Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 20 Jan 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA076a15.5                          6 END     2           2       33                receptor tyrosine kinase
     2   2.0    0Xt7.1-XZG42466.5                            5 END     2           2       40                Cek8 [Gallus gallus]

 This cluster: approximate FL confidence score = 0%

 1012074366 Xt7.1-XZT7657.3 - 68 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                        2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     5     4     7     3     7     5     8     5     8     5     8     5     8     5     8     5     8     5     9     5     9     7     9     6     9     7    10     8    11     8    11     8    11     8    11     8    11     8    11     8    11     8    11     8    11     8    12     9    12     9    12     9    12     9    12     9    13     9    14    11    15    11    15    11    15    12    16    12    16    13    17    13    17    13    17    13    17    14    18    14    18    14    19    18    19    18    19    17    18    17    18    19    20    18    20    19    20    19    20    19    20    19    20    18    18    18    18    18    18    18    18    18    18    18    18    16    17    15    16    16    17    16    17    17    18    17    18    17    18    17    18    17    18    15    17    10    12    11    11    11    11    11    12    11    12    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    14    15    15    15    15    15    15    15    15    14    15    15    16    15    16    15    16    14    16    15    16    15    16    14    15    14    15    14    15    13    14    13    14    13    14    13    14    13    14    14    15    14    15    13    15    13    15    12    13    13    14    14    15    14    15    14    15    13    14    13    14    12    13    13    14    13    14    13    15    13    15    13    15    13    15    13    15    12    14    13    15    13    15    13    15    12    15    12    15    13    16    13    14    13    14    14    15    14    15    14    15    14    16    14    16    15    16    13    17    13    16    12    15    13    16    13    16    11    16    14    16    13    17    15    17    15    17    16    18    19    20    19    21    23    25    24    27    25    27    24    26    24    28    24    28    27    30    28    31    30    32    30    32    29    31    29    31    29    31    29    31    29    31    29    31    27    31    26    30    27    29    26    29    29    30    29    31    29    31    28    31    28    31    27    29    28    28    28    28    28    28    28    28    27    28    27    27    27    27    25    27    26    27    25    27    26    26    26    26    26    27    26    27    26    27    26    27    27    27    27    27    27    27    26    27    27    27    27    27    27    27    27    27    26    27    27    27    26    27    26    27    26    26    26    26    25    26    23    26    25    25    24    24    24    24    16    17    13    16    13    15     7     8     3     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -T-C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----C-------
                                                       Xt7.1-XZT7657.3                                                                                                   TAG------------ATG---------TGA---------------------------------ATG------------------------------TAA------------------------------------------------------------------TAA---------------------------------------------TGA---------------------ATG---------------TAG---------------------------TAA------------TAA------------------------------------------------------------TAG---------TAA---------------------------------------------TGA---------------------------------------TGA---------------TAG------------------ATG---------------------------------------------TGA------------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------------------------ATG------------------------------------------------------------TGA------TGAATG------------------------------------------------------------TAA------------TAA---TGA------TAA---------------------------------------------------------TAG---------------TAA------------TAA------------------------------TAGTAA------------------------------------TAATAA------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------TGA---------------------------------------------------TAG------------------------------------------------------------------------------TAG---------------------------------------------------------TAATAA---------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------ATG---TAAATG------ATG---------------------------------------------------TAA------------------------------------------------------------------------------------------TAG------------------------------------------------------------------TGA---------------------------------------------TAG------------------TGA------------------------------------ATG---ATG------------------TGA---------------------------------------------------------------------TAG---------------------ATG---------------------------------------TAA---------------------------------------------------------------------------------------------------------------TAA---------------------------------------------TGA---------TAG------------TGA------TAA------------------------------TAA------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------TAA---------------------ATG---ATG---------------------TAATAATGA------------------------TAG
  3   1   2       bld Gas7      in                         XZG31340.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACGCGTCCGAACCTTCTGTGCTCATTGACTGGCTGACAGATTGTCTTTGGATAGTGCCTGAACTCCTTTGATATGAAAGAATATCTATTTTTGCCTGTGCTACCGCTGCAAGAGAATATCTGAAGTCAAAAAAGGATAATAAGGGATTCTTTTTTTGCTTCTTTAGCGACCCATGGGAAACTGGAGCAAGAAGGCATGAGAGATCAGAGCCATTCATTTTTTAGGAAATTCAGAGAAGAGTCAGCGGAATGTCACAGTAGAATGTTTAAACACCATTGTTGCTTCTCCAGCAAGAACATGGATTTTCTCCAGCACCATAAGATCCTGCAGGTCTTCCTCTCCATTCCATGTCGCGCCTTATGACTCCCCTGAATGATTCCGTGTTGTCTACAGCAATCCTGGTCCAGGATAAACAGAATAACGCATTGCCTGCAGTAAACCCTTTTTGGGTAACAGTGAAGAGAATAATTGTTAAAAAAAAAAAAAAGG
  5   1   2       bld Gas7      in                         XZG31340.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACCTTCTGTGCTCATTGACTGGCTGACAGATTGTCTTTGGATAGTGCCTGAACTCCTTTGATATGAAAGAATATCTATTTTTGCCTGTGCTACCGCTGCAAGAGAATATCTGAAGTCAAAAAAGGATAATAAGGGATTCTTTTTTTGCTTCTTTAGCGACCCATGGGAAACTGGAGCAAGAAGGCATGAGAGATCAGAGCCATTCATTTTTTAGGAAATTCAGAGAAGAGTCAGCGGAATGTCACAGTAGAATGTTTAAACACCATTGTTGCTTCTCCAGCAAGAACATGGATTTTCTCCAGCACCATAAGATCCTGCAGGTCTTCCTCTCCATTCCATGTCGCGCCTTATGACTCCCCTGAATGATTCCGTGTTGTCTACAGCAATCCTGGTCCAGGATAAACAGAATAACGCATTGCCTGCAGTAAACCCTTTTTGGGTAACAGTGAAGAGAATAATTGTTTAAAAAAAAAAAAAAGG
  5   1   2       bld Gas8      in                           st9p03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATGAGAGATCAGAGCCATTCATTTTTTAGGAAATTCAGAGAAGAGTCAGCGGAATGTCACAGTAGAATGTTTAAACACCATTGTTGCTTCTCCAGCAAGAACATGGATTTTCTCCAGCACCATAAGATCCTGCAGGTCTTCCTCTCCATTCCATGTCGCGCCTTATGACTCCCCTGAATGATTCCGTGTTGTCTACAGCAATCCTGGTCCAGGATAAACAGAATAACGCATTGCCTGCAGTAAACCCTTTTTGGGTAACAGTGAAGAGAATAATTGTTTAAAAAAAATGTTAAAAAAGGGAATAATGGCACTTCAGATCCACATCCAAACTAGGATTTTTGTTTTGTGTAAAACAACATCCTGTAAACTGTGCTTTGCTATGAAGAGGTAGAACATTAGTAACTATTGCCTGGGACAGAACTAAATGCCAAACAACCTTAATAAGGGACTGAGCAAGCAACGGGCAAGGGACTGTTTTATGTTTTGGTGTGCCCAGAGGCAAGCAGTGGTGATGCACTACCGTTGGGGCCATCTGTTCCTCTCTTGGTTGAGGCCTCTGTAATATAAAACTATAAAAGACTTTCCTTTCACAATAATAAATATGCAATTTCATGAGATTTAAGCATCTTTACTGGTCACGGTGACAACCATAAAGAGCTACCAACTTAGCATACAGTATGTATAAGTATAAATTCACATCCCCATAAATGTCTTTGTACT
  5   1   2       bld Tad5      in                         XZT11483.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGATTCCGTGTTGTCTACAGCAATCCTGGTCCAGGATAAACAGAATAACGCATTGCCTGCAGTAAACCCTTTTTGGGTAACAGTGAAGAGAATAATTGTTTAAAAAAAATGTTAAAAAAGGGAATAATGGCACTTCAGATCCACATCCAAACTAGGATTTTTGTTTTGTGTAAAACAACATCCTGTAAACTGTGCTTTGCTATGAAGAGGTAGAACATTAGTAACTATTGCCTGGGACAGAACTAAATGCCAAACAACCTTAATAAGGGACTGAGCAAGCAACGGGCAAGGGACTATTTTATGTTTTGGTGTGCCCAGAGGCAAGCAGTGGTGATGCACTACCGTTGGGGCCATCTGTTCCTCTCTTGGTTGAGGCCTCTGTAATATAAAACTATAAAAGACTTTCCTTTCACAATAATAAATATGCAATTTCATGAGATTTAAGCATCTTTACTGGTCACGGTGACAACCATAAAGAGCTACCAACTTAGCATACAGTATGTATAAGTATAAATTCACATCCCCATAAATGTCTTTGTACTCATTGCCCGCCTTTCTATTCCGAAACTTAGTATTGCAGGAGGGTAACAATAAAGGGTTATTTGTCTTGGATCAACTTGGAATCCACATAATAATCCTTATGTTAGTTTGGAGAGAAATGTCAGAGCTTAATACTATCTCTGTGGGCTCTCCGTAGAGCTCCTAAAACCAACGATGCTAGGACTGTTATCAGCAATGAGGGTAATAAAAGGCTTGTGGAAGCCATCTGGGAATTCAGTAGGAAAAAAAAGGAAGTTTTACATTTCACAA
  3   1   2       bld Gas8      in                           st9p03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTNTACAGCAATCCTGGTCCAGGATAAACAGAATAACGCATTGCCTGCAGTAAACCCTTTTTGGGTAACAGTGAAGAGAATAATTGTTTAAAAAAAATGTTAAAAAAGGGAATAATGGCACTTCAGATCCACATCCAAACTAGGATTTTTGTTTTGTGTAAAACAACATCCTGTAAACTGTGCTTTGCTATGAAGAGGTAGAACATTAGTAACTATTGCCTGGGACAGAACTAAATGCCAAACAACCTTAATAAGGGACTGAGCAAGCAACGGGCAAGGGACTGTTTTATGTTTTGGTGTGCCCAGAGGCAAGCAGTGGTGATGCACTACCGTTGGGGCCATCTGTTCCTCTCTTGGTTGAGGCCTCTGTAATATAAAACTATAAAAGACTTTCCTTTCACAATAATAAATATGCAATTTCATGAGATTTAAGCATCTTTACTGGTCACGGTGACAACCATAAAGAGCTACCAACTTAGCATACAGTATGTATAAGTATAAATTCACATCCCCATAAATGTCTTTGTACTCATTGCCCGCCTTTCTATTCCGAAACTTAGTATTGCAGGAGGGTAACAATAAAGGGTTATTTGTCTTGGATCAACTTGGAATCCACATAATAATCCTTATGTTAGTTTGGAGAGAAATGTCAGAGCTTAATACTATCTCTGTGGGCTCTCCGTAGAGCTCCTAAAACCAACGATGCTAGGACT
  5   1   2       bld Gas7      in                          XZG6527.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATATTGTTTAAAAAAATGTTAAAAAAGGGAATAATGGCACTTCAGATCCACATCCAAACTAGGATTTTTGTTTTGTGTAAAACAACATCCTGTAAACTGTGCTTTGCTATGAAGAGGTAGAACATTAGTAACTATTGCCTGGGACAGAACTAAATGCCAAACAACCTTAATAAGGGACTGAGCAAGCAACGGGCAAGGGACTATTTTATGTTTTGGTGTGCCCAGAGGCAAGCAGTGGTGATGCACTACCGTTGGGGCCATCTGTTCCTCTCTTGGTTGAGGCCTCTGTAATATAAAACTATAAAAGACTTTCCTTTCACAATAATAAATATGCAATTTCATGAGATTTAAGCATCTTTACTGGTCACGGTGACAACCATAAAGAGCTACCAACTTAGCATACAGTATGTATAAGTATAAATTCACATCCCCATAAATGTCTTTGTACTCATTGCCCGCCTTTCTATTCCGAAACTTAGTATTGCAGGAGGGTAACAATAAAGGGTTATTTGTCTTGGATCAACTTGGAATCCACATAATAATCCTTATGTTAGTTTGGAGAGAAATGTCAGAGCTTAATACTATCTCTGTGGGCTCTCCGTAGAGCTCCTAAAACCAACGATGCTAGGACTGTTATCAGCAATGAGGGTAATAAAAGGCTTGTGGAAGCCATCTGGGAATTCAGTAGGAAAAAAAAGGAAAGTTTTACATTTCACAAATAAGATCAGGTTTCTTCCATGCTGTAAATGTGTAAGATGTACAGAAGGCACCCTGTATATGGGGTAGCGACAGTATTTTTAAAAAAGAATTAAGTACTTTGCTCATACAATAAACTGCCT
  5   1   2       bld Tad5      in                          XZT5255.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATGGCACTTCGATCCCATCCAACTAGGATTTTTGTTTTGTGTAAAACAACATCCTGTAAACTGTGCTTTGCTATGAAGAGGTAGAACATTAGTAACTATTGCCTGGGACAGAACTAAATGCCAAACAACCTTAATAAGGGACTGAGCAAGCAACGGGCAAGGGACTATTTTATGTTTTGGTGTGCCCAGAGGCAAGCAGTGGTGATGCACTACCGTTGGGGCCATCTGTTCCTCTCTTGGTTGAGGCCTCTGTAATATAAAACTATAAAAGACTTTCCTTTCACAATAATAAATATGCAATTTCATGAGATTTAAGCATCTTTACTGGTCACGGTGACAACCATAAAGAGCTACCAACTTAGCATACAGTATGTATAAGTATAAATTCACATCCCCATAAATGTCTTTGTACTCATTGCCCGCCTTTCTATTCCGAAACTTAGTATTGCAGGAGGGTAACAATAAAGGGTTATTTGTCTTGGATCAACTTGGAATCCACATAATAATCCTTATGTTAGTTTGGAGAGAAATGTCAGAGCTTAATACTATCTCTGTGGGCTCTCCGTAGAGCTCCTAAAACCAACGATGCTAGGACTGTTATCAGCAATGAGGGTAATAAAAGGCTTGTGGAAGCCATCTGGGAATTCAGTAGGAAAAAAAAGGAAAGTTTTACATTTCACAAATAAGATCAGGTTTCTTCCATGCTGTAAATGTGTAAGATGTACAGAAGGCACCCTGTATATGGNGTAGCGACAGTATTTTTTAAAAAGAAATTAAGTACTTTGCTCA
  5   1   2       bld Neu                            TNeu003f06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTGTTTTGTGTAAAACAACATCCTGTAAACTGTGCTTTGCTATGAAGAGGTAGAACATTAGTAACTATTGCCTGGGACAGAACTAAATGCCAAACAACCTTAATAAGGGACTGAGCAAGCAACGGGCAAGGGACTATTTTATGTTTTGGTGTGCCCAGAGGCAAGCAGTGGTGATGCACTACCGTTGGGGCCATCTGTTCCTCTCTTGGTTGAGGCCTCTGTAATATAAAACTATAAAAGACTTTCCTTTCACAATAATAAATATGCAATTTCATGAGATTTAAGCATCTTTACTGGTCACGGTGACAACCATAAAGAGCTACCAACTTAGCATACAGTATGTATAAGTATAAATTCACATCCCCATAAATGTCTTTGTACTCATTGCCCGCCTTTCTATTCCGAAACTTAGTATTGCAGGAGGGTAACAATAAAGGGTTATTTGTCTTGGATCAACTTGGAATCCACATAATAATCCTTATGTTAGTTTGGAGAGAAATGTCAGAGCTTAATACTATCTCTGTGGGCTCTCCGTAGAGCTCCTAAAACCAACGATGCTAGGACTGTTATCAGCAATGAGGGTAATAAAAGGCTTGTGGAAGCCATCTGGGAATTCAGTANGAAAAAAAAGGAAAGTTTTACATTTCACAAA
  5   1   2       bld Gas7      in                         XZG15155.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTAAATGCCAAACAACCTTAATAAGGGACTGAGCAAGCAACGGGCAAGGGACTATTTTATGTTTTGGTGTGCCCAGAGGCAAGCAGTGGTGATGCACTACCGTTGGGGCCATCTGTTCCTCTCTTGGTTGAGGCCTCTGTAATATAAAACTATAAAAGACTTTCCTTTCACAATAATAAATATGCAATTTCATGAGATTTAAGCATCTTTACTGGTCACGGTGACAACCATAAAGAGCTACCAACTTAGCATACAGTATGTATAAGTATAAATTCACATCCCCATAAATGTCTTTGTACTCATTGCCCGCCTTTCTATTCCGAAACTTAGTATTGCAGGAGGGTAACAATAAAGGGTTATTTGTCTTGGATCAACTTGGAATCCACATAATAATCCTTATGTTAGTTTGGAGAGAAATGTCAGAGCTTAATACTATCTCTGTGGGCTCTCCGTAGAGCTCCTAAAACCAACGATGCTAGGACTGTTATCAGCAATGAGGGTAATAAAAGGCTTGTGGAAGCCATCTGGGAATTCAGTAGGAAAAAAAAAGTAAAGTTTTACATTTCACAAATAAGATCAGGTTTCTTCCATGCTGTAAATGTGTAAGATGTACAGAAGGCACCCTGTATATGGGGTAGCGACAGTATTTTTAAAAAAGAATTAAGTACTTTGCTCATACAATAAACTGCCTTTTGGCATTGTATGTGAAAGATATTCTAACTCTT
  5   1   2       bld Tad5      in                         XZT44531.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACAACCTTAATAAGGGACTGAGCAAGCAACGGGCAAGGGACTGTTTTATGTTTTGGTGTGCCCAGAGGCAAGCAGTGGTGATGCACTACCGTTGGGGCCATCTGTTCCTCTCTTGGTTGAGGCCTCTGTAATATAAAACTATAAAAGACTTTCCTTTCACAATAATAAATATGCAATTTCATGAGATTTAAGCATCTTTACTGGTCACGGTGACAACCATAAAGAGCTACCAACTTAGCATACAGTATGTATAAGTATAAATTCACATCCCCATAAATGTCTTTGTACTCATTGCCCGCCTTTCTATTCCGAAACTTAGTATTGCAGGAGGGTAACAATAAAGGGTTATTTGTCTTGGATCAACTTGGAATCCACATAATAATCCTTATGTTAGTTTGGAGAGAAATGTCAGAGCTTAATACTATCTCTGTGGGCTCTCCGTAGAGCTCCTAAAACCAACGATGCTAGGACTGTTATCAGCAATGAGGGTAATAAAAGGCTTGTGGAAGCCATCTGGGAATTCAGTAGGAAAAAAAAGGAAAGTTTTACATTTCACAAATAAGATCAGGTTTCTTCCATGCTGTAAATGTGTAAGATGTACAGAAGGCACCCTGTATATGGGGTAGCGACAGTATTTTTAAAAAAGAATTAAGTACTTTGCTCATACAATAAACTGCCTTTTGGCATTGTATGTGAAAGATATTCTAACTCTTATAAAAAGGTTCAGACATACTCAGCATTATAGGGCCAACATTTGTCAACAACATTTGGTCCAATACATACTGCAGTGTTTCTCCTNGTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGA
  5   1   2       bld Neu5      in                          ANHP390.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGCAAGCAGTGGTGATGCACTACCGTTGGGGCCATCTGTTCCTCTCTTGGTTGAGGCCTCTGTAATATAAAACTATAAAAGACTTTCCTTTCACAATAATAAATATGCAATTTCATGAGATTTAAGCATCTTTACTGGTCACGGTGACAACCATAAAGAGCTACCAACTTAGCATACAGTATGTATAAGTATAAATTCACATCCCCATAAATGTCTTTGTACTCATTGCCCGCCTTTCTATTCCGAAACTTAGTATTGCAGGAGGGTAACAATAAAGGGTTATTTGTCTTGGATCAACTTGGAATCCACATAATAATCCTTATGTTAGTTTGGAGAGAAATGTCAGAGCTTAATACTATCTCTGTGGGCTCTCCGTAGAGCTCCTAAAACCAACGATGCTAGGACTGTTATCAGCAATGAGGGTAATAAAAGGCTTGTGGAAGCCATCTGGGAATTCAGTAGGAAAAAAAAAGGAAAGTTTTACATTTCACAAATAAGATCAGGTTTCTTCCATGCTGTAAATGTGTAAGATGTACAGAAGGCACCCTGTATATGGGGTAGCGACAGTATTTTTAAAAAAGAATTAAGTACTTTGCTCATACAATAAACTGCCTTTTGGCATTGTATGTGAAAGATATTCTAACTCTTATAAAAAGGTTCAGACATACTCAGCATTATAGGGCCAACATTTGTCAACAACATTTGGTCCAATACATACTGCAGTGTTTCTCCTGTTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCCATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCCACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCA
  5   1   2       bld Eye       in                         CCAX4322.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACTTTCCTTTCACAATAATAAATATGCAATTTCATGAGATTTAAGCATCTTTACGGGTCACGGTGACAACCATAAAGAGCTACCAACTTAGCATACAGTATGTATAAGTATAAATTCACATCCCCATAAATGTCTTTGTACTCATTGCCCGCCTTTCTATTCCGAAACTTAGTATTGCAGGAGGGTAACAATAAAGGGTTATTTGTCTTGGATCAACTTGGAATCCACATAATAATCCTTATGTTAGTTTGGAGAGAAATGTCAGAGCTTAATACTATCTCTGTGGGCTCTCCGTAGAGCTCCTAAAACCAACGATGCTAGGACTGTTATCAGCAATGAGGGTAATAAAAGGCTTGTGGAAGCCATCTGGGAATTCAGTAGGAAAAAAAAGGAAAGTTTTACATTTCACAAATAAGATCAGGTTTCTTCCATGCTGTAAATGTGTAAGATGTACAGAAGGCACCCTGTATATGGGGGTAGCGACAGTATTTTTAAAAAAGAATTAAGTACTTTGCTCATACAATAAACTGCCTTTTGGCATTGTATGTGAAAGATATTCTAACTCTTAGAAAAAGGTTCAGACATACTCAGCAATATAGGGCCAACATTTGTCAACAACATTTGGTCCAATACA
  5   1   2       bld Gas7      in                         XZG31716.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATCTTTACTGGTCACGGTGACAACCATAAAGAGCTACCAACTTAGCATACAGTATGTATAAGTATAAATTCACATCCCCATAAATGTCTTTGTACTCATTGCCCGCCTTTCTATTCCGAAACTTAGTATTGCAGGAGGGTAACAATAAAGGGTTATTTGTCTTTGATCAACTTGGAATCCACATAATAATCCTTATGTTAGTTTGGAGAGAAATGTCAGAGCTTAATACTATCTCTGTGGGCTCTCCGTAGAGCTCCTAAAACCAACGATGCTAGGACTGTTATCAGCAATGAGGGTAATAAAAGGCTTGTGGAAGCCATCTGGGAATTCAGTAGGAAAAAAAAGGAAAGTTTTACATTTCACAAATAAGATCAGGTTTCTTCCATGCTGTAAATGTGTAAGATGTACAGAAGGCACCCTGTATATGGGGTAGCGACAGTATTTTTAAAAAAGAATTAAGTACTTTGCTCATACAATAAACTGCCTTTTGGCATTGTATGTGAAAGATATTCTAACTCTTAGAAAAAGGTTCAGACATACTCAGCAATATAGGGCCAACATTTGTCAACAACATTTGGTCCAATACATACTGCAGTGTTTCTCCTGTTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCTATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATNATATATTTCTTTNGTACT
  3   1   2       bld Brn4      out                       CAAL23032.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TACCAACTTAGCATACAGTATGTATAAGTATAAATTCACATCCCCATAAATGTCTTTGTACTCATTGCCCGCCTTTCTATTCCGAAACTTAGTATTGCAGGAGGGTAACAATAAAGGGTTATTTGTCTTGGATCAACTTGGAATCCACATAATAATCCTTATGTTAGTTTGGAGAGAAATGTCAGAGCTTAATACTATCTCTGTGGGCTCTCCGTAGAGCTCCTAAAACCAACGATGCTAGGACTGTTATCAGCAATGAGGGTAATAAAAGGCTTGTGGAAGCCATCTGGGAATTCAGTAGGAAAAAAAAGGAAAGTTTTACATTTCACAAATAAGATCAGGTTTCTTCCATGCTGTAAATGTGTAAGATGTACAGAAGGCACCCTGTATATGGGGTAGCGACAGTATTTTTAAAAAAGAATTAAGTACTTTGCTCATACAATAAACTGCCTTTTGGCATTGTATGTGAAAGATATTCTAACTCTTATAAAAAGGTTCAGACATACTCAGCATTATAGGGCCAACATTTGTCAACAACATTTGGTCCAATACATACTGCAGTGTTTCTCCTGTTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCCATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAAT
  5   1   2       bld Tbd0                               IMAGE:6978162                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCCCGCCTTTCTATTCCGAAACTTAGTATTGCAGGAGGGTAACAATAAAGGGTTATTTGTCTTGGATCAACTTGGAATCCACATAATAATCCTTATGTTAGTTTGGAGAGAAATGTCAGAGCTTAATACTATCTCTGTGGGCTCTCCGTAGAGCTCCTAAAACCAACGATGCTAGGACTGTTATCAGCAATGAGGGTAATAAAAGGCTTGTGGAAGCCATCTGAGAATTCAGTAGGAAAAAAAAGGAAAGTTTTACATTTCACAAATAAGATCAGGTTTCTTCCATGCTGTAAATGTGTAAGATGTACAGAAGGCACCCTGTATATGGGGTAGCGACAGTATTTTTAAAAAAGAATTAAGTACTTTGCTCATACAATAAACTGCCTTTTGGCATTGTATGTGAAAGATATTCTAACTCTTAAAAAAAGGTTCAGACATACTCAGCAATATAGGGCCAACATTTGTCAACAACATTTGGTCCAATACATACTGCAGTGTTTCTCCTGTTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCCATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCNNCAGACAAATAGAAAAAAAGAGAAAGATTTGCAATGTTGTATCCNCCAGCATACGTGAAGTCTAAAGGGAGTCATTACACTTTTGTACTGGCC
  3   1   2       bld Gas7      in                          XZG6527.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTCCGAAACTTAGTATTGCAGGAGGGTAACAATAAAGGGTTATTTGTCTTGGATCAACTTGGAATCCACATAATAATCCTTATGTTAGTTTGGAGAGAAATGTCAGAGCTTAATACTATCTCTGTGGGCTCTCCGTAGAGCTCCTAAAACCAACGATGCTAGGACTGTTATCAGCAATGAGGGTAATAAAAGGCTTGTGGAAGCCATCTGGGAATTCAGTAGGAAAAAAAAGGAAAGTTTTACATTTCACAAATAAGATCAGGTTTCTTCCATGCTGTAAATGTGTAAGATGTACAGAAGGCACCCTGTATATGGGGTAGCGACAGTATTTTTAAAAAAGAATTAAGTACTTTGCTCATACAATAAACTGCCTTTTGGCATTGTATGTGAAAGATATTCTAACTCTTAGAAAAAGGTTCAGACATACTCAGCAATATAGGGCCAACATTTGTCAACAACATTTGGTCCAATACATACTGCAGTGTTTCTCCTGTTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCTATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGT
  5   1   2       bld HdA       in                   THdA034j16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATATCCTTATGTTAGTTTGGAGAGAAATGTCAGAGCTTAATACTATCTCTGTGGGCTCTCCGTAGAGCTCCTAAAACCAACGATGCTAGGACTGTTATCAGCAATGAGGGTAATAAAAGGCTTGTGGAAGCCATCTGGGAATTCAGTAGGAAAAAAAAGGAAAGTTTTACATTTCACAAATAAGATCAAGTTTCTTCCATGCTGTAAATGTGTAAGATGTACAGAAGGCACCCTGTATATGGGGTAGCGACAGTATTTTTAAAAAAGAATTAAGTACTTTGCTCATACAATAAACTGCCTTTTGGCATTGTATGTGAAAGATATTCTAACTCTTAGAAAAAGGTTCAGACATACTCAGCAATATAGGGCCAACATTTGTCAACAACATTTGGTCCAATACATACTGCAGTGTTTCTCCTGTTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCTATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTTTTATTCCTTGTTTTTAACCCC
  5   1   2       chi Gas6      in                         ANBT2283.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGTATGGTCTGAACGCTTTTTATAAGAGTTAGAATATCTTTCACATACAATGCCAAAAGGCAGTTTATTGTATGAGCAAAGTACTTAATTCTTTTTTAAAAATACTGTCGCTACCCCATATACAGGGTGCCTTCTGTACATCTTACACATTTCACAAATAAGATCAAGTTTCTTCCATGCTGTAAATGTGTAAGATGTACAGAAGGCACCCTGTATATGGGGTAGCGACAGTATTTTTAAAAAAGAATTAAGTACTTTGCTCATACAGTAAACTGCCTTTTGGCATTGTATGTGAAAGATATTCTAACTCTTATAAAAAGGTTCAGACATACCCAGCATTATAGGGCCAACATTTGTCAACCACATTTGGTCCAATACATACC
  3   1   2       bld Gas7      out                        XZG22792.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTCAGCAATGAGGGTAATAAAAGGCTTGTGGAAGCCATCTGGGATTTCAGTAGGAAAAAAAAGGAAATTTTTCCATTTCACAAATAAGATCAGGTTTCTTCCACGCTGTAAATGTGTAAGAGGTCCAGAAGGCCCCCAGTATATGGGGTAGCGCCAGTCTTTTTAAAAAAGAATTAAGTGCTTTGCTCATACAATAAACTGCCTTTTGGCATAGTATGTGAAAGATATTCTAACTTTTAGAAAAAGGTTCTGACATACTCCGCAATATAGGGCCAACATTTGTCAACAACATTTGGTCCAATACATACTGCAGTGTTTCTCCTGTTGGTGCAAGTATGATCTGGCTTCCTTGCTAAACGG
  5   1   2       bld Gas7                                 XZG23350.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGAAAGTTTTACATTTCACAAATAAGATCAGGTTTCTTCCATGCTGTAAATGTGTAAGATGTACAGAAGGCACCCTGTATATGGGGTAGCGACAGTATTTTTAAAAAAGAATTAAGTACTTTGCTCATACAATAAACTGCCTTTTGGCATTGTATGTGAAAGATATTCTAACTCTTAAAAAAAGGTTCAGACATACTCAGCAATATAGGGCCAACATTTGTCAACAACATTTGGTCCAATACATACTGCAGTGTTTCTCCTGTTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCTATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAGAGAACGATTGCGAATGTTGTATCCCCAGCAATACGTGAAGTCCAAAGGGAGTCATTAACCCTTTTGCACTGCCCCT
  5   1   2       bld Gas7      in                         XZG51494.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGGTTTCTTCCATGCTGTAAATGTGTAAGATGTACAGAAGGCACCCTGTATATGGGGTAGCGACAGTATTTTTAAAAAAGAATTAAGTACTTTGCTCATACAATAAACTGCCTTTTGGCATTGTATGTGAAAGATATTCTAACTCTTAGAAAAAGGTTCAGACATACTCAGCAATATAGGGCCAACATTTGTCAACAACATTTGGTCCAATACATACTGCAGTGTTTCTCCTGTTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCTATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTCTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGGTCCTCTTTCCCTATGTTAGGTACGCATAACTTTATCTGGTTATTTA
  5   1   2       bld Gas                            TGas079j02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAAGGCACCCTGTATATGGGGTAGCGACAGTATTTTTAAAAAAGAATTAAGTACTTTGCTCATACAATAAACTGCCTTTTGGCATTGTATGTGAAAGATATTCTAACTCTTATAAAAAGGTTCAGACATACTCAGCATTATAGTGCCAACATTTGTCAACAACATTTGGTCCAATACATACTGCAGTGTTTCTCCTGTTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCCATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTTTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAATCAAAAGGGACATTTATATTTTGTGTGTCA
  5   1   2       bld Neu                            TNeu095l22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAAGGCACCCTGTATATGGGGTAGCAAAGTACTTAATTCTTTTTGGCATTGTATGTGAAAGATATTCTAACTCTTATAAAAAGGTTCAGACATACTCAGCATTATAGGGCCAACATTTGTCAACAACATTTGGTCCAATACATACTGCAGTGTTTCTCCTGTTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCCATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAAAAAAAAAAAAgcggccgcttttttttttttttttttgtctttacatggatgttttattggaaactttaaatacactttgccaacataactca
  3   1   2       bld Neu       in                    TNeu076p19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTGGCATTGTATGTGAAAGATATTCTAACTCTTATAAAAAGGTTCAGACATACTTCAGCATTATAGGGCCAACATTTGTCAACAACATTTGGTCCAATACATAACTGCAGGTTTCTCCTGTTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCCATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGANGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTTTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAATAATGAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas8      in                           st4j13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATATTCTAACTCTTAGAAAAAGGTTCAGACATACTCAGCAATATAGGGCCAACATTTGTCAACAACATTTGGTCCAATACATACTGCAGTGTTTCTCCTGTTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCTATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTCTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCANAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAANATGAGACATCTAACAGAGCATTTTAATTGGNTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGNTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTT
  3   1   2       bld Tad5      in                          XZT7657.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCAGACATACTCAGCATTATAGGGCCAACATTTGTCAACAACATTTGGTCCAATACATACTGCAGTGTTTCTCCTGTTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCCATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTTTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAATAATGAAAAAAAAAATTTCAAAAATAAAGTAGTAAATAAAGC
  5   1   2       bld Gas7      in                         XZG25450.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGACGCGTGGGTTGGTCCAATACATACTGCAGTGTTTCTCCTGTTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCTATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTCTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTTGTAAAATTGTAAAATAGA
  3   1   2       bld Gas7                                 XZG53531.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCAATACATACTGCAGTGTTTCTCCTGTTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCTATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTCTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAAT
  3   1   2      seed Gas7      in                         XZG31716.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATACATACTGCAGTGTTTCTCCTGTTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCTATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTTTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAATAATGAAAAAAAAAATTTACAAAAATAAAGTAGTTAAATAAAAGC
  3   1   2       bld Gas7      in                         XZG42217.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TACATACTGCAGTGTTTCTCCTGTTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCTATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTCTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAAT
  3   1   2       bld Tad5      in                         XZT44531.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TACATACTGCAGTGTTTCTCCTGTTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCCATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTTTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAATAATGAAAAAAAAAATTTACAAAAATAAAGTAGTT
  3   1   2       bld Gas6      in                         ANBT2283.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGCAGTGTTTCTCCTGTTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCCATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTTTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAATAATG
  3   1   2       bld Gas7      in                         XZG51494.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTGTTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCTATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTCTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAATAATGAAAAAAAAAATTTACAAAAATAAAGTAGTT
  3   1   2       bld Gas7      in                         XZG32261.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTTGGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCTATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTCTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAATAATGAAAAAAAAAATTTACAAAAATAAAGTAGTTAAATAAAAGCAAAAAGAAAAAAAAAAAGG
  3   1   2       bld Tad5      in                         XZT11483.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTTGGTGCAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCTATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTCTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAATAATGAAAAAAAAAATTTACAAAAATAAAGTAGTTAAATAAAAGCAAAATAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG25450.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTGGTGCAAGTATGATCTGGCTGCCCTGCTAAACTGCTGTGGACAAGCTATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTCTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAATAATGAAAAAAAAAATTTACAAAAATAAAGTAGTTAAATAAAAGC
  3   1   2       bld Gas7      in                          XZG6186.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCTATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCTCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTTTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAATAATGAAAAAAAAAATTTACAAAAATAAAGTAGTTA
  3   1   2       bld Spl2      in                        CBSS2851.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAGTATGATCTGGCTGCCTTGCTAAACTGCTGTGGACAAGCCATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTTTTATTCCTTGTGTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAATAATGAAAAAAAAAATTTACAAAAATAAAGTAGTTAAATAAAAGC
  3   1   2       bld Tad5 PIPE                            XZT52954.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTGCTAAACTGCTGTGGACAAGCTATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTCTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAATAATGAAAAAAAAAATTTACAAAAATAAAGTAGTT
  5   1   2       bld HdA                            THdA006j05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAGCTATTTATGTCAGTAGGAACATGGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTTTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAATAATG
  3   1   2       bld Neu5      in                          ANHP390.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGCCATTTATGTCAGTAGGAACATGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGGCAAAATAGAAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTTTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAATAATGAAAAAAAAAATTTACAAAAATAAAGTAGTTAAAT
  3   1   2       bld Gas8      in                           st4j13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGGAGCCATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGNTACTGCCAAGACAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTCTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCNTTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAATAANGAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG15155.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGACAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTCTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAAT
  3   1   2       bld Gas7                                  XZG4400.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACATGAGTCCAACACAGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGCCAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTTTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAATAATGAAAAAAAAAATTTACAAAAATAAAGTAGTTAA
  3   1   2       bld Tad5      in                          XZT5255.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAGATTGGCATTCACTGCATTGGCACATGACTATGGATCAGTGGTTGAGAAGATGACCTAGTTCAGAAGCTGTAGGCCAGAATTCAGGATGCATATTATATTTCTTTGTTACTGCCAAGCCAAAATAGAAAAAAAGAGAAAGATTGCAAATGTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTCTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTGGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAATAATGAAAAAAAAAATTTCCAAAAATAAAGTA
  3   1   2       bld Gas7      in                         XZG31412.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATATTATATTTCTTTGTTCCTGCCCGGCCAAATTGGAAAAAAAGAGAAGGTTTGCAAATGTTGTATCCCCACCAATCCGTGAAGTCTAAAGGGAGTCATTACCCCTTTTGTACGGGCCCTTTTGGCGGCAAAAGGGCCACCCCCCCTCCAATTGGTTGTTATCAGTATTTTTATTCCTTGGGTTTAACCCCGGGGACCCTTACCCGGGGAACTTAACTAATTCAAAAGGGCCATTTTTTTTTTGTGTGCCCCTGCAAAAGAGGGGTATTAATTTAGCTTCTCCTAAAATGGGCCTTCTACCGGGGCATTTTAATTGGTTCCCATATGGGTTAAAAGTATATTTTCTATTTTAATTGGCAGCCCTGCCCTTTGTTTTGTTTTTTTCTTTTCCCCCCTTTGTTTTTGCGGAAGGGAAGGGTAACGGGTTCCTCTTCCCTTATTGTTGGGTACGCATAACTTATCTTGTTTATTTAGGGTCTTTTTATCCCTAGTTTGTAAAATTGTAAAATGGAAAAGTTAATGCAAATGTTTCCTTTCGGGGGAAAATTTTATTAATGAAAAAAAAATTTTCCAAAAATAAGGTGGTTAATTAAAGGC
  3   1   2       bld HdA       in                    THdA034j16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCAAATGTTGTATCCCCAGCAATACGTGAAGTTTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTTTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTATATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTTTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAATAATGAAAAAAAGAAATTTACAAAAATAAAGTGTTAAATAAAGCAAAAAAAAAAAAAAAAAAGC
  5   1   2       bld Egg                            TEgg030m10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTGTATCCCCAGCAATACGTGAAGTCTAAAGGGAGTCATTAACACTTTTGTACTGGCCCTTTTAGCAGCAAAAAGGACAACACCCATGCAATTGGTTGTTATCAGTATTTTTATTCCTTGTTTTTAACCCCGGTGAACCTTAACCAGAGAACTTAACTAAATCAAAAGGGACATTTACATTTTGTGTGTCACTGCAAAAGATGAGTATTAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATACAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAATAATG
  5   1   2       bld Tad5                                  XZT4505.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAATTTAGCTTCTACTAAAATGAGACATCTAACAGAGCATTTTAATTGGTTCACATATTGGTTAAAAGTATATTTTCTATTTTAATTTGCAGCCCTTGCCTTTGTTTTGTTTTTTTCTTTTTCCCACTTTGTTTTTGCTGAAGGGAAGGGTAACTGGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTGTAAAATAGAAAAGTTAATGCAAATGTTTGCATTCTGGAGAAAATATTAATAATGAAAAAAAAAATTTACAAAAATAAAGTAGTTaaataaaagcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGG
  3   1   2       bld Eye       in                         CCAX4322.g3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGTTCCTCTTCCCTTATTGTTAGGTACGCATAACTTATCTTGTTTATTTATGGTCTTTTTATACCTAGTTTGTAAAATTTTAAAATAGAAAAGTTAATGCAAATGTTG

In case of problems mail me! (