Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABI6906.5                           18 END     1           2        5                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012074330 Xt7.1-CABD6323.3.5 - 50 ESTs
                                                                       .....-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABD6323.3.5                          TTGACCTACTAACACAGATCTGTAGAGCAGCAGCAGCAGGCTGCAGACTGGAGCGGGCAGAGACACTGATACACGCACGCATGCACACACGTACACACATAAGCACTGCACAGGAGGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCCCAAGAAATACAAAAGGTCACAACCTCCACTGCAATGTATTTTCAGGAATACTCATCTTCCAAACCAAATGTAATGTCGTATAACAGTGATCATGAACATTCTGTAATGACCAGCAGTTGTATTTCAGTTATCAAGCACTCCCCACAAAGCTCTCTGTCTGATGTGTCTGAGGCATCATCCGTGGAGCATGTTCAGCCGAGCACTGTCCAGAGCAACTGCAGAAGTACTGATATAAACTTCCAAAGAATTAAACAGGAACCTATGGAAAGGGAGAACTTTTCTAGAGATGCCAGAGAAGACAGTAACACTTTCCAAGGCTCTATATATACCAATTATATTGGAAACACATTTTCTGGGTATTCACATTCTCCTCCACTTCTTCACATAAACAGATCGTCGAGTAACTCTCCGAGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTGAAAAATATGTGCCTCGGGTTTGTATTAGAAATTTATTAGACACAAATAATAATGTTTGCGCTTTGGGATCCGCAACTATATTGCCAATGTTCTTCTTTACATCAGACTCCAGCATCAACTATGAAAGAAGCTGATAGAAACATGTTAATGTAATGACCCCATTACTAATGCAATTATTGTCATTGTTATCATCAGAAACTTATATTCAAGTAAGAGCTTAATAGCTCCCAGACCAATACCTTTTGTAGCTTGAGACCAGGTATTCAAGTCACCCCAAATCCCCATCCCCTAGGGCAGCTCCATGAATGCCAGTGTTCAGGCTCTTTCAAAGAGCTGTCACTCAGATATGTGGCTATTGCCCATGTGGGCATGGCGGACACATGTGGAGGCTCATTTATCAAAATTCAAACTTTTGTACTTTTTGTGGACTGCTCTCCCATGAAAAAACTCAGAAATTAAAAAAGCACGAATGTTGACTTATTTATTTAAAG
                                                  Xt7.1-CHK-1008225758                                TACTAACACAGATCTGTAGAGCAGCAGCAGCAGGCTGCAGACTGGAGCGGGCAGAGACACTGATACACGCACGCATGCACACACGTACACACATAAGCACTGCACAGGAGGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCCCAAGAAATACAAAAGGTCACAACCTCCACTGCAATGTATTTTCAGGAATACTCATCTTCCAAACCAAATGTAATGTCGTATAACAGTGATCATGAACATTCTGTAATGACCAGCAGTTGTATTTCAGTTATCAAGCACTCCCCACAAAGCTCTCTGTCTGATGTGTCTGAGGCATCATCCGTGGAGCATGTTCAGCCGAGCACTGTCCAGAGCAACTGCAGAAGTACTGATATAAACTTCCAAAGAATTAAACAGGAACCTATGGAAAGGGAGAACTTTTCTAGAGATGCCAGAGAAGACAGTAACACTTTCCAAGGCTCTATATATACCAATTATATTGGAAACACATTTTCTGGGTATTCACATTCTCCTCCACTTCTTCACATAAACAGATCGTCGAGTAACTCTCCGAGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTGAAAAATATGTGCCTCGGGTTTGTATTAGAAATTTATTAGACACAAATAATAATGTTTGCGCTTTGGGATCCGCAACTATATTGCCAATGTTCTTCTTTACATCAGACTCCAGCATCAACTATGAAAGAAGCTGATAGAAACATGTTAATGTAATGACCCCATTACTAATGCAATTATTGTCATTGTTATCATCAGAAACTTATATTCAAGTAAGAGCTTAATAGCTCCCAGACCAATACCTTTTGTAGCTTGAGACCAGGTATTCAAGTCACCCCAAATCCCCATCCCCTAGGGCAGCTCCATGAATGCCAGTGTTCAGGCTCTTTCAAAGAGCTGTCACTCAGATATGTGGCTATTGCCCATGTGGGCATGGCGGACACATGTGGAGGCTCATTTATCAAAATTCAAACTTTTGTACTTTTTGTGGACTGCTCTCCCATGAAAAAACTCAGAAATTAAAAAAGCACGAATGTTGACTTATTTATTTAAAGATCCGA
                                                      consensus depths                               4     5     4     5     5     6     6     6     7     7     8     8    10    10    12    12    12    12    14    14    14    14    16    16    16    16    16    16    16    16    16    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    16    16    12    17    12    17    12    17    12    18    12    18    12    18    13    18    13    18    13    18    13    18    13    18    13    18    13    18    13    18    13    18    13    18    13    18    13    18    13    18    13    18    12    17    12    17    12    17    12    18    12    18    12    18    12    18    13    18    13    18    12    17    12    17    12    17    12    17    12    17    12    17    13    18    14    19    14    19    14    19    13    18    13    18    12    17    12    17    12    17    12    16    12    16    12    16    10    14    10    14    10    14     9    14    10    13     7     9     5     9     5     8     5     7     5     7     4     6     4     5     4     5     4     5     6     7     6     7     6     7     6     7     6     7     7     8     7     8     7     8     6     8     7     8     8     8     8     9     8     9     8     9     8     8     8     8     8     8    10    10    10    10    11    11    11    11    13    13    15    17    15    17    16    18    16    19    16    19    17    19    16    19    18    18    18    18    19    19    19    19    20    20    25    25    25    25    25    25    25    25    25    25    25    25    25    25    24    24    24    24    23    24    24    24    23    24    23    24    23    24    25    25    24    25    24    25    24    25    24    25    25    25    25    25    24    25    24    25    24    25    25    26    25    26    25    26    26    26    26    26    25    26    24    26    25    26    25    26    24    26    24    27    25    27    25    26    25    27    26    27    25    26    23    23    23    23    23    23    23    23    22    22    21    21    21    21    19    20    18    20    17    19    17    19    18    19    17    17    17    17    17    17    16    16    16    16    16    16    14    16     3     6     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   2  SIG                                      Xt7.1-CABH6060.3               GGGGAGGAGTATTGACCTACTAACACAGATCTGTAGAGCAGCAGCAGCAGGCTGCAGACTGGAGCGGGCAGAGACACTGATACACGCACGCATGCACACACGTACACACATAAGCACTGCACAGGAGGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGAACAATTCTTGTGGGAAATTAAGTGATCCATCTTAACTTCTGATCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCCCAAGAAATACAAAAGGTCACAACCTCCACTGCAATGTATTTTCAGGAATACTCATCTTCCAAACCAAATGTAATGTCGTATAACAGTGATCATGAACATTCTGTAATGACCAGCAGTTGTATTTCAGTTATCAAGCACTCCCCACAAAGCTCTCTGTCTGATGTGTCTGAGGCATCATCCGTGGAGCATGTTCAGCCGAGCACTGTCCAGAGCAACTGCAGAAGTACTGAT------------------------------------------------------------------------------------ACATTCTCCTCCACTTCTTCACATAAACAGATCGTCGAGTAACTCTCCGAGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTGAAAAAAAAGGAA
  5   1   2  SIG                                      Xt7.1-CABD6323.3                                TACTAACACAGATCTGTAGAGCAGCAGCAGCAGGCTGCAGACTGGAGCGGGGAGAAACACTGATACACGCACGCATGCACACACGTACACACATAAGCACTGCACAGGAGGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCCCAAGAAATACAAAAGGTCACAACCTCCACTGCAATGTATTTTCAGGAATACTCATCTTCCAAACCAAATGTAATGTCGTATAACAGTGATCATGAACATTCTGTAATGACCAGCAGTTGTATTTCAGTTATCAAGCACTCCCCACAAAGCTCTCTGTCTGATGTGTCTGAGGCATCATCCGTGGAGCATGTTCAGCCGAGCACTGTCCAGAGCAACTGCAGAAGTACTGATATAAACTTCCAAAGAATTAAACAGGAACCTATGGAAAGGGAGAACTTTTCTAGAGATGCCAGAGAAGACAGTAACACTTTCCAAGGCTCTATATATACCAATTATATTGGAAACACATTTTCTGGGTATTCACATTCTCCTCCACTTCTTCACATAAACAGATCGTCGAGTAACTCTCCGAGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTGAAAAATATGTGCCTCGGGTTTGTATTAGAAATTTATTAGACACAAATAATAATGTTTGCGCTTTGGGATCCGCAACTATATTGCCAATGTTCTTCTTTACATCAGACTCCAGCATCAACTATGAAAGAAGCTGATAGAAACATGTTAATGTAATGACCCCATTACTAATGCAATTATTGTCATTGTTATCATCAGAAACTTATATTCAAGTAAGAGCTTAATAGCTCCCAGACCAATACCTTTTGTAGCTTGAGACCAGGTATTCAAGTCACCCCAAATCCCCATCCCCTAGGGCAGCTCCATGAATGCCAGTGTTCAGGCTCTTTCAAAGAGCTGTCACTCAGATATGTGGCTATTGCCCATGTGGGCATGGCGGACACATGTGGAGGCTCATTTATCAAAATTCAAACTTTTGTACTTTTTGTGGACTGCTCTCCCATGAAAAAACTCAGAAATTAAAAAAGCACGAATGTTGACTTATTTATTTAAAGATCCGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                          ACAATTCTTGTGGGAAATTAAGTGATCCATCTTAACTTCTGATCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGC
                                                                   SNP                                                                          ---------G--
                                                                   SNP                                                                                      -A----------
                                                                   SNP                                                                                                                                      -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                              -----------A
                                               BLH ATG     458     902                          
                                               BLH MIN     458     193                          
                                               BLH OVR     458     475                          
                                               ORF LNG     458      49                          
                                                                       PREDICTED - Sp ---- 3e-011     XP_797650.1 PREDICTED: similar to hepatic leukemia factor [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ce ---- 2e-013     NP_495861.1 basic-leucine zipper  transcription factor (2J43) [Caenorhabditis elegans] =================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ci ---- 5e-015     BAE06578.1 transcription factor protein [Ciona intestinalis] =========================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dm ---- 4e-019     NP_723075.1 CG14029-PC, isoform C [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Dr ==== 3e-116     NP_001004120.1 zgc:100867 [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Mm ==== 2e-174     NP_059069.1 nuclear factor, interleukin 3, regulated [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Gg ==== 0          NP_989949.1 nuclear factor, interleukin 3 regulated [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Hs ==== 0          NP_005375.2 nuclear factor, interleukin 3 regulated [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 0          AAH81074.1 MGC82043 protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xt ==== 0          NP_001015710.1 MGC107826 protein [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === ?? ==== 0          Q5FW38.1 Nuclear factor interleukin-3-regulated protein [(unknown)]  ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABD6323.3.5                                                                                                          ATG---------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------------------TAA---------------------------------ATG---------------------------TAA------------------------------------------------------------TAA---------------ATG------------ATG---------------------------------------------ATG------------------------------------ATG---------ATG---------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------TGA------------ATG---------------------------------------------TAA---------------------------------------------------ATGATG------TAA------------------------------TGA---------------------TAG------------------TAA---------------------------------TAA------------------TAA------------TGA------------------------TAG------------------TAATAA---------------------------------------------------------------------TGA---------------------TAA------------------------------------------------------------------------------------------------------TGA------------------------------------TAG---------ATG------------------------------------------ATG------------ATG---------------------------------------------------------------------------TGA---------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   2  SIG                                      Xt7.1-CABH6060.3               GGGGAGGAGTATTGACCTACTAACACAGATCTGTAGAGCAGCAGCAGCAGGCTGCAGACTGGAGCGGGCAGAGACACTGATACACGCACGCATGCACACACGTACACACATAAGCACTGCACAGGAGGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGAACAATTCTTGTGGGAAATTAAGTGATCCATCTTAACTTCTGATCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCCCAAGAAATACAAAAGGTCACAACCTCCACTGCAATGTATTTTCAGGAATACTCATCTTCCAAACCAAATGTAATGTCGTATAACAGTGATCATGAACATTCTGTAATGACCAGCAGTTGTATTTCAGTTATCAAGCACTCCCCACAAAGCTCTCTGTCTGATGTGTCTGAGGCATCATCCGTGGAGCATGTTCAGCCGAGCACTGTCCAGAGCAACTGCAGAAGTACTGAT------------------------------------------------------------------------------------ACATTCTCCTCCACTTCTTCACATAAACAGATCGTCGAGTAACTCTCCGAGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTGAAAAAAAAGGAA
                                                  Xt7.1-CHK-1008288552                     GAGTATTGACCTACTAACACAGATCTGTAGAGCAGCAGCAGCAGGCTGCAGACTGGAGCGGGCAGAGACACTGATACACGCACGCATGCACACACGTACACACATAAGCACTGCACAGGAGGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGAACAATTCTTGTGGGAAATTAAGTGATCCATCTTAACTTCTGATCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCCCAAGAAATACAAAAGGTCACAACCTCCACTGCAATGTATTTTCAGGAATACTCATCTTCCAAACCAAATGTAATGTCGTATAACAGTGATCATGAACATTCTGTAATGACCAGCAGTTGTATTTCAGTTATCAAGCACTCCCCACAAAGCTCTCTGTCTGATGTGTCTGAGGCATCATCCGTGGAGCATGTTCAGCCGAGCACTGTCCAGAGCAACTGCAGAAGTACTGATATAAAC------------------------------------------------------------------------GTATTCACATTCTCCTCCACTTCTTCACATAAACAGATCGTCGAGTAACTCTCCGAGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTGAAAAAA
  5   1   2       ext BrSp 5g3  in                     EC2BBA11AB03.g1               GGGGAGGAGTATTGACCTACTAACACAGATCTGTAGAGCAGCAGCAGCAGGCTGCAGACTGGAGCGGGCAGAGACACTGATACACGCACGCATGCACACACGTACACACATAAGCACTGCACAGGAGGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCTAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGAACAATTCTTGTGGGAAATTAAGTGATCCATCTTAACTTCTGATCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGGGATTAAATGACATGGGTTTTGGAAAATAACTTATTGCAC
  5   1   4   10 seed Mus1 5g3  in                         CABH6060.5p ..................................................................CCGAGGCTGGAGCGGGCAGAGACACTGATACACGCACGCATGCACACACGTACACACATAAGCACTGCACAGGAGGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGAACAATTCTTGTGGGAAATTAAGTGATCCATCTTAACTTCTGATCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAACTTAAATTTGGCTTTGATAGTTCTGCTTCCTATGCCCAAGAAATACAAAAGGTCACAACCTCCCACTGCATGTATTTTCAGGAATA
  5   1   2       ext Lun1      in                        CABD13801.5p                                                                                                     CACGCATGCACACACGTACACACATAAGCACTGCACAGGAGGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGAACAATTCTTGTGGGAAATTAAGTGATCCATCTTAACTTCTGATCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCCCC
  5   1   3   20   nb Int1 5g                              CAAP9603.5p .....................................................................................................................................................TGACACTCCAGCGTTGTGACTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGAACAATTCTTGTGGGAAATTAAGTGATCCATCTTAACTTCTGATCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCCC
  5   1   2   10  ext Ovi1 5g3  in                         CABI7444.5p ..............................................................................................................................................................................................................................................................................................................CATCGATTCGGACAATTCTTGTGGGAAATTAAGTGATCCATCTTAACTTCTGATCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCCCAAGAAATACAAAAGGTCACAACCTCCACTGCAATGTATTTTCAGGAATACTCATCTTCCAAACCAAATGTAATGTCGTATAACAGTGATCATGAACATTCTGTAATGACCAGCAGTTGTATTTCAGTTATCAAGCACTCCCCACAAAGCTCTCTGTCTGATGTGTCTGAGGCATCATCCGTGGAGCATGTTCAGCCGAGCACTGTCCAGAGCAACTGCAGAAGTACTGATATAAACTT
  3   1   2       ext BrSp 5g3  in                     EC2BBA11AB03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGTATTCACATTCTCCTCCACTTCTTCACATAAACAGATCGTCGAGTAACTCTCCGAGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAGAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGT
  3   1   4      seed Mus1 5g3  in                         CABH6060.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGACNATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTGAAAAAAA
  3   1   2       ext Ovi1 5g3  in                         CABI7444.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCNCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTG
  3   1   2       ext Lun1      in                        CABD13801.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGTCTGATGGTGAGGATGAACAGCAGGTTTCTAAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTGAAAAAAAAGGAAAG
  5   1   2  SIG                                      Xt7.1-CABD6323.3                                TACTAACACAGATCTGTAGAGCAGCAGCAGCAGGCTGCAGACTGGAGCGGGGAGAAACACTGATACACGCACGCATGCACACACGTACACACATAAGCACTGCACAGGAGGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCCCAAGAAATACAAAAGGTCACAACCTCCACTGCAATGTATTTTCAGGAATACTCATCTTCCAAACCAAATGTAATGTCGTATAACAGTGATCATGAACATTCTGTAATGACCAGCAGTTGTATTTCAGTTATCAAGCACTCCCCACAAAGCTCTCTGTCTGATGTGTCTGAGGCATCATCCGTGGAGCATGTTCAGCCGAGCACTGTCCAGAGCAACTGCAGAAGTACTGATATAAACTTCCAAAGAATTAAACAGGAACCTATGGAAAGGGAGAACTTTTCTAGAGATGCCAGAGAAGACAGTAACACTTTCCAAGGCTCTATATATACCAATTATATTGGAAACACATTTTCTGGGTATTCACATTCTCCTCCACTTCTTCACATAAACAGATCGTCGAGTAACTCTCCGAGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTGAAAAATATGTGCCTCGGGTTTGTATTAGAAATTTATTAGACACAAATAATAATGTTTGCGCTTTGGGATCCGCAACTATATTGCCAATGTTCTTCTTTACATCAGACTCCAGCATCAACTATGAAAGAAGCTGATAGAAACATGTTAATGTAATGACCCCATTACTAATGCAATTATTGTCATTGTTATCATCAGAAACTTATATTCAAGTAAGAGCTTAATAGCTCCCAGACCAATACCTTTTGTAGCTTGAGACCAGGTATTCAAGTCACCCCAAATCCCCATCCCCTAGGGCAGCTCCATGAATGCCAGTGTTCAGGCTCTTTCAAAGAGCTGTCACTCAGATATGTGGCTATTGCCCATGTGGGCATGGCGGACACATGTGGAGGCTCATTTATCAAAATTCAAACTTTTGTACTTTTTGTGGACTGCTCTCCCATGAAAAAACTCAGAAATTAAAAAAGCACGAATGTTGACTTATTTATTTAAAGATCCGA
                                                  Xt7.1-CHK-1008288548                                      CACAGATCTGTAGAGCAGCAGCAGCAGGCTGCAGACTGGAGCGGGCAGAAACACTGATACACGCACGCATGCACACACGTACACACATAAGCACTGCACAGGAGGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCCCAAGAAATACAAAAGGTCACAACCTCCACTGCAATGTATTTTCAGGAATACTCATCTTCCAAACCAAATGTAATGTCGTATAACAGTGATCATGAACATTCTGTAATGACCAGCAGTTGTATTTCAGTTATCAAGCACTCCCCACAAAGCTCTCTGTCTGATGTGTCTGAGGCATCATCCGTGGAGCATGTTCAGCCGAGCACTGTCCAGAGCAACTGCAGAAGTACTGATATAAACTTCCAAAGAATTAAACAGGAACCTATGGAAAGGGAGAACTTTTCTAGAGATGCCAGAGAAGACAGTAACACTTTCCAAGGCTCTATATATACCAATTATATTGGAAACACATTTTCTGGGTATTCACATTCTCCTCCACTTCTTCACATAAACAGATCGTCGAGTAACTCTCCGAGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTGAAAAATATGTGCCTCGGGTTTGTATTAGAAATTTATTAGACACAAATAATAATGTTTGCGCTTTGGGATCCGCAACTATATTGCCAATGTTCTTCTTTACATCAGACTCCAGCATCAACTATGAAAGAAGCTGATAGAAACATGTTAATGTAATGACCCCATTACTAATGCAATTATTGTCATTGTTATCATCAGAAACTTATATTCAAGTAAGAGCTTAATAGCTCCCAGACCAATACCTTTTGTAGCTTGAGACCAGGTATTCAAGTCACCCCAAATCCCCATCCCCTAGGGCAGCTCCATGAATGCCAGTGTTCAGGCTCTTTCAAAGAGCTGTCACTCAGATATGTGGCTATTGCCCATGTGGGCATGGCGGACACATGTGGAGGCTCATTTATCAAAATTCAAACTTTTGTACTTTTTGTGGACTGCTCTCCCATGAAAAAACTCAGAAATTAAAAAAGCACGAATGTTGACTTATTTATTTAAAGATCCGAATTAAA
  5   1   1           AbdN FL                     IMAGE:7021674.FL-MGC                                                                                                                                                                                                                                                                                                                                                          TGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCCCAAGAAATACAAAAGGTCACAACCTCCACTGCAATGTATTTTCAGGAATACTCATCTTCCAAACCAAATGTAATGTCGTATAACAGTGATCATGAACATTCTGTAATGACCAGCAGTTGTATTTCAGTTATCAAGCACTCCCCACAAAGCTCTCTGTCTGATGTGTCTGAGGCATCATCCGTGGAGCATGTTCAGCCGAGCACTGTCCAGAGCAACTGCAGAAGTACTGATATAAACTTCCAAAGAATTAAACAGGAACCTATGGAAAGGGAGAACTTTTCTAGAGATGCCAGAGAAGACAGTAACACTTTCCAAGGCTCTATATATACCAATTATATTGGAAACACATTTTCTGGGTATTCACATTCTCCTCCACTTCTTCACATAAACAGATCGTCGAGTAACTCTCCGAGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATTTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   0       chi Tad0                               IMAGE:6983904      CAGAGTAGCGTTGAGGAGTATTGACCTACTAACACAGATCTGTAGAGCAGCAGCAGCAGGCTGCAGACTGGAGCGGGGAGAAACACTGATACACGCACGCATGCACACACGTACACACATAAGCACTGCACAGGACGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAAGATAAATTTTTGTACCGGAGCATATAATGGAAATGGTAACTACCTGACTGCATTGGAGGACTGATTTAAAAATGGTATGGTCAATTATTTTAATTCAAAGGATAATGTGGATAAGATTGATTTTTTGTCTAAAGATCATCTAAGCTGTGGTGCCATCTACACTACAGATTGGAGACAATTATGCTCTCCTTCTTGTTCAAAAACTCTGTTGTTTGATTCCCGCTGTATCCAATTAATTGTTGTCGATAAAAAATGTTCTATTGCTTTTAATAATATAATAGCGATGTCTAATCAATATAAAATATTGAATAAATAATAATAAAGGATATAGATGTACAAATGGTTCTACGATTTGCTTTGTCAGAGATACAAAGATTAAACTACTTGTATAGTGATTATATGAACCTATACTACGTTTCAGTACTGCTTGGAC
  5   1   2   22  ext Tad5 5g                              XZT68131.5p .............CGTTGAGGAGTATTGACCTACTAACACAGATCTGTAGAGCAGCAGCAGCAGGCTGCAGACTGGAGCGGGGAGAAACACTGATACACGCACGCATGCACACACGTACACACATAAGCACTGCACAGGACGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGANAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGG
  5   1   3        nb Neu  5g                        TNeu135k13.p1cSP6                    GAGTATTGACCTACTAACACAGATCTGTAGAGCAGCAGACAGCACGCTGCAGACTGGAGCGGGCAGAGACACTGATACACGCACGCATGCACACACGTACACACATAAGCACTGCACAGGAGGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGGACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAAGAGCTGCAGAAGGTGTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAA
  5   1   2   10  ext Bone 5g3  in                       CBTC10667.fwd ......................GTATTGACCTACTAACACAGATCTGTAGAGCAGCAGCAGCAGGCTGCAGACTGGAGCGGGCAGAGACACTGATACACGCACGCATGCACACACGTACACACATAAGCACTGCACAGGAGGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGA
  5   1   3   34   nb Brn2 5x3  out                       CAAJ15302.5p ...........................................TCTGTAGAGCAGCAGCAGCAGGCTGCAGACTGGAGCGGGGAGAAACACTGATACACGCACGCATGCACACACGTACACACATAAGCACTGCACAGGACGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGT
  5   1   3   22   nb Tad5 5g                              XZT70334.5p ...............................................................................GGGGAGAAACACTGATACACGCACGCATGCACACACGTACACACATAAGCACTGCACAGGACGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAANACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCC
  5   1   4   10 seed Liv1 5g3  in                         CAAR4396.5p ........................................................................................CACTGATACACGCACGCATGCACACACGTACACACATAAGCACTGCACAGGAGGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCCCAAGAAATACAAAAGGTCACAACCTCCACTGNCATGTATTTTCAGGAATACTCATCTTCCAACCAAAATGTATGT
  5   1   3        nb Lun1      in                         CABD6323.5p                                                                                           CTGATACACGCACGCATGCACACACGTACACACATAAGCACTGCACAGGAGGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTANATTTGGCTTGATTAGTTCTGCTTCCTATGCCCAAGAAATACAAAAGGTCACAACCTCCACTGCAATGTATTTTCAGGAATACTCATC
  5   1   3        nb Lun1      in                         CABD5295.5p                                                                                                     CACGCATGCACACACGTACACACATAAGCACTGCACAGGACGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCC
  5   1   3   10   nb Int1 5g3  in                         CAAP2414.5p .....................................................................................................................................CACAGGAGGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGTGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCCCAAGAAATACAAAAGGTCACAACCTCCACTGCAATGTATTTTCAGGAATACTCATC
  5   1   3   10   nb Int1 5g3  in                         CAAP2510.5p .....................................................................................................................................CACAGGAGGCGCTGCTTGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCCCAAGAAATACAAAAGGTCACAACCTCCACTGCAATGTATTTTCAGGAATACTCATCTTCCAACCAAATGTAATGTCGTATAACAGTGATCATGAACATTCTGTAATGACCAGCAGTTGTATTTC
  5   1   3   10   nb Int1 5g3  in                         CAAP3292.5p .....................................................................................................................................................TGACACTCCAGCGTTGTGATTTTTGTTTTATTCCCTTGTTGTTGGCATATCTGATCACATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCCCAAGAAATACAAAAGGTCACAACCTCCACTGCAATGTATTTTCAGGAATACTCATCTTT
  5   1   3   10   nb Limb 5g3  in                        CBSU5448.fwd ..............................................................................................................................................................................................................CATCAACTCCCAGGTACTGGCCACCCATGCCTGGAAAGGAGCAAGTGAAGTTCTTCCGTTAAATAAGAGCAAAGATGCCTATGAACTGATGCAAGCGCTAATGCAGGTCAAATTTTTGTTCCTGAGCATATAACGGAAATGGTTACAACCTGGCTGTCATGAGGCCATGAAGGAAATATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCCCAAGAAATACAAAAGGTCACAACCTCCACTGCTATGTATTTTCAGGAATACTCATCTTCCANACCAAATGTAATGTCGTATAACAGTGATCATGAACATTCTGTAATGACCA
  5   1   3        nb AbdN FL                            IMAGE:7021674                                                                                                                                                                                                                                                                                                                                                            TGGTTAAACCTGGCTGTCATGAGGCCATGAAGGAAAATTACCAGCAGATGGAATTTAATCTAATTACAAGCTTCAAGTTGACGTGAAATTGCTCTTTTTAGGAGCTGCAGAAGGTTTCTAACTCCACTTCCTTCTCATGCAGCTGAGAAAAATGCCAACCATTAAAAGAGAGCAGGAATGTGCAGATTCACGCAACAATATGGAAAATATTCTTGTTCTTAGTTCAAACATACCAGACATGTCAGAATCCATGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCAGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCCCAAGAAATACAAAAGGTCACAACCTCCACTGCAATGTATTTTCAGGAATACTCATCTTCCAAACCAAATGTAATGTCGTATAACAGTGATCATGAACATTCTGTAATGACCAGCAGTTGTATTTCAGTTATCAAGCACTCCCCACAAAGCTCTCTGTCTGATGTGTCTGAGGCATCATCCGTGGAGCATGTTCAGCCGAGCACTGTCCAGAGCAACTGCAGAAGTACTGATATAAACTTCCAAAGAATTAACAGGAACCTATTGGAAAGGGAGAACTTTTCTAGAGATGCCAGAAGAAGACAGTAACACTTTTCCAAGGCTCTTATATATA
  5   1   2       ext Lun1      in                         CABD2073.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATTCGTCGAATCCTGGACTCCAGCAATGATATGTTGTACAGCGAAGGGGCACCACGCGAAAAACAAAAACTCCTCATGTCGGAGGAAAAGGGAATTTATCCCAGATGAAAAGAAAGATGCTATGTACTGGGAAAAAAGACGGAAAAACAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCCCAAGAAATACAAAAGGTCACAACCTCCACTGCAATGTATTTTCAGGAATACTCATCTTCCAAACCAAATGTAATGTCGTATAACAGTGATCATGAACATTCTGTAATGACCAGCAGTTGTATTTCAGTTATCAAGCACTCCCCACAAAGCTCTCTGTCTGATGTGTCTGAGGCATCATCCGTGGAGCATGTTCAGCCGAGCACTGTCCAGAGCAACTGCAGAAGTACTGATATAAACTTCCAAAGAATTAAACAGGAACCTATGGAAAGGGAGAACTTTTCTAGAGATGCCAGAGAAGACAGTAACACTTTCCAAGGCTCTATATATACCAATTATATTGGAAACACATTTTCTGGGTATTCACATTCTCCTCCACTTCTTCACATAAACAGATCGTCGAGTAACTCTCCGAGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAAC
  5   1   3        nb Ski1      in                         CABJ3748.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAATGAAGCTGCAAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCCCAAGAAATACAAAAGGTCACAACCTCCACTGCAATGTATTTTCAGGAATACTCATCTTCCAAACCAAATGTAATGTCGTATAACAGTGATCATGAACATTCTGTAATGACCAGCAGTTGTATTTCAGTTATCAAGCACTCCCCACAAAGCTCTCTGTCTGATGTGTCTGAGGCATCATCCGTGGAGCATGTTCAGCCGAGCACTGTCCAGAGCAACTGCAGAAGTACTGATATAAACTTCCAAAGAATTAAACAGGAACCTATGGAAAGGGAGAACTTTTCTAGAGATGCCAGAGAAGACAGTAACACTTTCCAAGGCTCTATATATACCAATTATATTGGAAACACATTTTCTGGGTATTCACATTCTCCTCCACTTCTTCACATAAACAGATCGTCGAGTAACTCTCCGAGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACC
  5   1   3        nb Tad5      in                         XZT14087.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGAAGCTGCAAAAGGTCGAGAGAAAAACGGAGATTAAATGACATGGTTTTGGAAAATAAACTTATTGCACTAGGAGAGGAGAATGCCAGTCTGAAAACAGAACTGCTGTCTTTAAAACTTAAATTTGGCTTGATTAGTTCTGCTTCCTATGCCCAAGAAATACAAAAGGTCACAACCTCCACTGCTATGTATTTTCAGGAATACTCATCTTCCAAACCAAATGTAATGTCGTATAACAGTGATCATGAACATTCTGTAATGACCAGCAGTTGTATTTCAGTTATCAAGCACTCCCCACAAAGCTCTCTGTCTGATGTGTCTGAGGCATCATCCGTGGAGCATGTTCAGCCGAGCACTGTCCAGAGCAACTGCAGAAGTACTGATATAAACTTCCAAAGAATTAAACAGGAACCTATGGAAAGGGAGAACTTTTCTAGAGATGCCAGAGAAGACAGTAACACTTTCCAAGGCTCTATATATACCAATTATATTGGAAACACATTTTCTGGGTATTCACATTCTCCTCCACTTCTTCACATAAACAGATCGTCGAGTAACTCTCCGAGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAANAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCA
  3  -1   2       ext Lun1      in                         CABD6535.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGCTGATGTGTCTGAGGCATCATCCGTGGAGCATGTTCAGCCGAGCACTGTCCAGAGCAACTGCAGAAGTACTGATATAAACTTCCAAAGAATTAAACAGGAACCTATGGAAAGGGAGAACTTTTCTAGAGATGCCAGAGAAGACAGTAACACTTTCCAAGGCTCTATATATACCAATTATATTGGAAACACATTTTCTGGGTATTCACATTCTCCTCCACTTCTTCACATAAACAGATCGTCGAGTAACTCTCCGAGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCAATTCCANGTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAATTGGTATGTTTT
  5   1   3        nb Ski1      ?                          CABJ1267.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGATGTGTCTGAGGCATCATCCGTGGAGCATGTTCAGCCGAGCACTGTCCAGAGCAACTGCAGAAGTACTGATATAAACTTCCAAAGAATTAAACAGGAACCTATGGAAAGGGAGAACTTTTCTAGAGATGCCAGAGAAGACAGTAACACTTTCCAAGGCTCTATATATACCAATTATATTGGAAACACATTTTCTGGGTATTCACATTCTCCTCCACTTCTTCACATAAACAGATCGTCGAGTAACTCTCCGAGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCCAGTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAG
  5   1   3        nb Gas7                                 XZG39224.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGCAACTGCAGAAGTACTGATATAAACTTCCAAAGAATTAAACAGGAACCTATGGAAAGGGAGAACTTTTCTAGAGATGCCAGAGAAGACAGTAACACTTTCCAAGGCTCTATATATACCAATTATATTGGAAACACATTTTCTGGGTATTCACATTCTCCTCCACTTCTTCACATAAACAGATCGTCGAGTAACTCTCCGAGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCCTTAAAGACTTATAGTAACCCAGGANATCTGTGCATCCAATTCCCAGTTAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTT
  5   1   2       ext Bone      in                        CBTC9617.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTTTCTAGAGATGCCAGAGAAGACAGTAACACTTTCCAAGGCTCTATATATACCAATTATATTGGAAACACATTTTCTGGGTATTCACATTCTCCTCCACTTCTTCACATAAACAGATCGTCGAGTAACTCTCCGAGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTANAGATTGTAGTTTGCAGTANATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACT
  5   1   2       ext Mus1      in                         CABH2079.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAGAGAAGACAGTAACACTTTCCAAGGCTCTATATATACCAATTATATTGGAAACACATTTTCTGGGTATTCACATTCTCCTCCACTTCTTCACATAAACAGATCGTCGAGTAACTCTCCGAGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTTCAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGA
  3   1   3        nb Int1 5g3  in                         CAAP2510.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATTCACATTCTCCTCCACTTCTTCACATAAACAGATCGTCGAGTAACTCTCCGAGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACNTGTGTTATGATCACTATGCCTTGGTACAGATAGGTAGCCAATGCAAG
  3   1   3        nb Int1 5g3  in                         CAAP2414.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACATAAACAGATCGTCGAGTAACTCTCCGAGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAACTCTTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCA
  5  -1   3        nb Gas7                                 XZG14032.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAACTCTCCGAGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCNCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGAT
  3   1   3        nb Int1 5g3  in                         CAAP3292.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGAGACNATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTG
  3   1   4      seed Liv1 5g3  in                         CAAR4396.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGAACATCAGAAGCAGATGAAGTGTGGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTGAAAAAT
  3   1   3        nb Lun1      in                         CABD6323.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAACATCAGAAGCAGATGAAGGTGTGGTAGGAAAGACGTCTGATGGTGAGGATGAACAGCAGGTTCCTAAAGGTCCCATTCATTCCCCAGTTGAACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGG
  5  -1   2       ext Lun1      in                         CABD6535.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGACCATCAGAAGCAGATGAAGGTGTGTAGGGAAAGACGTCTGATGGTGAGGATGANCAGCAGTTCCTAAAGGTCCCATTCATTCCCCAGTTGACTTAAAAACGGGCACACGACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTGCCTCGTGCCGAATTCG
  3   1   3        nb Lun1      in                         CABD5295.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GACAATCATAAAGGTTCCAGAAGTGAACTCCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTG
  3   1   3        nb Ovi1      out                        CABI6906.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTTTTTTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGGCTGGCCACTAAAACCAGGTCAGTGGCCCCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATTTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTTTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTTTTGGTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       ext Lun1      in                         CABD2073.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTGAAAAAT
  3   1   2       ext Mus1      in                         CABH2079.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTGAAAAAT
  3   1   2       ext Bone 5g3  in                       CBTC10667.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTG
  3   1   3        nb Limb 5g3  in                        CBSU5448.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCATTACCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAAACCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTG
  3   1   3        nb Tad5      in                         XZT14087.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTCCTCACAAGCTCCGCATAAAAGCAAAGGCTATGCAGATTAAAGTAGAAGCACTGGAAAGCGAACTTAATAGCACTCAAAAACTGACCCTGCCAATTGATATGTCCTCAAAGCGGCACTTACAGCTGGAAAAACACAACAGTGAACCCATGGTACATTCTTCTTTGTCACCTTTATCAGTTCAAGTAACTAATATACAGGACTGGCCACTAAAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTTGTAAAACATCTGGGATTGTGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATGGTG
  3   1   3        nb Ski1      in                         CABJ3748.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATAGCCCTCAAAAACTGGCCCTGCCAATTGATATGTCCTCAAAGGGGGCCTTTCAGGGGGGAAAACCCCACAGGGGAACCCGGGGCCCTTTTTTTTTGTCCCCTTTTTCAGTTCAAGGAACTAATATACAGGGCTGGCCCCTAAAACCAGGTCAGGGGCCCCCCCGGGGACTTGATAAAATTCCAAGGGTTTGTAAAACATTTGGGGTTGGGGGTATAAAAGACAAAGTTTTTAAAGCCTTTGGGTTGGGGGGGTTTTTTTTAAAGCAAGGGTTTGCAAATTTTTTTGGGGGGGGTGGAACCCTTAAAAGGCTTTTTGTTACCCCGGGAATTTGGGCCTCCAATTCCCGTTAAAAGGACTACTGGTTTTTTCCTG
  3   1   3        nb Bone                               CBTC10658.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTTTATCAGTTCAAGTAATTAGTATGCAGGGGTGGCCACTAGAACCAGGTCAGTGGCACCACAGGGAACTTGATAAAATTCCAAGTGTTAGTAAAACATCTGGGATTGGGGATATAAAAGACAATGTCTTCAAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTTTTTGCTGAGGTTGCAGCCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATGCAATTCCAGTTAAAAGTACTACTGTTTTTTTCATGATATGCATATGGTAAAGTTAGTAGTTTGCAGTAAATTGGTATGTTTG
  5   1   2       ext TpA       in                   TTpA024p06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATATAAAAGACAATGTCTTCAAGCCTCTGAGTCAGAGAGCTTATATTTAAAGCAAGGTATTGCAAATCTATCTGCTGAGGTTGCAACCCTTAAAAGACTTATAGTAACCCAGGAAATCTGTGCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTGAAAAATATGTGCCTCGGGTTTG
  3   1   2       ext TpA       in                    TTpA024p06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCATCCAATTCCAGTTAAAAGTACTACTGATTTTTTCATGATATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTGAAAAATATGTGCCTCGGGTTTGTATTAGAAATTTATTAGACACAAATAATAATGTTTGCGCTTTGGGATCCGCAACTATATTGCCAATGTTCTTCTTTACATCAGACTCCAGCATCAACTATGAAAGAAGCTGATAGAAACATGTTAATGTAATGACCCCATTACTAATGCAATTATTGTCATTGTTATCATCAGAAACTTATATTCAAGTAAGAGCTTAATAGCTCCCAGACCAATACCTTTTGTAGCTTGAGACCAGGTATTCAAGTCACCCCAAATCCCCATCCCCTAGGGCAGCTCCATGAATGCCAGTGTTCAGGCTCTTTCAAAGAGCTGTCACTCAGATATGTGGCTATTGCCCATGTGGGCATGGCGGACACATGTGGAGGCTCATTTATCAAAATTCAAACTTTTGTACTTTTTGTGGACTGCTCTCCCATGAAAAAACTCAGAAATTAAAAAAGCACGAATGTTGACTTATTTATTTAAAGATCCGAATTAAAAAGCATGAACAAATAAAATGTGACAAAAAAAAAAAAAAAA
  3   1   2       ext Bone      in                        CBTC9617.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGCATATTGTAAAGATTGTAGTTTGCAGTAAATTGGTATGTTTTGTATAATGCTCAGTTTTCACTGGTATTGTGACGTCATTTCACTGTACTGTTCAAGTAATGATGTCTACTTAATATTGTCCTTTTTTGTGCACAACTGTGTTATGATCACTATGCCTTGTGTACAGATAGGTAGCCAATGCAAGGCTGTAAATATCTTTAAACATTATTTTTGCCAGTCTGTTATAAATTGTGAAAGTTACCAGTTAAATAAAGTATTGGTGAAAAATATGTGCCTCGGGTTTGTATTAGAAATTTATTAGACACAAATAATAATGTTTGCGCTTTGGGATCCGCAACTATATTGCCAATGTTCTTCTTTACATCAGACTCCAGCATCAACTATGAAAGAAGCTGATAGAAACATGTTAATGTAATGACCCCATTACTAATGCAATTATTGTCATTGTTATCATCAGAAACTTATATTCAAGTAAGAGCTTAATAGCTCCCAGACCAATACCTTTTGTAGCTTGAGACCAGGTATTCAAGTCACCCCAAATCCCCATCCCCTAGGGCAGCTCCATGAATGCCAGTGTTCAGGCTCTTTCAAAGAGCTGTCACTCAGATATGTGGCTATTGCCCATGTGGGCATGGCGGACACATGTGGAGGCTCATTTATCAAAATTCAAACTTTTGTACTTTTTGTGGACTGCTCTCCCATGAAAAAACTCAGAAATTAAAAAAGCACGAATGTTGACTTATTTATTTAAAGATCCGAATATAAAAAGCATGAACAAATAAAAATGTTGAAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)