Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   3.0    0Xt7.1-XZF2076.3.5                          66 END     1           1        1                ZNF594 protein [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 187.0    0Xt7.1-CBWN11775.5.5                        37 PI      77       1782     2086                BMP-2 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 98%

 1012074363 Xt7.1-XZT65619.5.5 - 77 ESTs
                                                                       -40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-XZT65619.5.5                                         TATCATCTCCATCTGCAAACTGCGTCCCGAGTCCCACTGAGCTTTTCCACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAGTGAGTAGACTTTCTGTTCATTCTGTATTTTTCATCTCCCCCCTTGTGTACTTTGCCCGTAGCTGCCCTCCTGCATAGGAACCCCACGGCTCTGGGTACTTACTGCTGAGGCTATGGCAGGACCTGAGACAATGTTGAGCCCCCCCGCAGCGCTCTAGGACAGAAGTGTGCTACACATCTAGAACGGCAAGTCAGTCTTCTGCGCTCCAGGTGTTGGAGAACTACAAGTACCAACATTCTTTGGCCAGGTTCGCTGAACTGGGGTGGGGGGGTCGGAGTGTTGTAGTTCTTTAGCAGCTGGATAGCCGAGCGTTACGTGCGCTTGTGCCGGAGGGGGACTGATAGCGGCATGTATCACAGCTGTAGCGCCGACACATCGCGGGCTATCGGGTTGCAGAACACATGATCCAGCTGCCCGGAGCGCTGGCACTTGTTGCAAAAGGGCAAATGGCAGGGGCAATTCTATAGCTGCTGATCGTGCTAGGAGTCAGACTGGTGCTAATTGTCTGGAGCCCGGGAGACGCTCACAGTCAGATTAGCAACAGGATGGCGGTGACTATCTGATAATGAGGGATGTGACTGGGAACAAGTTATAGCCCAAGAAACCCCAGGCACCCCCCCTCTCGCCCTGCCCCGGGTGGCTCAGTGGAACTGTCCTTGTCCTATTATTTGCTTTGATCCCGCTCTATCACTTGATTTGATTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCATTATTTTAAACATAAGCTACTTCTTTGTACAATGTGTTTATAAATGTACATTAGGATGAATATGGATTTATATGGGAATAGAGTATTTTTTCTATAAATTACCTTGTGTTAATATTTATTGGCAATATGGCTTAAAACCCCTGCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATACCTCCCACCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATCTGATCTTATTTTCCAAAAGCAAGTAAGAAATTCATTTTGCGTTGGCAATTTTTCTTTATTTTTTGGGGGGGCTTGGAAGTTATCCAAAAATGTTCTGTCCCTAAGCTCTTGTGTAGGAAGTATAGGGAAAATATTTCTACATTTGTTTGTCAATTATTAAACTTCTCTAAACCTTAGAAACTAAAAAAGGGACAGCTTAGCTGAAACCAATAAAAACTGCTAAGTGGAAAGTTTGCCAAAGCCTCAGCTTCCTGGAGAGTGCAGGTGGAGCGACCAGATTAGAGCCTCAGGCTAACAGGACTGCCTGCTGCTTTTGTGTTGTAACTCTTCAGAAAGGGCCCTTTTAACTGTATTGAGCTTAAATAAATTGTTTTAAAACAGACTGAACTCAATTTTCCCTGTTTCTTTCCTCCTTTCCCCAAAAAAATAAACAATTTACAATTTCCCTTTTAACATATAAACTGTCTTGTCCACCAACCATTAATTAGTAGTACTTGTTTTCTGCCTCTGGAAATACAGTAAGTCTTGATCCATTTCTGTAGATTTCTTATAGATGTATCATTTCCATTTATTAGTAATAAAGAAGATACCATG
                                                  Xt7.1-CHK-1008224041                                               CTCCATCTGCAAACTGCGTCCCGAGTCCCACTGAGCTTTTCCACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAGTGAGTAGACTTTCTGTTCATTCTGTATTTTTCATCTCCCCCCTTGTGTACTTTGCCCGTAGCTGCCCTCCTGCATAGGAACCCCACGGCTCTGGGTACTTACTGCTGAGGCTATGGCAGGACCTGAGACAATGTTGAGCCCCCCCGCAGCGCTCTAGGACAGAAGTGTGCTACACATCTAGAACGGCAAGTCAGTCTTCTGCGCTCCAGGTGTTGGAGAACTACAAGTACCAACATTCTTTGGCCAGGTTCGCTGAACTGGGGTGGGGGGGTCGGAGTGTTGTAGTTCTTTAGCAGCTGGATAGCCGAGCGTTACGTGCGCTTGTGCCGGAGGGGGACTGATAGCGGCATGTATCACAGCTGTAGCGCCGACACATCGCGGGCTATCGGGTTGCAGAACACATGATCCAGCTGCCCGGAGCGCTGGCACTTGTTGCAAAAGGGCAAATGGCAGGGGCAATTCTATAGCTGCTGATCGTGCTAGGAGTCAGACTGGTGCTAATTGTCTGGAGCCCGGGAGACGCTCACAGTCAGATTAGCAACAGGATGGCGGTGACTATCTGATAATGAGGGATGTGACTGGGAACAAGTTATAGCCCAAGAAACCCCAGGCACCCCCCCTCTCGCCCTGCCCCGGGTGGCTCAGTGGAACTGTCCTTGTCCTATTATTTGCTTTGATCCCGCTxxxxxxxTxxAxxxxxTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCATTATTTTAAACATAAGCTACTTCTTTGTACAATGTGTTTATAAATGTACATTAGGATGAATATGGATTTATATGGGAATAGAGTATTTTTTCTATAAATTACCTTGTGTTAATATTTATTGGCAATATGGCTTAAAACCCCTGCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATACCTCCCACCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATCTGATCTTATTTTCCAAAAGCAAGTAAGAAATTCATTTTGCGTTGGCAATTTTTCTTTATTTTTTGGGGGGGCTTGGAAGTTATCCAAAAATGTTCTGTCCCTAAGCTCTTGTGTAGGAAGTATAGGGAAAATATTTCTACATTTGTTTGTCAATTATTAAACTTCTCTAAACCTTAGAAACTAAAAAAGGGACAGCTTAGCTGAAACCAATAAAAACTGCTAAGTGGAAAGTTTGCCAAAGCCTCAGCTTCCTGGAGAGTGCAGGTGGAGCGACCAGATTAGAGCCTCAGGCTAACAGGACTGCCTGCTGCTTTTGTGTTGTAACTCTTCAGAAAGGGCCCTTTTAACTGTATTGAGCTTAAATAAATTGTTTTAAAACAGACTGAACTCAATTTTCCCTGTTTCTTTCCTCCTTTCCCCAAAAAAATAAACAATTTACAATTTCCCTTTTAACATATAAACTGTCTTGTCCACCAACCATTAATTAGTAGTACTTGTTTTCTGCCTCTGGAAATACAGTAAGTCTTGATCCATTTCTGTAGATTTCTTATAGATGTATCATTTCCATTTATTAGTAATAAAGAAGATACCATGCGCTAT
                                                      consensus depths                                              3     4     3     4     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     9     9     9     9     9     9     9     9     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     7     5     7     5     7     5     8     5    10     5    10     6    12     6    13     6    14     7    15     8    15     8    15     8    14     8    14    14    15    16    16    16    16    16    16    16    16    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    16    16    16    16    16    16    12    12    13    13    14    15    15    16    16    17    16    17    16    16    16    16    16    16    16    16    16    16    16    16    16    16    17    17    20    20    21    21    21    21    21    21    20    21    21    21    21    21    20    20    20    20    20    20    20    20    18    18    18    18    18    18    18    18    19    20    19    20    19    20    19    20    19    20    20    21    22    23    21    22    21    22    20    21    20    21    20    21    23    24    23    24    24    25    23    25    25    25    26    27    22    25    23    24    22    23    23    23    24    24    24    24    26    26    26    26    26    26    25    25    24    24    23    24    23    24    23    26    24    28    23    25    23    25    23    25    26    27    27    28    27    28    25    27    26    27    26    27    24    27    26    27    24    26    24    26    24    26    25    26    23    24    22    23    22    23    21    24    21    24    22    24    22    24    20    23    21    23    20    24    22    25    23    27    24    27    25    27    24    26    24    26    23    26    22    25    18    22    17    20    14    18    13    19    13    17    13    16    13    16    13    16    13    16    13    16    13    16    13    16    13    17    13    17    14    17    16    17    15    16    16    18    16    18    14    18    16    18    16    19    16    19    14    17    15    18    15    19    15    19    15    18    15    18    16    19    14    20    16    20    16    19    15    19    18    20    18    20    19    20    20    20    20    20    20    20    20    20    19    20    18    19    16    19    17    19    17    19    17    19    14    19    16    19    16    19    16    18    15    18    13    17     9    10     8     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     9     9     8     8     7     7     5     6     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   2  SIG                                 Xt7.1-IMAGE:8961436.5                                         TATCATCTCCATCTGCAAACTGCGTCCCGAGTCCCACTGAGCTTTTCCACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAGTGAGTAGACTTTCTGTTCATTCTGTATTTTTCATCTCCCCCCTTGTGTACTTTGCCCGTAGCTGCCCTCCTGCATAGGAACCCCACGGCTCTGGGTACTTACTGCTGAGGCTATGGCAGGACCTGAGACAATGTTGAGCCCCCCCGCAGCGCTCTAGGACAGAAGTGTGCTACACATCTAGAACGGCAAGTCAGTCTTCTGCGCTCCAGGTGTTGGAGAACTACAAGTACCAACATTCTTTGGCCAGGTTCGCTGAACTGGGGTGGGGGGGTCGGAGTGTTGTAGTTCTTTAGCAGCTGGATAGCCGAGCGTTACGTGCGCTTGTGCCGGAGGGGGACTGATAGCGGCATGTATCACAGCTGTAGCGCCGACACATCGCGGGCTATCGGGTTGCAGAACACATGATCCAGCTGCCCGGAGCGCTGGCACTTGTTGCAAAAGGGCAAATGGCAGGGGCAATTCTATAGCTGCTGATCGTGCTAGGAGTCAGACTGGTGCTAATTGTCTGGAGCCCGGGAGACGCTCACAGTCAGATTAGCAACAGGATGGCGGTGACTATCTGATAATGAGGGATGTGACTGGGAACAAGTTATAGCCCAAGAAACCCCAGGCACCCCCCCTCTCGCCCTGCCCCGGGTGGCTCAGTGGAACTGTCCTTGTCCTATTATTTGCTTTGATCCCGCTCTATCACTTGATTTGAGTCTAATCCCCTACAGATCCTCCCTATTTATTTGCATGTATTTTTGTTCTGCACCCTCCAGAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGATACAATAACAGCAAGTGGAACATGATAATAGGCTGCTGGACCCGGCTATCCACACATGTGACCAGTGGAAAGTTTGAGTAGCCTGCATATAAGTGACCCGGATACAATAACATGGCTGCTTGAGTGTCCTCACAACAACTTCAGGAGCTGAGTATCTTTTTTCCAAGAGCACGTCCAGACCTTATTATCCTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATAACTCGCGAGCATCTTATGATCACGATGGCGGATCTGAATGACTCGACAGCTTATGCATGGATGCCATCTGCGATCACTAACCCACTACATGCTATGTACAACTCGTACCCGTAACTCAGCATCCAAAGCGGGTGCGTCCCCCAGATCGAGTGCTTCTCATGCTTATTGATGATAGACAAGTCGTCCTAAAACTATCAGAGATGTGTGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCAAACAAAAGACTGTAAGGGCTGGACTCTTTCCACTGAACATTCACCTTGACCTTATTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCATTATTTTAAACATAAGCTACTTCTTTGTACAATGTGTTTATAAATGTACATTAGGATGAATATGGATTTATATGGGAATAGAGTATTTTTTCTATAAATTACCTTGTGTTAATATTTATTGGCAATATGGCTTAAAACCCCTGCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATACCTCCCACCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAA
  5   1   2  SIG                                      Xt7.1-XZT65619.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCCATAGTATCATCTCCATCTGCAAACTGCGTCCCGAGTCCCACTGAGCTTTTCCACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCATTATTTTAAACATAAGCTACTTCTTTGTACAATGTGTTTATAAATGTACATTAGGATGAATATGGATTTATATGGGAATAGAGTATTTTTTCTATAAATTACCTTGTGTTAATATTTATTGGCAATATGGCTTAAAACCCCTGCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATACCTCCCACCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATCTGATCTTATTTTCCAAAAGCAAGTAAGAAATTCATTTTGCGTTGGCAATTTTTCTTTATTTTTTGGGGGGGCTTGGAAGTTATCCAAAAATGTTCTGTCCCTAAGCTCTTGTGTAGGAAGTATAGGGAAAATATTTCTACATTTGTTTGTCAATTATTAAACTTCTCTAAACCTTAGAAACTAAAAAAGGGACAGCTTAGCTGAAACCAATAAAAACTGCTAAGTGGAAAGTTTGCCAAAGCCTCAGCTTCCTGGAGAGTGCAGGTGGAGCGACCAGATTAGAGCCTCAGGCTAACAGGACTGCCTGCTGCTTTTGTGTTGTAACTCTTCAGAAAGGGCCCTTTTAACTGTATTGAGCTTAAATAAATTGTTTTAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCATAGTATCATCTCCATCTGCAAACTGCGTCCCGAGTCCCACTGAGCTTTTCCACAAAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCTAATCCCCTACAGATCCTCCCTATTTATTTGCATGTATTTTTGTTCTGCACCCTCCA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     G-----------
                                               BLH ATG     884    1669                                         
                                               BLH MIN     866     257                                         
                                               BLH MPR     371     257                                         
                                               BLH OVR     884    1294                                         
                                               ORF LNG     884      95                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Cs ---- 2e-013     BAB68348.1 lefty/antivin related protein [Ciona savignyi] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Br ---- 2e-015     ABD62777.1 myostatin [Branchiostoma lanceolatum] ==================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ce ---- 3e-035     NP_504709.1 decapentaplegic / Bone morphogenetic protein Like, transforming growthfactor-beta homolog, regulator of body size and male tail differentiation (41.7kD) (dbl-1) [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ci ---- 3e-047     BAE06331.1 transforming growth factor beta superfamily signaling ligand [Ciona intestinalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 1e-072     NP_477311.1 decapentaplegic CG9885-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ---- 7e-098     XP_787248.1 PREDICTED: similar to bone morphogenetic protein 4 [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Bf ==== 2e-104     AAC97488.1 bone morphogenetic protein 2/4 [Branchiostoma floridae] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Bb ==== 1e-114     AAF19841.1 bone morphogenetic protein 2/4 [Branchiostoma belcheri] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Dr ==== 2e-161     NP_571417.1 bone morphogenetic protein 4 [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Gg ==== 0          NP_990568.1 bone morphogenetic protein 4 [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Mm ---= 0          NP_031580.1 bone morphogenetic protein 4 [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 0          NP_001193.1 bone morphogenetic protein 4 preproprotein; bone morphogenetic protein 2B [Homosapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 0          CAA45836.1 protein 4 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === ?? ==== 0          NP_001081501.1 bone morphogenetic protein-4 [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 0          AAY90071.1 BMP4 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-XZT65619.5.5                                                                                                                                                             TGA------------------------------------------------------------------------------------------------------TGA---------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------ATG---------------------------------------------------TGA------------------------------------------------------------------TGA------TAG---------------TAA---------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------------TAA---TGA------------------------------------------------------TGA---------TGA---------------------------TGA---------------------------------------------------TAA---------------TAA---TAA------------------------------------TAG------------------------TAG---------------------------------------------ATG---TAA------------------------------------TGA------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------TAG---------------ATG------------------------------------------------TAG------------------------------------------------------------------------TAA---------TAG---TGA---------------------------------------------------TAA---------TAG---------------------------------------TAA---------------------------------------------------------------ATG---------TAA---------TAG------TAG------------------------------------------TAA---------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------TAA------TGA---TAA---------------------TGA---------------------------------------------------------------------------------------------------TAGTAG------------------------------------------------TAG------------------------------TAGTAATAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2  SIG                                 Xt7.1-IMAGE:8961436.5                                         TATCATCTCCATCTGCAAACTGCGTCCCGAGTCCCACTGAGCTTTTCCACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAGTGAGTAGACTTTCTGTTCATTCTGTATTTTTCATCTCCCCCCTTGTGTACTTTGCCCGTAGCTGCCCTCCTGCATAGGAACCCCACGGCTCTGGGTACTTACTGCTGAGGCTATGGCAGGACCTGAGACAATGTTGAGCCCCCCCGCAGCGCTCTAGGACAGAAGTGTGCTACACATCTAGAACGGCAAGTCAGTCTTCTGCGCTCCAGGTGTTGGAGAACTACAAGTACCAACATTCTTTGGCCAGGTTCGCTGAACTGGGGTGGGGGGGTCGGAGTGTTGTAGTTCTTTAGCAGCTGGATAGCCGAGCGTTACGTGCGCTTGTGCCGGAGGGGGACTGATAGCGGCATGTATCACAGCTGTAGCGCCGACACATCGCGGGCTATCGGGTTGCAGAACACATGATCCAGCTGCCCGGAGCGCTGGCACTTGTTGCAAAAGGGCAAATGGCAGGGGCAATTCTATAGCTGCTGATCGTGCTAGGAGTCAGACTGGTGCTAATTGTCTGGAGCCCGGGAGACGCTCACAGTCAGATTAGCAACAGGATGGCGGTGACTATCTGATAATGAGGGATGTGACTGGGAACAAGTTATAGCCCAAGAAACCCCAGGCACCCCCCCTCTCGCCCTGCCCCGGGTGGCTCAGTGGAACTGTCCTTGTCCTATTATTTGCTTTGATCCCGCTCTATCACTTGATTTGAGTCTAATCCCCTACAGATCCTCCCTATTTATTTGCATGTATTTTTGTTCTGCACCCTCCAGAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGATACAATAACAGCAAGTGGAACATGATAATAGGCTGCTGGACCCGGCTATCCACACATGTGACCAGTGGAAAGTTTGAGTAGCCTGCATATAAGTGACCCGGATACAATAACATGGCTGCTTGAGTGTCCTCACAACAACTTCAGGAGCTGAGTATCTTTTTTCCAAGAGCACGTCCAGACCTTATTATCCTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATAACTCGCGAGCATCTTATGATCACGATGGCGGATCTGAATGACTCGACAGCTTATGCATGGATGCCATCTGCGATCACTAACCCACTACATGCTATGTACAACTCGTACCCGTAACTCAGCATCCAAAGCGGGTGCGTCCCCCAGATCGAGTGCTTCTCATGCTTATTGATGATAGACAAGTCGTCCTAAAACTATCAGAGATGTGTGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCAAACAAAAGACTGTAAGGGCTGGACTCTTTCCACTGAACATTCACCTTGACCTTATTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCATTATTTTAAACATAAGCTACTTCTTTGTACAATGTGTTTATAAATGTACATTAGGATGAATATGGATTTATATGGGAATAGAGTATTTTTTCTATAAATTACCTTGTGTTAATATTTATTGGCAATATGGCTTAAAACCCCTGCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATACCTCCCACCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAA
                                                  Xt7.1-CHK-1008282886                                               CTCCATCTGCAAACTGCGTCCCGAGTCCCACTGAGCTTTTCCACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAGTGAGTAGACTTTCTGTTCATTCTGTATTTTTCATCTCCCCCCTTGTGTACTTTGCCCGTAGCTGCCCTCCTGCATAGGAACCCCACGGCTCTGGGTACTTACTGCTGAGGCTATGGCAGGACCTGAGACAATGTTGAGCCCCCCCGCAGCGCTCTAGGACAGAAGTGTGCTACACATCTAGAACGGCAAGTCAGTCTTCTGCGCTCCAGGTGTTGGAGAACTACAAGTACCAACATTCTTTGGCCAGGTTCGCTGAACTGGGGTGGGGGGGTCGGAGTGTTGTAGTTCTTTAGCAGCTGGATAGCCGAGCGTTACGTGCGCTTGTGCCGGAGGGGGACTGATAGCGGCATGTATCACAGCTGTAGCGCCGACACATCGCGGGCTATCGGGTTGCAGAACACATGATCCAGCTGCCCGGAGCGCTGGCACTTGTTGCAAAAGGGCAAATGGCAGGGGCAATTCTATAGCTGCTGATCGTGCTAGGAGTCAGACTGGTGCTAATTGTCTGGAGCCCGGGAGACGCTCACAGTCAGATTAGCAACAGGATGGCGGTGACTATCTGATAATGAGGGATGTGACTGGGAACAAGTTATAGCCCAAGAAACCCCAGGCACCCCCCCTCTCGCCCTGCCCCGGGTGGCTCAGTGGAACTGTCCTTGTCCTATTATTTGCTTTGATCCCGCTCTATCACTTGATTTGAGTCTAATCCCCTACAGATCCTCCCTATTTATTTGCATGTATTTTTGTTCTGCACCCTCCAGAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGATACAATAACAGCAAGTGGAACATGATAATAGGCTGCTGGACCCGGCTATCCACACATGTGACCAGTGGAAAGTTTGAGTAGCCTGCATATAAGTGACCCGGATACAATAACATGGCTGCTTGAGTGTCCTCACAACAACTTCAGGAGCTGAGTATCTTTTTTCCAAGAGCACGTCCAGACCTTATTATCCTAGCGAAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGTGTAAATAACTCGCGAGCATCTTATGATCACGATGGCGGATCTGAATGACTCGACAGCTTATGCATGGATGCCATCTGCGATCACTAACCCACTACATGCTATGTACAACTCGTACCCGTAACTCAGCATCCAAAGCGGGTGCGTCCCCCAGATCGAGTGCTTCTCATGCTTATTGATGATAGACAAGTCGTCCTAAAACTATCAGAGATGTGTGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCAAACAAAAGACTGTAAGGGCTGGACTCTTTCCACTGAACATTCACCTTGACCTTATTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCATTATTTTAAACATAAGCTACTTCTTTGTACAATGTGTTTATAAATGTACATTAGGATGAATATGGATTTATATGGGAATAGAGTATTTTTTCTATAAATTACCTTGTGTTAATATTTATTGGCAATATGGCTTAAAACCCCTGCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATACCTCCCxCCCNCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATC
  5  -1   2       ext Gas                            TGas037a20.p1kSP6 CATTATATCCCAATATTCATTTTAGGAACCAGTTCCATAGTATCATCTCCATCTGCAAACTGCGTCCCGAGTCCCACTGAGCTTTTCCACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAGTGAGTAGACTTTCTGTTCATTCTGTATTTTTCATCTCCCCCCTTGTGTACTTTGCCCGTAGCTGCCCTCCTGCATAGGAACCCCACGGCTCTGGGTACTTACTGCTGAGGCTATGGCAGGACCTGAGACAATGTTGAGCCCCCCCGCAGCGCTCTAGGACAGAAGTGTGCTACACATCTAGAACGGCAAGTCAGTCTTCTGCGCTCCAGGTGTTGGAGAACTACAAGTACCAACATTCTTTGGCCAGGTTCGCTGAACTGGGGTGGGGGGGTCGGAGTGTTGTAGTTCTTTAGCAGCTGGATAGCCGAGCGTTACGTGCGCTTGTGCCGGAGGGGGACTGATAGCGGCATGTATCACAGCTGTAGCGCCGACACATCGCGGGCTATCGGGTTGCAGAACACATGATCCAGCTGCCCGGAGCGCTGGCACTTGTTGCAAAAGGGCAAATGGCAGGGGCAATTCTATAGCTGCTGATCGTGCTAGGAGTCAGACTGGTGCTAATTGTCTGGAG
  5   1   2       ext Gas       in                   TGas140b21.p1kSP6                             ACCAGTTCCATAGTATCATCTCCATCTGCAAACTGCGTCCCGAGTCCCACTGAGCTTTTCACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAGTGAGTAGACTTTCTGTTCATTCTGTATTTTTCATCTCCCCCCTTGTGTACTTTGCTCGTAGCTGCCCTCCTGCATAGGAACCCCACGGCTCTGGGTACTTACTGCTGAGGCTATGGCAGGACCTGAGACAATGTTGAGCCCCCCCGCAGCGCTCTAGGACAGAAGTGTGCTACACATCTAGAACGGCAAGTCAGTCTTCTGCGCTCCAGGTGTTGGAGAACTACAAGTACCAACATTCTTTGGCCAGGTTCGCTGAACTGGGGTGGGGGGGTCGGAGTGTTGTAGTTCTTTAGCAGCTGGATAGCCGAGCGTTACGTGCGCTTGTGCCGGAGGGGGACTGATAGCGGCATGTATCACAGCTGTAGCGCCGACACATCGCGGGCTATCGGGTTGCAGAACACATGATCCAGCTGCCCGGAGCGCTGGCACTTGTTGCAAAAGGGCAAATGGCAGGGGCAATTCTATAGCTGCTGATCGTGCT
  5   1   2       ext Gas7 PIPE in                         XZG27985.5p                                GTTCCATAGTATCATCTCCATCTGCAAACTGCGTCCCGAGTCCCACTGAGCTTTTCCACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAGTGAGTAGACTTTCTGTTCATTCTGTATTTTTCATCTCCCCCCTTGTGTACTTTGCCCGTAGCTGCCCTCCTGCATAGGAACCCCACGGCTCTGGGTACTTACTGCTGAGGCTATGGCAGGACCTGAGACAATGTTGAGCCCCCCCGCAGCGCTCTAGGACAGAAGTGTGCTACACATCTAGAACGGCAAGTCAGTCTTCTGCGCTCCAGGTGTTGGAGAACTACAAGTACCAACATTCTTTGGCCAGGTTCGCTGAACTGGGGTGGGGGGGTCGGAGTGTTGTAGTTCTTTAGCAGCTGGATAGCCGAGCGTTACGTGCGCTTGTGCCGGAGGGGGACTGATAGCGGCATGTATCACAGCTGTAGCGCCGACACATCGCGGGCTATCGGGTTGCAGAACACATGATCCAGCTGCCCGGAGCGCTGGCACTTGTTGCAAAAGGGCAAATGGCAGGGGCAATTCTATAGCTGCTGATCGTGCTAGGAGTCAGACTGGTGCTAATTGTCTGGAGCCCGGGAGACGCTCACAGTCAGATTAGCAACAGGATGGCGGTGACTATCTGATAATGAGGGATGTGACTGGGGAACAAGTTATAGCCCCAAGAAACCCCAGGCACCCCCCCCTCTCGCCCTGGCCCCGGGTGGCTCAGTGGAAAC
  5   1   4      seed Gas8      in                          st29i12.5p                                        GTATCATCTCCATCTGCAAACTGCGTCCCGAGTCCCACTGAGCTTTTCCACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAGTGAGTAGACTTTCTGTTCATTCTGTATTTTTCATCTCCCCCCTTGTGTACTTTGCCCGTAGCTGCCCTCCTGCATAGGAACCCCACGGCTCTGGGTACTTACTGCTGAGGCTATGGCAGGACCTGAGACAATGTTGAGCCCCCCCGCAGCGCTCTAGGACAGAAGTGTGCTACACATCTAGAACGGCAAGTCAGTCTTCTGCGCTCCAGGTGTTGGAGAACTACAAGTACCAACATTCTTTGGCCAGGTTCGCTGAACTGGGGTGGGGGGGTCGGAGTGTTGTAGTTCTTTAGCAGCTGGATAGCCGAGCGTTACGTGCGCTTGTGCCGGAGGGGGACTGATAGCGGCATGTATCACAGCTGTAGCGCCGACACATCGCGGGCTATCGGGTTGCANAACACATGATCCAGCTGCCCGGAGCGCTGGCACTTGTTGCAAAAGGGCAAATGGCAGGGGCAATTCTATAGCTGCTGATCGTGCTA
  5   1   3   22   nb Tad5 5g                              XZT50806.5p .........................................................AACTGCGTCCCGAGTCCCACTGAGCTTTTCCACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAGTGAGTAGACTTTCTGTTCATTCTGTATTTTTCATCTCCCCCCTTGTGTACTTTGCCCGTAGCTGCCCTCCTGCATAGGAACCCCACGGCTCTGGGTACTTACTGCTGAGGCTATGGCAGGACCTGAGACAATGTTGAGCCCCCCCGCAGCGCTCTAGGACAGAAGTGTGCTACACATCTAGAACGGCAAGTCAGTCTTCTGCGCTCCAGGTGTTGGAGAACTACAAGTACCAACATTCTTTGGCCAGGTTCGCTGAACTGGGGTGGGGGGGTCGGAGTGTTGTAGTTCTTTAGCAGCTGGATAGCCGAGCGTTACGTGCGCTTGTGCCGGAGGGGGACTGATAGCGGCATGTATCACAGCTGTAGCGCCGACACATCGCGGGCTATCGGGTTGCAGAACACATGATCCAGCTGCCCGGAGCGCTGGCACTTGTTGCAAAAGGGCAAATGGCAGGGGCAATTCTATAGCTGCTGATCGTGCTAGGAGTCAGACTGGTGCTAATTGTCTGGAGCCCGGGAGACGCTCACAGTCAGATTAGCAACAGGATGGCGGTGACTATCTGATAATGAGGGATGTGACTGGGAACAAGTTATAGCCCAAGAAACCCCAGGCACCCCCCCTCTCGCCCTGCCCCGGGTGGCTCAGTGGAACTGTCCTTGTCCTATTATTTGCTTTGATCCCGCTCTATCACTTGATTTGAGTCTAATCCCCTACAGATCCTCCCCTATTATTTGCATGTATTTTTG
  3   1   2       ext Gas       in                    TGas140b21.q1kT7                                                                                                                                                                                                                                                       CTGGGTACTTACTGCTGAGGCTATGGCAGGACCTGAGACAATGTTGAGCCCCCCCGCAGCGCTCTAGGACAGAAGTGTGCTACACATCTAGAACGGCAAGTCAGTCTTCTGCGCTCCAGGTGTTGGAGAACTACAAGTACCAACATTCTTTGGCCAGGTTCGCTGAACTGGGGTGGGGGGGTCGGAGTGTTGTAGTTCTTTAGCAGCTGGATAGCCGAGCGTTACGTGCGCTTGTGCCGGAGGGGGACTGATAGCGGCATGTATCACAGCTGTAGCGCCGACACATCGCGGGCTATCGGGTTGCAGAACACATGATCCAGCTGCCCGGAGCGCTGGCACTTGTTGCAAAAGGGCAAATGGCAGGGGCAATTCTATAGCTGCTGATCGTGCTAGGAGTCAGACTGGTGCTAATTGTCTGGAGCCCGGGAGACGCTCACAGTCAGATTAGCAACAGGATGGCGGTGACTATCTGATAATGAGGGATGTGACTGGGAACAAGTTATAGCCCAAGAAACCCCAGGCACCCCCCCTCTCGCCCTGCCCCGGGTGGCTCAGTGGAACTGTCCTTGTCCTATTATTTGCTTTGATCCCGCTCTATCACTTGATTTGAGTCTAATCCCCTACAGATCCTCCCTATTTATTTGCATGTATTTTTGTTCTGCACCCTCCAGAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTC
  3   1   2       ext Gas7 PIPE in                         XZG27985.3p                                                                                                                                                                                                                                                                                                                                                                                                               GCCAGGTTCGCTGAACTGGGGTGGGGGGGTCGGAGTGTTGTAGTTCTTTAGCAGCTGGATAGCCGAGCGTTACGTGCGCTTGTGCCGGAGGGGGACTGATAGCGGCATGTATCACAGCTGTAGCGCCGACACATCGCGGGCTATCGGGTTGCAGAACACATGATCCAGCTGCCCGGAGCGCTGGCACTTGTTGCAAAAGGGCAAATGGCAGGGGCAATTCTATAGCTGCTGATCGTGCTAGGAGTCAGACTGGTGCTAATTGTCTGGAGCCCGGGAGACGCTCACAGTCAGATTAGCAACAGGATGGCGGTGACTATCTGATAATGAGGGATGTGACTGGGAACAAGTTATAGCCCAAGAAACCCCAGGCACCCCCCCTCTCGCCCTGCCCCGGGTGGCTCAGTGGAACTGTCCTTGTCCTATTATTTGCTTTGATCCCGCTCTATCACTTGATTTGAGTCTAATCCCCTACAGATCCTCCCTATTTATTTGCATGTATTTTTGTTCTGCACCCTCCAGAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAA
  5   1   2       ext Gas8 5g3  in                          st87f16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATGAATCCAGCTGCCCGGAGCGCTGGCACTTGTTGCAAAAGGGCAAATGGCAGGGGCAATTCTATAGCTGCTGATCGTGCTAGGAGTCAGACTGGTGCTAATTGTCTGGAGCCCGGGAGACGCTCACAGTCAGATTAGCAACAGGATGGCGGTGACTATCTGATAATGAGGGATGTGACTGGGAACAAGTTATAGCCCAAGAAACCCCAGGCACCCCCCCTCTCGCCCTGCCCCGGGTGGCTCAGTGGAACTGTCCTTGTCCTATTATTTGCTTTGATCCCGCTCTATCACTTGATTTGAGTCTAATCCCCTACAGATCCTCCCTATTTATTTGCATGTATTTTTGTTCTGCACCCTCCAGAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGG
  5   1   3        nb Gas8 5g                               st88f16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCTTGTCCTANTATTTGCTTTGATCCCGNTCTATCACTTGATTTGAGTCTAATCCCCTACGGATCCTCCCTATTTATTTGCATGTATTTTTGNTCTGCACCCTCCGGAGACACCNTGATTCCTGGTAACCGAATGATGATGGTCATTTTATTATGCCNAGTCCTGCT
  5   1   2       ext 1030 5x                         IMAGE:7094329.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCAGAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGATACAATAACAGCAAGTGGAACATGATAATAGGCTGCTGGACCCGGCTATCCACACATGTGACCAGTGGAAAGTTTGAGTAGCCTGCATATAAGTGACCCGGATACAATAACATGGCTGCTTGAGTGTCCTCACAACAACTTCAGGAGCTGAGTATCTTTTTTCCAAGAGCACGTCCAGACCTTATTATCCTAGCGAAGCGC
  5  -1   2       ext In63                            IMAGE:8961436.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGTGTAAATAACTCGCGAGCATCTTATGATCACGATGGCGGATCTGAATGACTCGACAGCTTATGCATGGATGCCATCTGCGATCACTAACCCACTACATGCTATGTACAACTCGTACCCGTAACTCAGCATCCAAAGCGGGTGCGTCCCCCAGATCGAGTGCTTCTCATGCTTATTGATGATAGACAAGTCGTCCTAAAACTATCAGAGATGTGTGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCAAACAAAAGACTGTAAGGGCTGGACTCTTTCCACTGAACATTCACCTTGACCTTATTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCATTATTTTAAACATAAGCTACTTCTTTGTACAATGTGTTTATAAATGTACATTAGGATGAATATGGATTTATATGGGAATAGAGTATTTTTTCTATAAATTACCTTGTGTTAATATTTATTGGCAATATGGCTTAAAACCCCTGCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATACCTCCCACCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATCTG
  3   1   2       ext Gas8 5g3  in                          st87f16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTNTTTTAAACNTAAGCTACTTCTTTGTACAATGGGTTTNTAAATGTNCNTTAGGNTGAATNTGGATTTNTNTGGGAATAGNGTNTTTTTTCTATAAATTACCNTGNGNTAATATTTATTGGCNATATGGNTTAAAACCCCNGCCCCCCCGTAAATGAATGTAAATTAAGNTGNGGCNTATTGCNGTNTGCNTGTCNGNTGAATTTAAATTCCCTACTTNTGGGNANAGAACTACNTGNCNTGNTAACCCGGGGGGGGGNTTATTTTTTTCAAATTCNTTTGCNNGGGGNCTTTGAAACCCCTATGNTGTTNTGCTAAAGTNTGTCNTACCTCCCCCCCNCCTGTTGTNTAGCCTAAGTTCAAAGCTNTGCNTAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACCAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAA
  3   1   4      seed Gas8      in                          st29i12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGNCATACCNCCCCCCCNCCTGTTGNTTNGCCTAAGTTCAAANCTCNGCATANNTTTTTTTTTTTTNAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAANTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATCTGATCTTATTTTCCAAAAGCAAGTAAGAAATTCATTTTGCGTTGGCAATTTTTCTTTATTTTTTGGGGGGGCTTGGAAGTTATCCAAAAATGTTCTGTCCCTAAGCTCTTGTGTAGGAAGTATAGGGAAAATATTTCTACATTTGTTTGTCAATTATTAAACTTCTCTAAACCTTAGAAACTAAAAAAGGGACAGCTTAGCTGAAACCAATAAAAACTGCTAAGTGGAAAGTTTGCCAAAGCCTCAGCTTCCTGGAGAGTGCAGGTGGAGCGACCAGATTAGAGCCTCAGGCTAACAGGACNGCCTGCTGCTTTTGTGTNGTAACTCTTCAGAAAGGGCCCTT
  5   1   2  SIG                                      Xt7.1-XZT65619.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCCATAGTATCATCTCCATCTGCAAACTGCGTCCCGAGTCCCACTGAGCTTTTCCACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCATTATTTTAAACATAAGCTACTTCTTTGTACAATGTGTTTATAAATGTACATTAGGATGAATATGGATTTATATGGGAATAGAGTATTTTTTCTATAAATTACCTTGTGTTAATATTTATTGGCAATATGGCTTAAAACCCCTGCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATACCTCCCACCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATCTGATCTTATTTTCCAAAAGCAAGTAAGAAATTCATTTTGCGTTGGCAATTTTTCTTTATTTTTTGGGGGGGCTTGGAAGTTATCCAAAAATGTTCTGTCCCTAAGCTCTTGTGTAGGAAGTATAGGGAAAATATTTCTACATTTGTTTGTCAATTATTAAACTTCTCTAAACCTTAGAAACTAAAAAAGGGACAGCTTAGCTGAAACCAATAAAAACTGCTAAGTGGAAAGTTTGCCAAAGCCTCAGCTTCCTGGAGAGTGCAGGTGGAGCGACCAGATTAGAGCCTCAGGCTAACAGGACTGCCTGCTGCTTTTGTGTTGTAACTCTTCAGAAAGGGCCCTTTTAACTGTATTGAGCTTAAATAAATTGTTTTAA
                                                  Xt7.1-CHK-1008282884                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTATCATCTCCATCTGCAAACTGCGTCCCGAGTCCCACTGAGCTTTTCCACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCATTATTTTAAACATAAGCTACTTCTTTGTACAATGTGTTTATAAATGTACATTAGGATGAATATGGATTTATATGGGAATAGAGTATTTTTTCTATAAATTACCTTGTGTTAATATTTATTGGCAATATGGCTTAAAACCCCTGCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATACCTCCCACCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATCTGATCTTATTTTCCAAAAGCAAGTAAGAAATTCATTTTGCGTTGGCAATTTTTCTTTATTTTTTGGGGGGGCTTGGAAGTTATCCAAAAATGTTCTGTCCCTAAGCTCTTGTGTAGGAAGTATAGGGAAAATATTTCTACATTTGTTTGTCAATTATTAAACTTCTCTAAACCTTAGAAACTAAAAAAGGGACAGCTTAGCTGAAACCAATAAAAACTGCTAAGTGGAAAGTTTGCCAAAGCCTCAGCTTCCTGGAGAGTGCAGGTGGAGCGACCAGATTAGAGCCTCAGGCTAACAGGACTGCCTGCTGCTTTTGTGTTGTAACTCTTCAGAAAGGGCCCTTTTAACTGTATTGAGCTTAAATAAATTG
  0   1   1           HeRe FL                   EC2CAA16DD12.FL-Pollet                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGGAACCAGTTCCATAGTATCATCTCCATCTGCAAACTGCGTCCCGAGTCCCACTGAGCTTTTCCACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAgtGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACGAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATAAAAGAAAAAAAATaaaataaagtcca
  0   1   1           Neu  FLt3                   TNeu045c17.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGCAAACTGCGTCCCGAGTCCCACTGAGCTTTTCCACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCC
  0   1   1           Neu  FLq                    TNeu015d14.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTTTTTAATGGTCATCTGATACTGCTCCAGTTCTTAGCTATTTGATGCTAAAAATCAGTAAGTCCTTAGCTACAACTATTAAACAGAAGCCTTATAAGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAAAAAAAAAAAAAAA
  5   1   2   12  add Fat1 5g3  in                        CABC11461.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGCGCTGGCACTTGTTGCAAAAGGGCAAATGGCAGGGGCAATTCTATAGCTGCTGATCGTGCTAGGAGTCAGACTGGTGCTAATTGTCTGGAGCCCGGGAGACGCTCACAGTCAGATTAGCAACAGGATGGCGGTGACTATCTGATAATGAGGGATGTGACTGGGAACAAGTTATAGCCCAAGAAACCCCAGGCACCCCCCCTCTCGCCCTGCCCCGGGTGGCTCAGTGGAACTGTCCTTGTCCTATTATTTGCTTTGATCCCGCTCTATCACTTGATTTGAGTCTAATCCCCTACAGATCCTCCCTATTTATTTGCATGTATTTTTGTTCTGCACCCTCCAGAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGC
  5   1   2       add Gas8 5g                               st52m12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCGCGGGCTATCGGGTTGCAGAACACATGATCCAGCTGCCCGGAGCGCTGGCACTTGTTGCAAAAGGGCAAATGGCAGGGGCAATTCTATAGCTGCTGATCGTGCTAGGAGTCAGACTGGTGCTAATTGTCTGGAGCCCGGGAGACGCTCACAGTCAGATTAGCAACAGGATGGCGAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCA
  5   1   2       ext HeRe FL   in                     EC2CAA16DD12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGGAACCAGTTCCATAGTATCATCTCCATCTGCAAACTGCGTCCCGAGTCCCACTGAGCTTTTCCACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTC
  3   1   3        nb Neu       in                    TNeu059f22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCCATAGTATCATCTCCATCTGCAAACTGCGTCCCGAGTCCCACTGAGCTTTTCCACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGC
  5   1   3        nb Neu       in                   TNeu059f22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCATAGTATCATCTCCATCTGCAAACTGCGTCCCGAGTCCCACTGAGCTTTTCCACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGC
  5   1   2       ext Gas8 5g3  in                           st6l12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCATCTCCATCTGCAAACTGCGTCCCGAGTCCCACTGAGCTTTTCCACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGT
  5   1   3        nb Neu  FLt3                      TNeu045c17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGCAAACTGCGTCCCGAGTCCCACTGAGCTTTTCCACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCC
  5   1   3        nb Lun1      in                        CABD11145.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCGAATTCGGCCGAGGTCCACAAATTTCTGTCCAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGNTAGGATAAGTCGATCATTATTACCTCAAGAAGATGCAGACTGGTCACAGATG
  5   1   2   10  ext Fat1 5g3  in                         CABC5804.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGAGCTTTTCCACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCCTCACCAAACAAAAACTTATCAGGNGAAGCATGNTAGGATAAGTCGATCATTATTACCCTCAGAGGATGCAGAC
  5   1   3   14   nb Gas6 5g3  in                         ANBT1301.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CACAAATTTCTGTCCAAGATTGGCAGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGNGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTG
  5   1   2       ext Gas8      in                          st89c06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTAGGAGGCACTAACCATGCCAGCCTGATACCTGAGACGGGCAAGAAGAAAGTAGTGGCCGAGATTCAGGGAGGTAGAAGGTCCGCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATG
  5   1   2       ext Lun1      in                         CABD8987.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATC
  5   1   0       chi Gas7      in                          XZG3231.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGATCCAAAGCATCTTCATATATCCTTGCTGAGGTATCACCTCTACATTGATACAGTACCCCAATATGACAGCCAGGGACCTGCAATTCCTTTACTCTCCCTTGTTGCTTTCTACTTTGGCCAACTCCAAAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCCATGGAGATGTCCATTTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAA
  5   1   3        nb Gas8                                   st1k13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGTTCGGCCTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCANACTGGTCACAGATGANACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAANTCCAAAACA
  3  -1   3        nb Limb      in                         CBSU527.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGTTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACT
  3  -1   3        nb Gas       in                    TGas125e13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGTTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTNCAGCATCCCANAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGC
  3  -1   3        nb TpA       in                   TTpA068h16.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGTGGTGGTGCCCGCGTATATGCGGGACCTGTACAGGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTA
  5   1   3        nb Gas                            TGas047g07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTGCCCGCGTATATGCGGGACCTGTACAGGGGGGANGCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGGGGGACCGCANCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCANCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCANGGGAAGCATGTAAGGATAAGTCGATCATTATTACC
  5   1   3        nb Gas7      in                         XZG33067.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGTATATGCGGGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTACACGATATCAGCATGGAGTACCCGGAGAGACCGACCAGCCGGGCTAACACCGTGAGGAGCTTCCATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCCAAAGCGTNGTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGA
  5   1   0       chi Neu  FLq                       TNeu015d14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCGGGGTTTTTTTTTAATGGTCATCTGATACTGCTCCAGTTCTTAGCTATTTGATGCTAAAAATCAGTAAGTCCTTAGCTACAACTATTAAACAGAAGCCTTATAAGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAATAAACATTGCCGGGAGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGAC
  5   1   4      seed Tad5      in                         XZT65619.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCATGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTG
  5   1   2       ext TbA       in                   TTbA072g21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTANAAACTATCANGAGATGGTGGTG
  5   1   3        nb Eye       in                         CCAX6447.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGC
  5   1   3        nb Gas7                                 XZG54873.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTAAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGAAGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCAATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCA
  3   1   2       ext Lun1      in                         CABD8987.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGTTATGAAACCCATAACAGCAAGTGGACACATGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCATTATTTTAAACAT
  3   1   2       ext Gas8      in                          st89c06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATGAAACCAATAACAGCAAGTGGACACNTGATAAGTAGGCTGCTGGACACACGGCTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTT
  3   1   2       add Fat1 5g3  in                        CABC11461.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCATTATTTAAAC
  3   1   2       ext Fat1 5g3  in                         CABC5804.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTTTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATTTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTTTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATATAAATAAG
  3   1   2       ext Gas8 5g3  in                           st6l12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATAAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTGACAAAATATATT
  3   1   2       add Gas  5x3  out                   TGas094i15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTAAAGAAGAAAAAAAATAAAATAAGTCATTATTTAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas                            TGas094g13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATCACATTGCCGGAGGCATTCCCTCTATGTGGATTTCAGCGATGCCGGCTGGAATG
  3   1   2       ext HeRe FL   in                     EC2CAA16DD12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGGCTTGCCATTGAGGTTGTTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACGAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTA
  5  -1   3        nb Gas                            TGas010f01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGATTCTTTCCACTGAACATTCACCTTGACCTTATTTATGATTTTATGTGCAAATGTTTTGACAATATGATCATAATTTTGACAAAATAATTTATAACTACGTATTAAAAAAAAAAAAA
  5  -1   3        nb Gas                            TGas012n10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCATGTAAGGATAAGTCGATCATTATTACTCNAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTAGAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCA
  5  -1   3        nb Gas       in                   TGas125e13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTAAAAAAAAAAAAAAA
  5   1   3        nb Gas7                                 XZG19023.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCACAGATGAGACCGTCTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAATAAGTCCTTATTTTAAACATAAGCTACTTCTTTGTACAATGTGTTTATAAATGTACATTAGGGATGAATATGGATTTATATGGGGAATAAGAGT
  5  -1   3        nb TpA       in                   TTpA068h16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCATTATTTTAAACATAAGCTACTTCTTTGTACAATGTGTTTATAAATGTACATTAGGATGAATATGGATTTATATGGGAATAGAGTATTTTTTCTATAAATTACCTTGTGTTAATATTTATTGGCAATATGGCTTAAAACCCCTGCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAAAAAAAAAAAAAAAAAACCCCGGG
  3   1   3        nb BrSp      in                     EC2BBA22AH05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATAAAAGAAAAAA
  5   1   3        nb BrSp      in                     EC2BBA22AH05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAAAGACCCCGTAAAAAAAATAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCATTATTTTAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas7      in                         XZG14963.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCTTTATGTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGAAAAAAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCATTATTTTAAACATAAGCTACTTCTTTGTACAATGTGTTTATAAATGTACATTAGGATGAATATGGATTTATATGGGAATAGAGTATTTTTTCTATAAATTACCTTGTGTTAATATTTATTGGCAATATGGCTTAAAACCCCTGCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATCATTTGCATGGAGACTCTGA
  5   1   2       ext Gas7      in                         XZG35960.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGGATTTCAGCGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCATTATTTTAAACATAAGCTACTTCTTTGTACAATGTGTTTATAAATGTACATTAGGATGAATATGGATTTATATGGGAATAGAGTATTTTTTCTATAAATTACCTTGTGTTAATATTTATTGGCAATATGGCTTAAAACCCCTGCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATACCTCCCACCCTCCTGTTGTAT
  5   1   3        nb Neu                            TNeu020b16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGATGTTGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCTTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCATTATTTTAAACATAAGCTACTTCTTTGTACAATGTGTTTATAAATGTACATTAGGATGAATATGGATTTATATGGGAATAGAGTATTTTTTCTATAAATTACCTTGTGTTAATATTTATTGGCAATATGGCTTAAAACCCCTGCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTA
  5   1   3        nb Gas                            TGas028j03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCCGGGCAGGCTTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAAATAAAATAAGTCATTATTTTAAACTT
  5   1   3        nb Neu                            TNeu058g23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGATCTGAGTGCTATCTCCATGCTTTATTTGGATGAATATGACAAAGTCGTCCTTAAAAACTATCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATT
  3   1   3        nb Lun1      in                        CABD11145.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGGGGGATTGTCCTTTTCCCTGGGGGGGTCCCCTAAACTCAACTAACCATGGTTTTGTACAAATTTGGGTAAATTTTGTTAACTCAAGCATCCCAAAAGGGGGTTGGGTCCCCCCAGATTTGGGGGCTATTTCCATGCTTTTTTTGGAGGAATATGAAAAAGTTGTCCTTAAAAACTTTCAGGAAATGGTGGTGGAAGGGTGTGGGTGCCTTTAATTTTGGGCCCCAAACAAAAGACTGTTAAGGGGGGGATTTTTTTCCCCGGAACATTCCCCTTGCCCTTTTTTATGACTTTTTTGGGCAAATGTTTTGCCAATATGTTCATATTTTTTGCCAAAATTTTTTTTTAACTTGGTTTTAAAGGAAAAAAAATAAAATAGGTCTTTTTTTTAAACATAAGCTATTTTTTTGTCCAAGGGGTTTTTAAATGTCCTTTGGGGGGAATTGGGTTTTTTTTGGGAATGGGGTTTTTTTTTTTTAAATTCCCTTGGGTTAATTTTTTTTGGCAATTGGGGTTAAAACCCCTGCCCCCCGGTAAAGGAATGTA
  5  -1   2       add AbdN                               IMAGE:7022095                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAAAAGAATTCTTTTAAAGGGGGGTGGGGAATTTTTTTTTTTCCCCCCGGGAACACATTTTCCCCCTCTTGACCCCTTATTTTAAAGAAACTTTTTAAGGGGGACAAAAATTTTTTTGGCCCAATTGTGTTTCCATTTTTTTTTGGCCAAAAATAAAATTTTTATAACCTCGGGTTTTTAAAAGGAAAAAAAAATTAAAATTAGGTCCTTTATTTTAAACTTAAAGCTATTTCTTTGGTACAAAGGGGTTTTTAAATGGTACATTAAGAGGAATAATGGATTTATATGGGAATAGAGTATTTTTTTTATAAAATACCTTGTGGTTAATATTTATGGCAAATATGGCTAAAAACCCCTGCCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTGAATNTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATACCTCCCACCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAANNACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATCTGATCTTATTTTC
  5   1   3        nb Gas7                                 XZG11941.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTGGAGGGTGTGGGTGCCGTTAAGTCTGAGACCCAAACAAAAGACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCATTATTTTAAACATAAGCTACTTCTTTGTACAATGTGTTTATAAATGTACATTAGGATGAATATGGATTTATATGGGAATAGAGTATTTTTTCTATAAATTACCTTGTGTTAATATTTATTGGCAATATGGCTTAAAACCCCTGCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATACCTCCCACCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCANAGGTTACAGGATTCTTTTG
  3   1   3        nb Gas6 5g3  in                         ANBT1301.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGACTGTTAAGGGGTGGACTTCTTTCCACTGAACATCACCCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCATTATTTTAAACATAAGCTACTTCTTTGTACAATGTGTTTATAAATGTACATTAGGATGAATATGGATTTATATGGGAATAGAGTATTTTTTCTATAAATTACCTTGTGTTAATATTTATTGGCAATATGGCTTAAAACCCCTGCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATACCTCCCACCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATCTGATCTTATTTTCC
  3   1   2       ext Gas7      in                         XZG35960.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCATTATTTTAAACATAAGCTACTTCTTTGTACAATGTGTTTATAAATGTACATTAGGATGAATATGGATTTATATGGGAATAGAGTATTTTTTCTATAAATTACCTTGTGTTAATATTTATTGGCAATATGGCTTAAAACCCCTGCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATACCTCCCACCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATCTGATCTTATTTTCCAAA
  3   1   3        nb Gas7      in                         XZG33067.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCATTATTTTAAACATAAGCTACTTCTTTGTACAATGTGTTTATAAATGTACATTAGGATGAATATGGATTTATATGGGAATAGAGTATTTTTTCTATAAATTACCTTGTGTTAATATTTATTGGCAATATGGCTTAAAACCCCTGCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATACCTCCCACCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATCTGATCTTATTTTCC
  3   1   2       add Gas7      in                          XZG3231.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAATGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAATAAAATAAGTCATTATTTTAAACATAAGCTACTTCTTTGTACAATGTGTTTATAAATGTACATTAGGATGAATATGGATTTATATGGGAATAGAGTATTTTTTCTATAAATTACCTTGTGTTAATATTTATTGGCAATATGGCTTAAAACCCCTGCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATACCTCCCACCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATCTGATCTTATTTTCC
  3   1   3        nb Eye       in                         CCAX6447.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATTTTAAACATAAGCTACTTCTTTGTACAATGTGTTTATAAATGTACATTAGGATGAATATGGATTTATATGGGAATAGAGTATTTTTTCTATAAATTACCTTGTGTTAATATTTATTGGCAATATGGCTTAAAACCCCTGCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTTTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATCCCTCCCCCCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACCCATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATCTGATCTTATTTTCC
  3   1   3        nb Gas7      in                         XZG14963.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTAAACATAAGCTACTTCTTTGTACAATGTGTTTATAAATGTACATTAGGATGAATATGGATTTATATGGGAATAGAGTATTTTTTCTATAAATTACCTTGTGTTAATATTTATTGGCAATATGGCTTAAAACCCCTGCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATACCTCCCACCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAATCTAGAAATTTCAAATAAATCTGATCTTATTTTCAAAAAAAAAAAAAAAAGG
  5   1   3        nb TpA       in                   TTpA072c03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATTGTTTCGATAGTTACCTCTGCTGTGAATATTTACTTGGCAATATGAGCTTATAACCCCTGCCCCCCTGTAAATGAATGTAGATTAAGCTGAGGCATATTGCTGTCTGCATGTCACTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGAGTATATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCCTACCTCCCACCCTCCTGTTGTATAGCCTAGGTTCAAAGCTATGCATAGTTTTTTTTCTTTTAAAACGGAGGTTAGCAAAAGGGCTGTTAAGGACCGAATTACTTTGGAAAATAATTTTTCTTTAGACATCAAAGGTTACACGGATTCTTTTGAAGGTTAAAACGCATTAAAAATGCACATAGACTTGACAAGTGATGTGTTTAAAATTGACAGACGTTTTTATTTGTATTTTTGTTACCAGAAAAAAAAATCTAGAAATTTCAAATAAATCTGATCTTATTTTCC
  3   1   3        nb Neu       out                   TNeu114o13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATATTTATTGGCAATATGGCTTAAAACCCCTGCCCCCCCTGTAAATGAATGTAAATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATACCTCCCACCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATCTGATCTTATTTTCCAAAAGCAAGTAAGAAATTCATTTTGCGTTGGCAATTTTTCTTTATTTTTTGGGGGGGCTTGGAAGTTATCCAAAAATGTTCTGTCCCTAAGCTCTTGTGTAGGAAGTATAGGGAAAATATTTCTACATTTGTTTGTCAATTATTAAACTTCTCTAAACCTTAGAAACTAAAAAAGGGACAGCTTAGCTGAAACCAATAAAAACTGCTAAGTGGAAAGTTTGCCAAAGCCTCAGCTTCCTGGAGAGTGCAGGTGGAGCGACCAGATTAGAGCCTCAGGCTAACAGGACTGCCTGCTGCTTTTGTGTTGTAACTCTTCAGAAAGGGCCCTTTTAACTGTATTGAGCTTAAATAAATTGTTTAAAACAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas7                                 XZG60862.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTAAGCTGAGGCATATTGCTGTCTGCATGTCAGTTGAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATACCTCCCACCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATCTGATCTTATTTTCCAAAAGCAAGTAAGAAATTCATTTTGCGTTGGCAATTTTTCTTTATTTTTTGGGGGGGCTTGGAAGTTATCCAAAAATGTTCTGTCCCTAAGCTCTTGTGTAGGAAGTATAGGGAAAATATTTCTACATTTGTTTGTCAATTATTAAACTTCTCTAAACCTTAGAAACTAAAAAAGGGACAGCTTAGCTGAAACCAATAAAAACTGCTAAGTGGAAAGTTTGCCAAAGCCTCAGCTTCCTGGAGAGTGCAGGTGGAGCGACCAGATTAGAGCCTCAGGCTAACAGGACTGCCTGCTGCTTTTGTGTTGTAACTCTTCAGAAAGGGCCCTTTTAACTGTATTGAGCT
  3   1   4      seed Tad5      in                         XZT65619.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAAGCTGAGGCATATTGCTGTCTGCATGTCAGTGAAATTTAAATTCCCTACTTCTGGGAATAGAACTACTTGACTTGCTAACCTGTGTGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATACCTCCCACCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATCTGATCTTATTTTCCAAAAGCAAGTAAGAAATTCATTTTGCGTTGGCAATTTTTCTTTATTTTTTGGGGGGGCTTGGAAGTTATCCAAAAATGTTCTGTCCCTAAGCTCTTGTGTAGGAAGTATAGGGAAAATATTTCTACATTTGTTTGTCAATTATTAAACTTCTCTAAACCTTAGAAACTAAAAAAGGGACAGCTTAGCTGAAACCAATAAAAACTGCTAAGTGGAAAGTTTGCCAAAGCCTCAGCTTCCTGGAGAGTGCAGGTGGAGCGACCAGATTAGAGCCTCAGGCTAACAGGACTGCCTGCTGCTTTTGTGTTGTAACTCTTCAGAAAGGGCCCTTTTAACTGTATTGAGCTTAAATAAATTGTTTTAAAC
  3   1   3        nb TpA       in                   TTpA072c03.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGGAATAGAACAACTTGACTGGCTAACCCGAGTGTGTGTTTATTTTTTCAAATTCATTGGCATGGAGACATTTGAAATCACATGATGTGGTTATGTTAAAGTCTGTCATACCTCCCACCCTCCTGTTGTATAGCCTAAGTTCAAAGGTATGCATAGTTTTTTTTTTTTTAAAAGAGAGCGTTAGCAAATAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAACCACATTAAAAATGCACATGGACTTGACAAGTGATATGTTTAAAATCGACAGATGTTTTTATCTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATCTGATCTTATTTCCAAAAAAAAAAAAAAAA
  5  -1   3        nb Limb      in                         CBSU527.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTGTGTTTATTTTTTCAAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGCCTGTCATACCTCCCACCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATCTGATCTTATTTTCCAAAAGCAAGTAAGAAATTCATTTTGCGTTGGCAATTTTTCTTTATTTTTTGGGGGGGCTTGGAAGTTATCCAAAAATGTTCTGTCCCTAAGCTCTTGTGTAGGAAGTATAGGGAAAATATTTCTACATTTGTTTGTCAATTATTAAACTTCTCTAAACCTTAGAAACTAAAAAAGGGACAGCTTAGCTGAAACCAATAAAAACTGCTAAGTGGAAAGTTTGCCAAAGCCTCAGCTTCCTGGAGAGTGCAGGTGGAGCGACCAGATTAGAGCCTCAGGCTAACAGGACTGCCTGCTGCTTTTGTGTTGTAACTCTTCAGAAAGGGCCCTTTTAACTGTATTGAGCTTAAATAAATTGTTTAAAACAG
  5   1   3        nb Tad5      in                         XZT11433.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTTTATTTTTTCAATTCATTTGCATGGAGACTCTGAAACACCTATGTTGTTATGCTAAAGTCTGTCATACCTCCCACCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATCTGATCTTATTTTCCAAAAGCAAGTAAGAAATTCATTTTGCGTTGGCAATTTTTCTTTATTTTTTGGGGGGGCTTGGAAGTTATCCAAAAATGTTCTGTCCCTAAGCTCTTGTGTAGGAAGTATAGGGAAAATATTTCTACATTTGTTTGTCAATTATTAAACTTCTCTAAACCTTAGAAACTAAAAAAGGGACAGCTTAGCTGAAACCAATAAAAACTGCTAAGTGGAAAGTTTGCCAAAGCCTCAGCTTCCTGGAGAGTGCAGGTGGAGCGACCAGATTAGAGCCTCAGGCTAACAGGACTGCCTGCTGCTTTTGTGTTGTAACTCTTCAGAAAGGGCCCTTTTAACTGTATTGAGCTTAAATAAATTGTTTTAAAA
  3   1   3        nb Tad5      in                         XZT11433.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTATGCTAAAGTCTGTCATACCTCCCCCCCTCCTGTTGTATAGCCTAAGTTCAAAGCTATGCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGAAGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATTTGATCTTATTTTCCAAAAGCAAGTAAGAAATTCATTTTGCGTTGGCAATTTTTCTTTATTTTTTGGGGGGGCTTGGAAGTTATCCAAAAATGTTCTGTCCCTAAGCTCTTGTGTAGGAAGTATAGGGAAAATATTTCTACATTTGTTTGTCAATTATTAAACTTCTCTAAACCTTAGAAACTAAAAAAGGGACAGCTTAGCTGAACCCAATAAAAACTGCTAAGTGGAAAGTTTGCCAAAGCCTCAGCTTCCTGGAGAGTGCAGGTGGAGCGACCAGATTAGAGCCTCAGGCTAACAGGACTGCCTGCTGCTTTTGTGTTGTAACTTTTCAGAAAGGGCCCTTTTAACGGTATTGAGCTTAAATAAATTGTTTT
  3   1   2       ext TbA       in                    TTbA072g21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCATAGTTTTTTTTTTTTTAAAACAGAGGTTAGCAAAAGGGCTGTTAAGTAGCGAAGTACTTTGGAAAATAATTTTTCTTTAAACATCAAAGGTTACAGGATTCTTTTGAAGGTTAAAACACATTAAAAATGCACATAGACTTGACAAGTGATATGTTTAAAATTGACAGATGTTTTTATTTGTATTTTTTTACCATAAAAAAAAATCTAGAAATTTCAAATAAATTTGATTTTATTTTCCAAAAGCAAGTAAGAAATTCATTTTGCGTTGGCAATTTTTTTTTATTTTTTGGGGGGGCTTGGAAGTTATCCAAAAATGTTTTGTCCCTAAGCTTTTGTGTAGGAAGTATAGGGAAAATATTTTTACATTTGTTTGTCAATTATTAAACTTCTTTAAACCTTAGAAACTAAAAAAGGGACAGCTTAGCTGAAACCAATAAAAACTGTTAAGTGGAAAGTTTGCCAAAGCCTCAGCTTCCTGGAGAGTGCAGGTGGAGCGACCAGATTAGAGCCTCAGGCTAACAGGACTGCCTGCTGCTTTTGTGTTGTAACTTTTCAGAAAGGGCCCTTTTAACTGTATTGAGCTTAAATAAATTGTTTTAAAACAGACTGAACTCAATTTTCCCTGTTTTTTTCCTCCTTTCCCCAAAAAAATAAACAATTTACAATTTCCCTTTTAACATATAAACTGTTTTGTCCACCAACCATTAATTAGTAGTACTTGTTTTTTGCCTCTGGAAATACAGTAAGTCTTGATCCATTTCTGTAGATTTTTTATAGAGGTATCATTTCCATTTATTAGTAATAAAGAAGATACCATGCGCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  5   1   2       add Gas7      in                         XZG64835.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACTTCTCTAAACCTTAGAAACTAAAAAAGGGACAGCTTAGCTGAAACCAATAAAAACTGCTAAGTGGAAAGTTTGCCAAAGCCTCAGCTTCCTGGAGAGTGCAGGTGGAGCGACCAGATTAGAGCCTCAGGCTAACAGGACTGCCTGCTGCTTTTGTGTTGTAACTCTTCAGAAAGGGCCCTTTTAACTGTATTGAGCTTAAATAAATTGTTTTAAAACAGACTGAACTCAATTTTCCCTGTTTCTTTCCTCCTTTCCCCAAAAAAATAAACAATTTACAATTTCCCTTTTAACATATAAACTGTCTTGTCCACCAACCATTAATTAGTAGTACTTGTTTTCTGCCTCTGGAAATACAGTAAGTCTTGATCCATTTCTGTAGATTTCTTATAGATGTATCATTTCCATTTATTAGTAATAAAGAAGATACCATGCGCTATTTTCTTTCTGTTGAACGGTTGCTATAGAAGATGACTTTTATCAGGAAGTAAAAAGAACCAAATAAAATAATTCCCCTCAGTCTGCTAAACACAACAACTGGGGTAAAGGTTTATCAGCGTATGACAGGAATGCCAGACTTTTGGCCCTTCAGTTGATAAGAACTGGGATGTTGGGAGTAATAACCATCAACAGCTGGTAAGCCTTTTCTTGTCAGCCTTCCACACAGGGATATTTTAACATGCTAATGTATACATCGCAACATGTTAAAAAAACTGCTTATTATAATTGCTGCTTCATTTTTGTTGTGTGGATTGTAGGTCGAGAAGCCATTTATTTTTTTTATTATTACTTCAGAAGTAACCTAAAAAATTCAGAATTATATCCATTTTTCAGTGGCANCATCAGAGAATCATTGAAGATNAACTGAAA
  3   1   0       add Gas7      in                         XZG64835.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAATAAAATAATTCCCCTCAGTCTGCTAAACACAACAACTGGGGTAAAGGTTTATCAGCGTATGACAGGAATGCCAGACTTTTGGCCCTTCAGTTGATAAGAACTGGGATGTTGGGAGTAATAACCATCAACAGCTGGTAAGCCTTTTCTTGTCAGCCTTCCACACAGGGATATTTTAACATGCTAATGTATACATCGCAACATGTTAAAAAAACTGCTTATTATAATTGCTGCTTCATTTTTGTTGTGTGGATTGTAGGTCGAGAAGCCATTTATTTTTTTTATTATTACTTCAGAAGTAACCTAAAAAATTCAGAATTATATCCATTTTCCAGTGGCACAATCAGAGAATCATTGAAGATAACTGAAAAGAATATAAAGAACATAACATAACTACGCTCACATTCCTCCTCAAAATGCTCTTGCCTCATGATAATAATATTTTATAAATGATAATTTATGTCCTGACAACTGTGCAAAAAACATAAATGTATTCTTCAAGTGTAAATGTGTAAGAAGGCATTATCACAAAAATTCATGTTTTTCCGAGGTTATTCTCACTATCCACAGAGGGAAGGAATTTTTGGGTGTTTTATTGCAGATTCACAAGTACAGCTGGCAAATGACTTTATTTTACCCCATTTCTTTTGATCAAATAATTCTTTAAATTTAACATACATGGGTTTAAAACCCCTGCCTTAACTTTTCCTGCATACTAGACTTTTAGTTCATACTCCCATGGTCTTGGTGTCATCTCTTTTAGATACATGTACTGTATATTTATTTTATATCATTTATTATACTAATTAAAAAGGACAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)