCATTCCCTTCAGCAGGGGAGCAATGTGTTGTGTTCTCAATACGTTACCAAAGTCTGTTCCCTATGTGCCTAACTTAGGGGACATTTTCGTACACAGACAGAAAACTGCTTCCTAGTCAGTCAACCAGTCATTTCTTCATCCAAACACACACCAGCTTCTGGTTATTCAAAGACACACCCGTCCACAAAGAGATCTGTATGCACTTGACTACATCCATACCTAAGTTACCTATTCAGTAATACACATTATCCACCAACATGCCTATCCAACTGTGTGCACACCCACCATCCATATTCCCAATAAACTGCTCTT
  5   1   2       bld Gas8      in                          st86k02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAACATTTTCTTTCTATTTAGCTGCATGACCGATTGAGCTAGATCTTCTTAGCAGCAATCTACTTATAATGAAAAGGAATTTTCTCAGCCAAACTGATTTCTTCGTTATGCCTTTAACTCTCCAGAATTTGAGTTTGTGCGGGGGTGCATCTAGTGCAATATACACAAAAGGAACCCATTCCCTTCAGCAGGGGAGCAATGTGTTGTGTTCTCAATACGTTACCAAAGTCTGTTCCCTATGTGCCTAACTTAGGGGACATTTTCGTACACAGACAGAAAACTGCTTCCTAGTCAGTCAACCAGTCATTTCTTCATCCAAACACACACCAGCTTCTGGTTATTCAAAGACACACCCGTCCACAAAGAGATCTGTATCCACTTGACTACATCCATACCTAAGTTACCTATTCAGTAATACACATTATCCACCAACATGCCTATCCAACTGTGTGCACACCCACCATCCATATTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAGCCATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAAC
  5   1   2       bld Ova1      in                         CABE1067.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCATCGATTCGATTTCTTCGTTATGCCTTTAACTCTCCAGAATTTGAGTTTGTGCGGGGGTGCATCTAGTGCAATATACACAAAAGGAACCCATTCCCTTCAGCAGGGGAGCAATGTGTTGTGTTCTCAATACGTTACCAAAGTCTGTTCCCTATGTGCCTAACTTAGGGGACATTTTCATACACAGACAGAAAACTGCTTCCTAGTCAGTCAACCAGTCATTTCTTCATCCAAACACACACCAGCTTCTGGTTATTCAAAGACACACCCGTCCACAAAGAGATCTGTATGCACTTGACTACATCCATACCTAAGTTACCTATTCAGTAATACACATTATCCACCAACATGCCTATCCAACTGTGTGCACACCCACCATCCATATTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAGCCATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCTATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTA
  5   1   2       chi Egg       in                   TEgg040g09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCAATCTCGCGAGATTATAGAAGTAACAAACTTTCCCGAAATCCTTTGCGTTTCCTCTTTCCAGCCAGCGCCTGAGAATGGGTATCTCAAGGGACAACTGGCACAAGCGCCGCAAGACTGGTGGCAAAAGGAAGCCTTATCACAAAAAAAAAAAAAAAGCGGCCGTCACACTAGTCCAGTAATACACATTATCCACCAACATGCCTATCCAACTGTGTGCACACCCACCATCCATATTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAGCGATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCCATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTGTCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGC
  5   1   2       bld Neu5      in                         ANHP2484.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTGTTGGGTGGTTCAATGAATGTGTAGTCAGTCAACCAGTCATTTCTTCATCCAAACACACACCAGCTTCTGGTTATTCAAAGACACACCCGTCCACAAAGAGATCTGTATGCACTTGACTACATCCATACCTAAGTTACCTATTCAGTAATACACATTATCCACCAACATGCCTATCCAACTGTGTGCACACCCACCATCCATATTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAGCCATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCTATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTA
  3   1   2       bld Sto1                                 CABG2316.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCTAGTCAGTCAACCAGTCATTTCTTCATCCAAACACACACCAGCTTCTGGTTATCCAAAGACACACCCGTCCACAAAGAGATCTGTATGCACTTGACTACATCCATACCTAAGTTACCTATTCAGTAATACACATTATCCACCAACATGCCTATCCAACTGTGTGCACACCCACCATCCATATTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAGCCATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCTATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGGTGATAATTAAAGCAAACAATATTGC
  3   1   2       bld Lun1      in                         CABD2135.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACACCAGCTTCTGGTTATTCAAAGACACACCCGTCCACAAAGAGATCTGTATGCACTTGACTACATCCATACCTAAGTTACCTATTCAGTAATACACATTATCCACCAACATGCCTATCCAACTGTGTGCACACCCACCATCCATATTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAGCCATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCTATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTA
  3   1   2       bld Gas                             TGas094o05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGACACACCCGTCCACAAAGAGATCNGTANGCACTTNANTACATCCATACCTAAGTTACCTATTCAGTAATACACATTATCCACCAACATGCCTATCCAANNGNGTGCACACCCACCATCCATATTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAGCCATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCTATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATAAAAAAAAAAAAAAAAAA
  3   1   2       bld Fat1      in                         CABC6382.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGACACACCCGTCCACAAAGAGATCTGTATGCACTTGACTACATCCATACCTAAGTTACCTATTCAGTAATACACATTATCCACCAACATGCCTATCCAACTGTGTGCACACCCACCATCCATATTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAGCCATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCTATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAATGAATTCGCTTGTTTACAGTAAACAATGTAAGCTATGGGCATTTGCTTTTGCTAATAAAATATTAAAGC
  3   1   2      seed Spl1      out                        CABK5766.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGACACACCCGTCCACAAAGAGATCTGTATGCACTTGACTACATCCATACCTAAGTTACCTATTCAGTAATACACATTATCCACCAACATGCCTATCCAACTGTGTGCACACCCACCATCCATATTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAGCCATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCTATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAATGAATTCGCTTGTTTACAGTAAACAATGTAAGCTATGGGCATTTGCTTTTGCTAATAAAATATTTAAAGC
  5  -1   2       bld Ski1      out                        CABJ2050.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACACACCCGTNCACAAAGAGATCTGTATGCACTTGACTACATCCATACCTAAGTTACCTATTCAGTAATACACATTATCCACCAACATGCCTATCCAACTGTGTGCACACCCACCATCCATATTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAGCCATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCTATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAATGAATTCGCTTG
  3   1   2       bld Ova1      in                         CABE1067.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAGAGATCTGTATGCACTTGACTACATCCATACCTAAGTTACCTATTCAGTAATACACATTATCCACCAACATGCCTATCCAACTGTGTGCACACCCACCATCCATATTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAGCCATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCTATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAATGAATTCGCTTGTTTACAGTAAACAATGTAAGCTATGGGCATTTGCTTTTGCTAATAAAATATTTAAAGC
  3   1   2       bld Lun1      out                       CABD13806.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATCTGTATGCACTTGACTACATCCATACCTAAGTTACCTATTCAGTAATACACATTATCCACCAACATGCCTATCCAACTGTGTGCACACCCACCATCCATATTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAGCCATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCTATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAATGAATTCGCTTGTTTACAGTAAACAATGTAAGCTATGGGCATTTGCTTTTGCTAATAAAATATTTAAAGCAAAAAAAAA
  5  -1   2       bld Ovi1      in                         CABI4897.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATGCACTTGACTACATCCATACCTAAGTACCCTATTCAGTAATACACATTATCCANCAACATGCCTATCCAACTGTGTGCACACCCACCATCCATATTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAGCCATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCTATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAATGAATTCGCTTGTTTACAGTAAACAATGTAAGCTATGGGCATTTGCTTTTGCTAATAAAATATTTAAAGC
  3   1   2       bld Ova1      in                         CABE1948.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAACATGCCTATCCAACTGTGTGCACACCCACCATCCATATTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAGCCATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCTATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAATGAATTCGCTTGTTTACAGTAAACAATGTAAGCTATGGGCATTTGCTTTTGCTAATAAAATATTTAAAGCAG
  5   1   2       bld Ova1      in                         CABE1948.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAACATGCCTATCCAACTGTGTGCACACCCACCATCCATATTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAGCCATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCTATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAATGAATTCGCTTGTTTACAGTAAACAATGTAAGCTATGGGCATTTGCTTTTGCTAATAAAATATTTAAAGCAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ovi1      in                          CABI571.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACTGTGTGCACACCCACCATCCATATTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAGCCATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCTATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAATGAATTCGCTTGTTTACAGTAAACAATGTAAGCTATGGGCATTTGCTTTTGCTAATAAAATATTTAAAGC
  3   1   2       bld Tad5      in                         XZT18353.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCACCATCCATATTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAGCCATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCCATAAAGTACAATACCACTCGAACTGCTCACATCGGTTTGCTTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAATGAATTCGCTTGTTTACAGTAAACAATGTAAGCTATGGGCATTTGCTTTTGCTAATAAAATATTTAAAGC
  3   1   2       bld Egg       in                    TEgg040g09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAGCGATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCCATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTGTCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATACATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAATGAATTCGCTTGTTTACAGTAAACAATGTAAGCTATGGGCATTTGCTTTTGCTAATAAAATATTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  ?                     TEgg045h23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCCCAATAAACTGCTCTTGTGTATACACCACCAACCAGACTCTTCACACAGCCATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTATTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCTATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAATGAATTCGCTTGTTTACAGTAAACAATGTAAGCTATGGGCATTTGCTTTTGCTAATAAAATATTAAA
  3   1   2       bld Liv1      in                         CAAR5391.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TACACCACCAACCAGACTCTTCACACAGCCATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCTATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAATGAATTCGCTTGTTTACAGTAAACAATGTAAGCTATGGGCATTTGCTTTTGCTAATAAAATATTAAAGC
  3   1   2       bld Tad5 5g3  out                        XZT31947.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACACAGCCATTCCACAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTATTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCCATAAAGTACAATACCACTCGAACTGCTCACATCGGTTTGCTTCTTTAACATCTCAGTCACTGGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCCCCCTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTTTCTTCTGCCCTCTGTTTTGGGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGCCATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAAGGAATTCGCTTGTTTCCAGTAAACAATGTAAGCTAGGGGCATTTGCTTTTGCTAATAAAATATTTAAGGC
  3   1   2       bld Neu5      in                         ANHP2484.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCTATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAATGAATTCGCTTGTTTACAGTAAACAATGTAAGCTATGGGCATTTGCTTTTGCTAATAAAATATTTAAAGC
  3   1   2       bld Te4  5g3  out                         CAAN648.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATATGCCAAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCTATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAATGAATTCGCTTGTTTACAGTAAACAATGTAAGCTATGGGCATTTGCTTTTGCTAATAAAATATTTAAAGC
  3   1   2       bld Egg  FL   ?                     TEgg006j10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGACAGACATTTACACACATCCTGCCTCCAGAAAAGCCACCAACCCATGCAAAGCCAGCTACAAACACCTACAACTAACTACACATTCATTGAACCACCCAACAATCTGCAGAAATGCTCATCAAACCACACAAATTACTCTGCCAACACTCCCATGAATCAACACCCTGTTTAATTACTATCATCCATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTGTCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATACATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAATGAATTCGCTTGTTTACAGTAAACAATGTAAGCTATGGGCATTTGCTTTTGCTAATAAAATATTTAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas059f06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACACATTCATTGAACCACCCAACCAATCTGCAGAAATGCTCATCAAANCCACACAAATTATTCTGCCAACACTCCACATGAATCAACACCCTGTTTAATTACTATCATCTATAAAGTACAATACCACTCGAACTGCTCACATCTGTTTGCCTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAATGAATTCGCTTGTTTACAGTAAACAATGTAAGCTATGGGCATTTGCTTTTGCTAATAAAATATTAAAGCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7                                 XZG23029.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCGAACTGCTCACATCTGTTTGCTTCTTTAACATCTCAGTCACTTGAATCCATTTTTGAACTTTCATCTGCAAACTGCTATCCAACCACAAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGGGGCAGTTTTCGGTATAATAAACATTGTTTAATTATTTCACTTTATCATGGGCCATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAAGGAATTCGCTTGTTTACAGTAAACAATGTAAGCTATGGGCATTTGCTTTTGCTAATAAAATTTTTAAGGCaaaaaaaaaaaataaaaaaaaaaaaaaaaaaataaaaaaaaaaaaataaaaaaaaaaaaataaaaaaaaaaaaT
  3   1   2       bld Gas8      in                          st86k02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGTCACTTGAATNCANNTTGGAANTTTCATCTGCANACTGCTNTCCNACCACNAACACATCCTTTCCCAGTCACAAACATGCAACCTACCTAACCTATCTGCAAAAACAACCATACGCACACTGTAGAAAAACATAAATAAGCCAATCAAACATGCATATCAATGTATTTCTCTTCTGCCCTCTGTTTTGTGGCAGTTTTCTGTATAATAAACATTGTTTAATTATTTCACTTTATCATGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTNTAAAATTATTTGAAATGAATTCGCTTGTT
  5   1   2       bld TbA                            TTbA023c17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAGTTTTCTGTATAATAAACATCGTTTAATTATTTCACTTTATCACGTGACATTAAAAAAGTGATAATTAAAGCAAACAATATCGCAACCGTCGTCGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTCGAAATGAATTCGCTTGTTTACAGTAAACAATGTAAGCTATGAGGCATTTCGCTTTTCGCTAATAAAATA
  5   1   2       bld BrSp                            EC0CBA003CC07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCAAACAATATTGCAACTGTTGTTGCTGCAATTTCCAGGTAGATTTAATATGCAATTTCTAAAATTATTTGAAATGAATTCGCTTGTTTACAGTAAACAATGTAAGCTATGGGCATTTGCTTTTGCTAATAAAATATTTAAAGCAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)