Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 28 Feb 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TNeu087j08.3                          5 END     1           1       20                unknown [Xenopus laevis]

 This cluster: approximate FL confidence score = 87%

 1012074329 Xt7.1-CABK882.5 - 58 ESTs
                                                                       .-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                       Xt7.1-CABK882.5                                                                                                                                                                                                                              GAGCTGGACTCAGACCTGCCCTCCCATCCCCTGCTACTGTCACCTCCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCCGCAGCCTTTGCTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCAGTGACCTTGTATTTACTTCTGAGAGTAACAGGCCGAGAGACTATAGTCACAGAGAGACAGTTTTTATTTGATTGTAGTAATGGACAGTGCGGTACTTCACAGGTGGCTGCCATGTATATTACCTACAATTATTCTTTTTTTTTTTTTTTTGACCTGACTACAATAAACTGGAAACTGCAAGTCACATGACTTGTGCTTCTTTTTTAATTTTTGGTTTGTTCTGAAATATATCTGCCATGTGTATGCCACTTACACCATGCAGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAACCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCACGGCATTCTTTGCCTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAATCAAAAAGAAAATCTATTCTGAGAATAAAAACATTGAAACACAAGCTGATAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008225079                                                                                                                                                                                                                                    GACTCAGACCTGCCCTCCCATCCCCTGCTACTGTCACCTCCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCCGCAGCCTTTGCTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCAGTGACCTTGTATTTACTTCTGAGAGTAACAGGCCGAGAGACTATAGTCACAGAGAGACAGTTTTTATTTGATTGTAGTAATGGACAGTGCGGTACTTCACAGGTGGCTGCCATGTATATTACCTACAATTATTCTTTTTTTTTTTTTTTTxxCxxGACTACAATAAACTGGAAACTGCAAGTCACATGACTTGTGCTTCTTTTTTAATTTTTGGTTTGTTCTGAAATATATCTGCCATGTGTATGCCACTTACACCATGCAGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAACCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCACGGCATTCTTTGCCTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAATCAAAAAGAAAATCTATTCTGAGAATAAAAACATTGAAACACAAGCTxAxAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                   5     7     9    10    10    13    14    16    15    17    16    19    17    20    17    20    18    22    22    23    23    24    24    26    24    26    25    27    25    27    25    27    24    27    25    27    25    27    25    26    25    26    25    26    25    26    25    26    25    26    25    26    26    27    26    27    26    27    24    27    24    27    24    27    24    27    24    27    24    27    24    27    24    27    24    27    25    28    25    28    23    27    25    27    25    27    25    27    24    26    24    26    23    26    24    26    24    26    24    26    21    26    21    25    23    27    22    25    23    24    22    24    21    23    21    23    20    23    20    22    19    20    18    19    17    18    15    16    14    15    14    15    14    15    14    16    14    17    14    18    14    18    13    18    15    19     7    18     6    17     7    15     7    16     7    16     7    17     9    17    10    18    10    19    13    20    15    22    16    24    16    23    17    24    19    24    20    25    19    25    20    25    20    25    20    25    20    25    20    25    19    24    19    24    19    24    19    24    19    25    19    25    19    25    19    25    19    25    19    25    22    25    22    25    21    24    21    24    21    24    23    25    22    24    22    24    22    24    23    24    23    24    23    24    23    23    20    21    20    21    21    21    19    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    20    21    21    21    21    21    20    20    20    20    18    20    18    20    16    20    16    20    13    17     7    15     3     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                          AG----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --------T---
                                               BLH ATG     124     407                                                                                                                                                                                                                              
                                               BLH MIN     124      63                                                                                                                                                                                                                              
                                               EST CLI      -6       5                                                                                                                                                                                                                              
                                                                       PROTEIN --- Ce ---- 2e-011     NP_001023759.1 DC2.3b [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                  PREDICTED - Sp ---- 6e-017     XP_781871.1 PREDICTED: similar to Galectin-8 (30 kDa S-type lectin) (RL-30) [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Dr ---- 6e-050     NP_001038765.1 hypothetical protein LOC723995 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Hs ==== 4e-072     NP_054900.1 hypothetical protein LOC29094 [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Mm ==== 2e-072     NP_776113.1 RIKEN cDNA 1110067D22 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Gg ==== 1e-073     NP_001008456.1 similar to RIKEN cDNA 1110067D22 [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xl ==== 6e-092     AAH79769.1 Unknown (protein for MGC:86236) [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = ?? ==== 6e-092     NP_001090244.1 hypothetical protein LOC779149 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Xt ==== 9e-096     AAH68036.1 Hypothetical protein MGC76272 [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-CABK882.5                                                                                                                                                                                                                                                                                                                                                          ATG---------------------------------ATG---------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATGA------------------------------------------------------------------------------------------TGA---------------TGA---TAA---------------TAG---------------------------------ATG------------------------------------------------------------------TGA------------TAA------------------------------------------------------------------------------------------ATG------ATG---------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------TAA---------------TAA------------------------------------------TAA---------------------------TAG------------------------------------------TAG---------------------------------------------------TGA---TAG---------------------------------------------------------------------------------------ATG------------------------------------TGA---TAA------TAA---------------------TAG---------ATGATG------------------------------------------------------------------------------------------TAA------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   1           Tbd0 FL                     IMAGE:5379255.FL-MGC                                                                                                                                                                                                                                                          CCCTGCTGCTGTCACCTCCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCCGCAGCCTTTGCTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCAGTGACCTTGTATTTACTTCTGAGAGTAACAGGCCGAGAGACTATAGTCACAGAGAGACAGTTTTTATTTGATTGTAGTAATGGACAGTGCGGTACTTCACAGGTGGCTGCCATGTATATTACCTACAATTATTCTTTTTTTTTTTTTTTTTGACCTGGACTACAATAAACTGGAAACTGCAAGTCACATGACTTGTGCTTCTTTTTTTAATTTTTGGTTTGTTCTGAAATATATCTGCCATGTGTATGCCACTTACACCATGCAGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAATCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCACGGCATTCTTTGCCTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAATCAAAAAGAAAATCTATTCTGAGAATAAAAACATTGAAACACAAGCTGATAAAGACAATAATGGAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Neu  FL                     TNeu102b22.FL-Sanger                                                                                                                                                                                                                                                                                                                               CTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCAGTGACCTTGTATTTACTTCTGAGAGTAACAGGCCGAGAGACTATAGTCACAGAGAGACAGTTTTTATTTGATTGTAGTAATGGACAGTGCGGTACTTCACAGGTGGCTGCCATGTATATTACCTACAATTATTCTTTTTTTTTTTTTTTTGACCTGGACTACAATAAACTGGAAACTGCAAGTCACATGACTTGTGCTTCTTTTTTAATTTTTGGTTTGTTCTGAAATATATCTGCCATGTGTATGCCACTTACACCATGCAGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAACCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCACGGCATTCTTTGCCTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAATCAAAAAGAAAATCTATTCTGAGAATAAAAACATTGAAACACAAGCTGATAAAGACAATAATGGAAAAAAAAAAAAAAAAAA
  5   1   2       chi Neu                            TNeu021p13.p1kSP6                                     ataaactatatatacaaacattaatactaactgtagatattagtatcacaatagccttggatattctgatggttcaagaactcatccaggcccctcttaaaggcattaacagaatctgccattactacatctctaggaagggcattccccaacctcactgccctcaacgtgaggaaccccctttgctgcttcaaatggaagctccgttcctctaatctaaaggggAAGAAAAGAACACCCCCCATCTGCCTATAATCCCCTCTACTAGCCAGACTGACCTTGCTGTTATGCTGTTGAAATGCAGTTCATTCAATAGCACACACATGAATACTTTGCTTTCTGGATGTAAATAGCATGGAACTTGTCTGGTATATCTTTCTTGGTTGAATGAATCAAACCTGTGTTTTATTTCAGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGG
  5   1   2       bld Gas1 5x3                           IMAGE:6988007                                                                                                                                                                                                      GGTCCGGAATTTCCGGGATCGGCTGAGCTGGACTCAGACCTGCCCTCCCATCCCCTGCTACTGTCACCTCCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCCGCAGCCTTTGCTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCATGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAAATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGAATTTTATCATCGCGTCCAGACACTTTCAGCCATTAACACGATTAAAAATTAACGGGTGACCTTCAACTGGACCCAACTTGGGTTGAATGACTGCGCATGTTTCCTGGTGCCCCCCGATGGGACTTAGTTTCAACTTGCCAACCATGGCAAGGGTCCACCAAAGCCGCGCCAGTTCTCTTTTCTGGCCAAGAAACCTCCGAGGGACACTTGGTATTTTACCTCCAGGAGAATTAAACTGGGCCCTAAAAGACTAATAACCACCAGAAAGGCCAGGATTTTTATTTTGGATTTGAAGATTAATGGAATGAGTGGCGGAACCTTTTCAAAGGGTAGCAATGATATGCGAAAACTCACATCCACCATGTCATGGCTCATTTTTCTTTGTTAGTCCGCATAAGAAATATACATTAGCAGACCAGTGAAATTAGACCAATTACCTCTAAATTTGATTTTACATCATTAATAGTAATATTAGGGGTGTTCTTCCCTCATCATTC
  5   1   2   30  bld Limb 5x3  ?                         CBSU5713.fwd .............................................................................................................................................................................................................GTTCTGTGCGCCGGCTGAGCTGGACTCAGACCTGCCCTCCCATCCCCTGCTGCTGTCACCTCCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCCGCAGCCTTTGCTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAATGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCCACTCTTCTCGCTTTATTCCGCTTAAGTAATCATCTGATGGTGTAAATAAAGGATTTT
  5   1   2   34  bld Brn4 5g                             CAAL10276.5p .....................................................................................................................................................................................................................CGCCGGCTGAGCTGGACTCAGACCTGCCCTCCCATCCCCTGCTACTGTCACCTCCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCCGCAGCCTTTGCTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCAGTGACCTTGTATTTACTTCTGAGAGTAACAGGCCGAGAGACTATAGTCACAGAGAGACAGTTTTTATTTGATTGTAGTAATGGACAGTGCGGTACTTCACAGGTGGCTGCCATGTATATTACCCTACAATTATCTTTTTTTTTTTTTTTTGACCTGGAC
  5   1   2       bld Gas  5g3  in                   TGas122i21.p1kSP6                                                                                                                                                                                                                        CCGGCTGAGCTGGACTCAGACCTGCCCTCCCATCCCCTGCTACTGTCACCTCCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCCGCAGCCTTTGCTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCATGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGGTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAAC
  5   1   2   10  bld Spl1 5g3  in                          CABK882.5p ........................................................................................................................................................................................................................ATCCATCGATTCGCTCAGACCTGCCCTCCCATCCCCTGCTACTGTCACCTCCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCCGCAGCCTTTGCTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCAGTGACCTTGTATTTACTTCTGAGAGTAACAGGCCGAGAGACTATAGTCACAGAGAGACAGTTTTTATTTGATTGTAGTAATGGACAGTGCGGTACTTCACAGGTGGCTGCCATGTATATTACCTACAATTATTCTTTTTTTTTTTTTTTGACTGNACTACAATAAACTGGAAAACTGCAGTCACATGACTTGTGCCT
  5   1   2       bld Neu  5g                        TNeu080a07.p1cSP6                                                                                                                                                                                                                            CTGAGCTGGACTCAGACCTGCCCTCCCATCCCCTGCTACTGTCACCTCCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCCGCAGCCTTTGCTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAAGATCAGCAATACCTTATTTCCCCTTCATTGCAGATC
  5   1   2       bld Neu  5g                        TNeu050i18.p1kSP6                                                                                                                                                                                                                               AGCTGGACTCAGACCTGCCCTCCCATCCCCTGCTACTGTCACCTCCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCCGCAGCCTTTGCTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCT
  5   1   2       bld Neu  5g                        TNeu126g21.p1cSP6                                                                                                                                                                                                                                   GGACTCAGACCTGCCCTCCCATCCCCTGCTGCTGGCACCTCCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCCGCAGCCTTTGCTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTGCAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCGTGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTGAACCTGGAGCCAAAGAGTTTTGACATCAGGTGGACATGCGGGGACTCAAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAAGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCACTGTTTGATTTTTATCATCGCGTCGAGACACTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTG
  5   1   2       bld 1030 5g                         IMAGE:7091697.5p                                                                                                                                                                                                                                         TGACCTGCCCTCCCATCCCCTGCTACTGTCACCTCCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCCGCAGCCTTTGCTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCATATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATAACGGTGACCTACACTGACCAAACTTGGTTGATGACTGCAATGTT
  5   1   2       bld Neu  5g3  in                   TNeu134e02.p1cSP6                                                                                                                                                                                                                                            CTGCCCTCCCATCCCCTGCTGGTGGGGCCTGCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCCGCAGCCTTTGCTTATCCGTGCTAGGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCGGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTGCGCGGTGCAAGCTGAGGTGTATTTTCCACGACTGA
  5   1   2   12  bld Tad5 5g3  in                         XZT56733.5p ...................................................................................................................................................................................................................................................CCCAACCCCTGCTACTGTCACCTCCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCCGCAGCCTTTGCTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCAGTGACCTTGTATTTACTTCTGAGAGTAA
  5   1   2       bld Gas  5g                        TGas112d20.p1kSP6                                                                                                                                                                                                                                                     CCATCCCCTGCTACTGTCACCTCCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCCGCAGCCTTTGCTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGC
  5   1   2       bld Neu  5g3  in                   TNeu101a18.p1cSP6                                                                                                                                                                                                                                                              GCTACTGTCACCTCCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCCGCAGCCTTTGCTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGC
  5   1   2       bld Tbd0 FL   ?                     IMAGE:5379255.y1                                                                                                                                                                                                                                                                 GCTGTCACCTCCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCCGCAGCCTTTGCTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAAC
  5   1   2   10  bld Spl2 5g3  in                        CBSS7520.fwd .................................................................................................................................................................................................................................................................CTGTCACCTCCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCCGCAGCCTTTGCTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCAGTGACCTTGTATTTACTTCTGAGAGTAACAGGCCGAGAGACTATAGT
  5   1   2   10 seed Ski1 5g3  in                         CABJ3257.5p ..........................................................................................................................................................................................................................................................................CCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCCGCAGCCTTTGCTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCAGTGACCTTGTATTTACTTCTGAGAGTAACAGGCCGAGAGACTATAGTCACAGAGAGACAGTTTTTATTTGATTGTAGTAATGGACAGTGCGGTACTTCACAGGTGGCTGCCATGTATATTACCTACAATTATTCTTTTTTTTTTTTTT
  5   1   2   10  bld Ski1 5g3  in                        CABJ10234.5p ..............................................................................................................................................................................................................................................................................CTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCCGCAGCCTTTGCTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCAGTGACCTTGTATTTACTTCTGAGAGTAACAGGCCGAGAGACTATAGTCACAGAGAGACAGTTTTTATTTGATTGTAGTAATGGACAGTGCGGTACTTCACAGGTGGCTGCCATGTATATTACCTACAATTATTCTTTTTTTTTTTTTTTTGACCTGGACTACAATAAACTGGAAACT
  5   1   2       bld BrSp 5g3  in                    EC0CBA005DD01.g1                                                                                                                                                                                                                                                                                    GGaagcagtggtatctacgcagagtgtccattatggccgggGGCTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAATGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGGTCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATA
  5   1   2       bld Gas8 5x3                              st96k24.5p                                                                                                                                                                                                                                                                                           CGGGCTCCGCTGATCCGGTGCCCCCCGCAGCCTTTGCTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCAGTGACCTTGTATTTACTTCTGAGAG
  5   1   2       bld Neu  5x3  out                  TNeu078k07.p1cSP6                                                                                                                                                                                                                                                                                                                           GCTTATCACGTGCCTAGGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCA
  5   1   2       bld Neu  FL   in                   TNeu102b22.p1cSP6                                                                                                                                                                                                                                                                                                                              CTTATCCGTGCTAGGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTGACCAAGCAGCGCAGTTCCTTCTGCCAGCAAC
  5   1   2       bld Neu  5x3  in                   TNeu117h14.p1cSP6                                                                                                                                                                                                                                                                                                                               CTTATCCGTGCTAGGCTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCGTGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAAGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCACTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACT
  5   1   2   10  bld Tbd1 5g3  in                        CBXT17577.b1 .............................................................................................................................................................................................................................................................................................................................................CTTCGCTACAAGATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCATGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCAGTGACCTTGTATTTACTTCTGAGAGTAACAGGCCGAGAGACTATAGTCACAGAGAGACAGTTTTTATTTGATTGTAGTAATGGACAGTGCGGTACTTCACAGGTGGCTGCCATGTATATTACCTACAATTATTCTTTTTTTTTTTTTTTTTGACCTGGACTACAATAAACTGGAAACTGCAAGTCAAA
  5   1   2       bld Neu       in                   TNeu060c09.p1cSP6                                                                                                                                                                                                                                                                                                                                                             GCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCAGTGACCTTGTATTTACT
  5  -1   2       chi Hrt1                                 CAAQ3056.5p                                                                                                                                                                                                                                                                                                                                                              CACACGCGTGTATTCATACATGCTTACTATTTTTTCTTCATTTCCTCTGTGTGCTTTGTACATAATACTTACTAGAAACCCACTGCTGTCCGACTCGCTGAACTGATACTTTGTTTGCTTTGCGCTAGCTACATCACTAAACCAATCCTGTATTTCAACTTTTTCTCCTTACCTCTCGATACCATTTTGGCAGGCTAGTGCCACTCTGTGCTTTGTCTGCTACTATATATAAGTTACAGGATATTTATGTCTTTTGTGTATTATAAGAAATATATAGAATTGTAACCAGCAGGTTATAATAATGTAGTGGAATTTTTATAGGGTTTAAGAAAAAAATCTGATTTTCCTTTTTGTATTTCTTGTTGCAGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCAGTGACCTTGTATTTACTTCTGAGAGTAACAGGCCGAGAGACTATAGTCACAGAGAGACAGTTTTTATTTGATTGTAGTAATGGACAGTGCGGTACTTCACAGGTGGCTGCCATGTATATTACCTACAATTATTCTTTTTTTTTTTTTTTTTGACCTGGACTACAATAA
  5   1   2       bld Tbd0      in                       IMAGE:6977571                                                                                                                                                                                                                                                                                                                                                                                         TGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCATGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCAGTGACCTTGTATTTACTTCTGAGAGTAACAGGCCGAGAGACTATAGTCACAGAGAGACAGTTTTTATTTGATTGTAGTAATGGACAGTGCGGTACTTCACAGGTGGCTGCCATGTATATTACCTACAATTATTCTTTTTTTTTTTTTTTTGACCTGGACTACCATAAACCTGGAAACTGCAAGTCACATGACTTGTGCTTCCTTTTTTAATTTTTGGGTTTGGTCCGGAAATATAATCGGCCCTGGTGTATGCCCACTTAACACCATGGCAGCCCCATGAATTGGAAAA
  5   1   2       bld Gas                            TGas040l09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGGAGCCAAANAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCAGTGACCTTGTATTTACTTCTGAGAGTAACAGGCCGAGAGACTATAGTCACAGAGAGACAGTTTTTATTTGATTGTAGTAATGGACAGTGCGGTACTTCACAGGTGGCTGCCATGTATATTACCTACAATTATTCTTTTTTTTTTTTTTTTGACCTGGACTACAATAAACTGGAAACTGCAAGTCACATGACTTGTGCTTCTTTTTT
  5   1   2       bld HdA                            THdA021l16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAGTGGGGAGAAGAAGAATCAGCAATACTTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCAGTGACCTTGTATTTACTTCTGAGAGTAACAGGCCGAGAGACTATAGTCACAGAGAGACAGTTTTTATTTGATTGTAGTAATGGACAGTGCGGTACTTCACAGGTGGCTGCCATGTATATTACCTACAATTATTCTTTTTTTTTTTTTTTTGACCTGGACTACAATAAACTGGAAACTGCAAGTCACATGACTTGTGCTTCTTTTTTAATTTTTGGTTTGTTCTGAAATATATCTGCCATGTGTATGCCACTTACACCATGCAGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAATCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAACATTG
  5   1   2       bld TpA       in                   TTpA003l18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCAGTGACCTTGTATTTACTTCTGAGAGTAACAGGCCGAGAGACTATAGTCACAGAGAGACAGTTTTTATTTGATTGTAGTAATGGACAGTGCGGTACTTCACAGGTGGCTGCCATGTATATTACCTACAATTATTCTTTTTTTTTTTTTTTGACCTGGACTACAATAAACTGGAAACTGCAAGTCACATGACTTGTGCTTCTTTTTTAATTTTTGGTTTGTTCTGAAATATATCTGCCATGTGTATGCCACTTACACCATGCAGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAACCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGT
  5   1   2       bld Neu       in                   TNeu063e08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCAGTGACCTTGTATTTACTTCTGAGAGTAACAGGCCGAGAGACTATAGTCACAGAGAGACAGTGTTTATTTGATTGTAGTAATGGACAGTGCGGTACTTCACAGGTGGCTGCCATGTATATTACCTACAATTATTCTTTTTTTTTTTTTTTGACCTGGACTACAATAAACTGGAAACTGCAAGTCACATGACTTGTGCTTCTTTTTTAATTTTTGGTTTGGTCTGAAATATATCTGCCATGTGTATGCCACTTACACCATGCAGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATA
  3   1   2       bld Tbd1 5g3  in                        CBXT17577.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACCTACAACTGACCAAACTTGGTTGATGACTGGGATGTTCCTGTGCCCCCAGTGGATTAGTTCAACTGCAACCATGCAAGGTCCCCAAGCAGCGCAGTTCCTTTTGCCAGCAACCCCAGTGACCTTGTATTTATTTTTGAGAGTAACAGGCCGAGAGACTATAGTCACAGAGAGACAGTTTTTATTTGATTGTAGTAATGGACAGTGCGGTACTTCACAGGGGGCTCCCATGTATATTACCTACAATTATTTTTTTTTTTTTTTTTTTGCCCTGGACTACAATAAACTGGAAACTGCAAGTCAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAA
  5   1   2       bld Neu                            TNeu024j22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTACAACTGACCAAACTTGGTTGATGACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCAGTGACCTTGTATTTACTTCTGAGAGTAACAGGCCGAGAGACTATAGTCACAGAGAGACAGTTTTTATTTGATTGTAGTAATGGACAGTGCGGTACTTCACAGGTGGCTGCCATGTATATTACCTACAATTATTCTTTTTTTTTTTTTTTTGACCTGGACTACAATAAACTGGAAACTGCAAGTCACATGACTTGTGCTTCTTTTTTAATTTTTGGTTTGTTCTGAAATATATCTGCCATGTGTATGCCACTTACACCATGCAGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGC
  5   1   2       bld Tbd1      in                         CBXT4628.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACTGCGATGTTCCTGTGCCACCAGTGGACTAGTTCAACTGCAACCATGCAAGGTCACCAAGCAGCGCAGTTCCTTCTGCCAGCAACCCCAGTGACCTTGTATTTACTTCTGAGAGTAACAGGCCGAGAGACTATAGTCACAGAGAGACAGTTTTTATTTGATTGTAGTAATGGACAGTGCGGTACTTCACAGGTGGCTGCCATGTATATTACCTACAATTATTCTTTTTTTTTTTTTTTGACCTGGACTACAATAAACTGGAAACTGCAAGTCACATGACTTGTGCTTCTTTTTTAATTTTTGGTTTGTTCTGAAATATATCTGCCATGTGTATGCCACTTACACCATGCAGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAATCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGT
  3   1   2       bld Ski1 5g3  in                        CABJ10234.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTTGATGNTAGTAATGGACAGTGCGGTACTTCACAGGTGGCTGCCATGTATATTACCTACAATTATTCTTTTTTTTTTTTTTTTGACCTGGACTACAATAAACTGGAAACTGCAAGTCACATGACTTGTGCTTCTTTTTTAATTTTTGGTTTGTTCTGAAATATATCTGCCATGTGTATGCCACTTACACCATGCAGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAACCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCACGGCATTCTTTGCCTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTT
  5   1   2       bld Neu       in                   TNeu103o08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGACAGTGCGGTACTTCACAGGTGGCTGCCATGTATATTACCTACAATTATTCCTTTTTTTTTTTTTTTGACCTGGACTACAATAAACTGGAAACTGCAAGTCACATGACTTGTGCTTCTTTTTTAATTTTTGGTTTGTTCTGAAATATATCTGCCATGTGTATGCCACTTACACCATGCAGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAACCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGAT
  5   1   2       bld Gas                            TGas021e22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCGGTACTTCACAGGTGGCTGCCATGTATATTACCTACAATTATTCTTTTTTTTTTTTTTTTGACCTGGACTACAATAAACTGGAAACTGCAAGTCACATGACTTGTGCTTCTTTTTTAATTTTTGGTTTGTTCTGAAATATATCTGCCATGTGTATGCCACTTACACCATGCAGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAACCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTA
  3   1   2       bld Tbd0      in                       IMAGE:6977571                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTGGGAAAGTTCCACAATGAGACCCTGGGGGTTTTTTTTTTTTAAATTTAAAGGAAGGGGTTTGGGGTAGNAAAATCAACCCCACGGGAAAAGCCAACTTACCTCCCTGGCTGCCAATTGAATGGGAAGGAGATTTTCAATTTGTATGCCCTCTTCATAGATTAGGATTTGACAGCCAAGCAGGTTTCCTTTTTTTTGTAAATTACGTGGGGTTTAAGCATGCAGCAAGTTACATTTATTTTTTTGACATGGGGGGGAAAAAGAATGCTACTTTAATACTATTATTTCACAAGGCCAATAGATCGTGCTCTTGGGAGCAGTGGGCATGCAGTGCGGCAAAAAAGGTTAATATATAATCATTTGTTAACAAAGTGCTAAAATAACATCCAAACAAAACCACTTTTTTTGTAAAAACATTGTTTCTGCATCGATGTGTACTAGCTTCGCACAACAATATATTTATATTTGGTCGGGGTATTAGCATAGAATGTGGAGTATGTTTATTTGCATCCGAGTATAGTTGACACTTATACGAGCTTTGATGGTAGTTTATTTATATATTGTATGTAGCAATAGAACAATCCACGGCATTCTTTGCCTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTTATCTTTGTCACATCTCATGAAATTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAATCAAAAGGAGAATCTTTCTGGGAACTTGCAGTTTCC
  3   1   2       bld Gas  5x3  ?                     TGas094b06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAAGTCACATGACTTGTGCTTCTTTTTTAATTTTTGGTTTGTTCTGAAATATATCTGCCATGTGTATGCCACTTTACANCCCATGCAGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAACCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCACGGCATTCTTTGCCTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAATCAAAAAGAAGATCTATTCTGAGAATAAAAACATGAAACACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu  5x3  in                    TNeu117h14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAAGTCACATGACTTGTGCTTCTTTTTTAATTTTTGGTTTGTTCTGAAATATATCTGCCATGTGTATGCCACTTACACCATGCAGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAACCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCACGGCATTCTTTGCCTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAATCAAAAAGAAAATCTATTCTGAGAATAAAAACATGAAACACAAGCTGATAAAGACAATAATGGAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       out                   TNeu078i05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGACTTGTGCTTCTTTTTTAATTTTTGGTTTGTTCTGAAATATATCTGCCATGTGTATGCCACTTACACCCATGCAGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAACCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCACGGCATTCTTTGCCTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAATCAAAAAGAAAATCTATTCTGAGAATAAAAACATTGAAACACAAGCTGATAAAGACAATAATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu063e08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTCTTTTTTAATTTTTGGTTTGTTCTGAAATATATCTGCCATGTGTATGCCACTTACACCCATGCAGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAACCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTTTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTGGATGGTAGTTTATTTATCTATTGTAGGTAGCAATAGAACAATCCACGGCATTCTTTGCTTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAATCAAAAAGAAAATCTATTCTGAGAATAAAAACATGAAACACAAAAAAAAAAAAAAAAA
  5  -1   2       bld Gas1                               IMAGE:6990683                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCTGTTGTATTTATNGATTGTTCTGAAATATATCTGCCATGTGTATGCCACTTACACCATGCAGCCAATGAATGAAAGAGATGTCAGTTGTATGCCTTTCATTGATTGGTCTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTCTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAATCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCACGGCATTCTTTGCCTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGGATTCCAAAAATCAAAAAGAAAATGCGTTCCAGTATGACGGGN
  3   1   2       bld Spl1 5g3  in                          CABK882.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTTGTTCTGAAATATATCTGCCATGTGTATGCCACTTACACCATGCAGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAACCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCACGGCATTCTTTGCCTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAATCAAAAAGAAAATCTATTCTGAGAATAAAAACATTGAAACACAAGCTGATAAAGAC
  3   1   2       bld Ski1 5g3  in                         CABJ3257.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAAATATATCTGCCATGTGTATGCCACTTACACCATGCAGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAACCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCACGGCATTCTTTGCCTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAATCAAAAAGAAAATCTATTCTGAGAATAAAAACATTGAAACAC
  3   1   2       bld Tad5 5g3  in                         XZT56733.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTGTATGCCACTTACACCATGCAGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAACCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCACGGCATTCTTTGCCTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAATCAAAAAGAAAATCTATTCTGAGAATAAAAACATTGAAACACAAGCTGATAAAGACAATAATGGAAGCTGT
  3   1   2       bld Gas  5g3  in                   TGas122i21.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TATGCCACTTACACCATGCAGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAATCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCACGGCATTCTTTGCCTTTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAATCAAAAAGAAAATCTATTCTGAGAATAAAAACATTGAAACACAAGCTGATAAAGACAATAATGGAAGCGTAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu103o08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTGGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGTTTTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAACCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTTTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTTTTTGCACTGTGTATTGTTGACACTTATACCGCTTGGAGGGTAGTTTATTTATTTATTGTAGGTAGCAATAGAACAATCCACGGCATTTTTTGCTTTTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTGGGGTCAGCGTTCATCCTTGTCACATTTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAAGGACTCCCAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAATTCAGACAGGATTCCAAAAATCAAAAAGAAAATTTATTTTGAGAATAAAAACCTTTGACCCCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu  FL   in                    TNeu102b22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCCAATGAATGAAAGAGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAACCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCACGGCATTCTTTGCCTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAATCAAAAAGAAAATCTATTCTGAGAATAAAAACATTGAAACACAAGCTGATAAAGACAATAAGGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu  5g3  in                    TNeu134e02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAAAGAGATTCAGTTGTAGCCTTTCATTGATTGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTTCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAACCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCACGGCATTCTTTGCCTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAATCAAAAAGAAAATCTATTCTGAGAATAAAAACATTGAAACACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                         CBXT4628.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGATTTCAGTTGTATGCCTTTCATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAATCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCACGGCATTCTTTGCCTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAATCAAAAAGAAAATCTATTCTGAGAATAAAAACATTGAAACACAAGCTGATAAAGACAATAAAAAAAAAAAAAAA
  3   1   2       bld Spl2 5g3  in                        CBSS7520.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTGATTGGTTTGACAGTAGCAGTTTCCTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAACCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCACGGCATTCTTTGCCTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAATCAAAAAGAAAATCTATTCTGAGAATAAAAACATTGAAACAC
  3   1   2       bld TpA       in                    TTpA003l18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTAGCAGTTTCCTTTTTTTTNTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAACCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAANAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCACGGCATTCTTTGCCTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAATCAAAAAGAAAATCTATTCTGAGAATAAAACCATTGAAACACAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                    EC0CBA005DD01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTCCTTTTTTTTTCTAATTTCCTTGGTTTTAGCATGTAGCAAGTACATATATTTTTTGGCAATGGGGGGAAAAGACTGCTACTTTAATACTATTATATCACAAGGCCCTTACATCGTGCTCTTGGGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAATCATTTTTTAACAAAGTGCTAAAATAACATCCAAACAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCCCGGCATTCTTTGCCTCTGAGATAAAGTCTGTAACCATTTTGAATGTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu060c09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAGCAGTGGGCCTGCAGTGTGGCAAAAAAGGTTAATATATAACCATTTTTTAACAAAGTGCTAAAATAACATNCCAAACAAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATATNATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCACGGCATTCTTTGCCTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAATCAAAAAGAAAATCTATTCTGAGAATAAAAACATTGAAACACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu  5g3  in                    TNeu101a18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGTGTGGCAAAAAAGGTTAATATATAATCATTTTTTAACAAAGTGCTAAAAATAACATTCCAAACCAAAAAACACTTTTTTTTGTAAAAACATTGTTTCTGCACTGAAGTGTACTAGCCTAGCACAACAATAATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCACGGCATTCTTTGCTTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAATCAAAAAGAAAATCTATTCTGAGAATAAAAACATTGAAACACAAGCTGATAAAGACAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tad5                                 XZT59390.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAATATATTTATATTTAGTCAGGGTATTTGCATAGAATGTAGAGTATGTTTCTTTGCACTGTGTATTGTTGACACTTATACCGCTTTGATGGTAGTTTATTTATCTATTGTACGTAGCAATAGAACAATCCACGGCATTCTTTGCCTCTGAGATAAAGTCTGTAACCATTTTGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGTAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGTAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAATCAAAAAGAAAATCTATTCTGAGAATAAAAACATTGAAACACNNaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaannaaaa
  5   1   2       bld Gas                            TGas012b11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAATGTACGAATGTGCTTTTGGGTCAGCGTTCATCCTTGTCACATCTCATGAACTTAAGGTATTTAATGCAGGTTTTTTCACACTAGTTAGCTAGACAGGATGATGCCGGGTAATGAATGTGATTTTCATGCTTTTTACATTTTTTGCAATGACTCACAAGTATTAAGACAATTCTGCCATTTTTTTGTAATTTGTTAAGAACTCAGACAGTGATTCCAAAAACAAAAAAAAATTATCCGAGAATAAAAACATTGAAACAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)