Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012074391 Xt7.1-CBXT5804.3 - 80 ESTs
                                                                       .........-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CBXT5804.3                              ACAGTAGGGAGGCCGAAGGTCTGAGTTCGGTAGTTCCAGCCGGAGAGACGATGAACCCGGACTTGAGCAGGGAGAGGGCCGCCGCCTCATTCAACCCCGAAACCATCACCGTCATCCTGGATGGCAGCCCTGAGAGGACCCGCAGGAGGAGGGAGATTGAGGGCCTGGTTCTCAATGACCCCAGCTTCCAGCATGAGGACCCCAACTTTCTGTCTCGCAGTGAGCGCTACGAGCTGGCCATCAAGAAGAGCGCCCTGATGGTTCAGAAGATGAGGGAGCATGGCATCTCCGACCCAGAGGAGATCTACTGGTTCAAGAGTTTTGTTCACCGGGGCCGCCCTGAGCCCCTAGATCTTCACCTGGGCATGTTCTTGCCCACGCTATTGAACCAGGCTACGCCCGAGCAGCAGGAGCGTCTCTTCATGCCTGCCTGGAACCTGGAGATCATTGGGACCTATGCTCAAACTGAGATGGGACATGGAACCCACCTTCGAGGGCTGGAGACCACAGCTACCTATGATCCATCTACTCAGGAGTTCATCCTCAATAGCCCAACGGTCTCTTCTATCAAGTGGTGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAACTTTACACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCTTAAGTTTGACAAGCTTCGGATTCCTCGAGAGAATATGCTGATGAAGTACGCCAAGGTGGAGCCAGACGGCACCTATGTGAAGCCGCTGAGTGACAAACTGACCTACGGCACTATGGTGTTCATTCGTTCAATGATCGTAGGAGACTCCGCTCGCAGCCTTTCCCGGGCCTGTACCATTGCCATCCGCTATAGTGCTGTGAGGCACCAGTCAGAGATCAGAGCTGGGGAGCCGGAGCCCCAAATCCTAGACTTTCAGACTCAGCAGTACAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTATATGAGCCACACGTACCACAGAATCAGCGCTGAAATCCAAGCGGGTAACCTGAACGAACTGCCCGAGCTGCACGCCCTTTCTGCGGGCTTAAAAGCCTTCACCACGTGGGCAGCCAACACGGGTATCGAGGAGTGCCGGATGGCATGTGGGGGGCATGGATACTCCCGTTGCAGTGGGATCCCCGATATCTATGTGACCTTTACCCCCGCCTGCACATATGAGGGGGAAAACACAGTGATGATGCTGCAGACTGCAAGATTTTTGGTGAAAAGCTACAAAGCGGTTCTTTCTGGGAAACGACTTGACGGGATGGTGTCGTACCTTAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCCGTGGCCGGCCGATCCTTGGTCAAAGACATCAACGACATTCAAAATCTGGTCGAGGCCTACAAACAGCGAGCTGCTTGGCTAGTGGTGGCCGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGATCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCTCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTTAAAAAAAAA
                                                  Xt7.1-CHK-1008223951                                    GGGAGGCCGAAGGTCTGAGTTCGGTAGTTCCAGCCGGAGAGACGATGAACCCGGACTTGAGCAGGGAGAGGGCCGCCGCCTCATTCAACCCCGAAACCATCACCGTCATCCTGGATGGCAGCCCTGAGAGGACCCGCAGGAGGAGGGAGATTGAGGGCCTGGTTCTCAATGACCCCAGCTTCCAGCATGAGGACCCCAACTTTCTGTCTCGCAGTGAGCGCTACGAGCTGGCCATCAAGAAGAGCGCCCTGATGGTTCAGAAGATGAGGGAGCATGGCATCTCCGACCCAGAGGAGATCTACTGGTTCAAGAGTTTTGTTCACCGGGGCCGCCCTGAGCCCCTAGATCTTCACCTGGGCATGTTCTTGCCCACGCTATTGAACCAGGCTACGCCCGAGCAGCAGGAGCGTCTCTTCATGCCTGCCTGGAACCTGGAGATCATTGGGACCTATGCTCAAACTGAGATGGGACATGGAACCCACCTTCGAGGGCTGGAGACCACAGCTACCTATGATCCATCTACTCAGGAGTTCATCCTCAATAGCCCAACGGTCTCTTCTATCAAGTGGTGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAACTTTACACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCTTAAGTTTGACAAGCTTCGGATTCCTCGAGAGAATATGCTGATGAAGTACGCCAAGGTGGAGCCAGACGGCACCTATGTGAAGCCGCTGAGTGACAAACTGACCTACGGCACTATGGTGTTCATTCGTTCAATGATCGTAGGAGACTCCGCTCGCAGCCTTTCCCGGGCCTGTACCATTGCCATCCGCTATAGTGCTGTGAGGCACCAGTCAGAGATCAGAGCTGGGGAGCCGGAGCCCCAAATCCTAGACTTTCAGACTCAGCAGTACAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTATATGAGCCACACGTACCACAGAATCAGCGCTGAAATCCAAGCGGGTAACCTGAACGAACTGCCCGAGCTGCACGCCCTTTCTGCGGGCTTAAAAGCCTTCACCACGTGGGCAGCCAACACGGGTATCGAGGAGTGCCGGATGGCATGTGGGGGGCATGGATACTCCCGTTGCAGTGGGATCCCCGATATCTATGTGACCTTTACCCCCGCCTGCACATATGAGGGGGAAAACACAGTGATGATGCTGCAGACTGCAAGATTTTTGGTGAAAAGCTACAAAGCGGTTCTTTCTGGGAAACGACTTGACGGGATGGTGTCGTACCTTAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCCGTGGCCGGCCGATCCTTGGTCAAAGACATCAACGACATTCAAAATCTGGTCGAGGCCTACAAACAGCGAGCTGCTTGGCTAGTGGTGGCCGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGATCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCTCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTTAAAAAAAAAAAAAAA
                                                      consensus depths                                   2     2     3     3     4     4     6     6     8     8     9     9    11    11    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    15    13    15    13    15    13    15    14    16    14    16    14    16    14    16    15    16    14    16    14    16    15    17    16    17    16    17    16    17    16    17    16    18    16    17    16    18    18    19    17    19    17    19    18    19    18    20    18    20    18    21    18    21    18    21    20    21    20    21    20    21    20    21    20    22    20    22    20    22    20    21    20    21    20    21    19    20    18    19    18    19    16    17    17    18    15    16    15    16    15    16    14    16    16    17    16    17    15    16    14    15    13    16    13    16    13    16    14    16    13    16    14    18    14    18    15    18    15    18    15    18    15    18    16    18    16    17    16    17    16    17    16    16    16    16    16    16    14    17    14    17    14    17    14    18    15    17    14    16    14    16    14    16    13    16    13    16    13    16    13    16    14    17    14    17    14    19    15    19    14    19    14    19    14    19    14    18    15    18    16    19    16    19    17    21    17    22    17    22    16    22    17    23    18    23    18    21    18    20    19    22    17    21    18    21    19    22    20    23    20    23    21    24    21    24    21    24    21    25    21    25    21    24    23    26    22    25    21    25    21    26    21    25    21    25    21    25    20    25    21    25    20    25    22    26    20    26    20    26    20    26    21    26    20    26    20    26    21    25    22    25    22    24    22    24    22    24    23    24    22    24    23    24    23    25    23    26    24    27    27    32    26    34    30    36    33    37    34    38    34    37    30    35    34    37    33    39    34    39    34    39    34    40    33    40    33    41    30    38    33    39    34    40    34    40    35    40    37    41    36    41    34    39    33    39    32    37    32    37    31    37    30    37    30    37    30    37    29    36    29    36    29    36    29    36    29    36    28    34    28    32    28    32    28    32    27    29    27    29    26    28    26    26    26    26    26    26    25    26    25    26    25    26    25    26    25    26    25    26    25    25    25    25    25    25    25    25    25    25    25    26    24    26    23    26    22    25    22    25    23    25    23    25    23    25    23    25    23    25    22    24    21    24    20    23     4     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                  -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                              ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ------T-----
                                               BLH ATG      50    2081                              
                                               BLH MIN      20     275                              
                                               BLH MPR     -10     275                              
                                               EST CLI      25       1                              
                                                                                                               PROTEIN --- Sc ==== 1e-073     NP_011310.1 Fatty-acyl coenzyme A oxidase, involved in the fatty acid beta-oxidation pathway; localized to the peroxisomal matrix [Saccharomyces cerevisiae] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                               PROTEIN -== Ce ==== 9e-156     NP_001021089.1 F08A8.1a [Caenorhabditis elegans] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                       PROTEIN --- Dm ==== 5e-158     NP_611264.2 CG5009-PA [Drosophila melanogaster] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                          PREDICTED - Sp ---- 6e-179     XP_783450.2 PREDICTED: similar to acyl-CoA oxidase type 1 [Strongylocentrotus purpuratus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                      PROTEIN === Dr ==== 0          NP_001005933.1 zgc:92584 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                      PROTEIN === Mm ==== 0          NP_056544.2 acyl-Coenzyme A oxidase 1, palmitoyl [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                      PROTEIN === Hs ==== 0          NP_004026.2 acyl-Coenzyme A oxidase isoform a; acyl-coenzyme A oxidase 1 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                   PROTEIN === Gg ==== 0          NP_001006205.1 similar to acyl-CoA oxidase type 2 [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                      PROTEIN === Xl ==== 0          AAI08648.1 MGC131363 protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                      PREDICTED = ?? ==== 0          NP_001090149.1 hypothetical protein LOC735228 [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                      PROTEIN === Xt ==== 0          AAH89698.1 Unknown (protein for MGC:108278) [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CBXT5804.3                                                                                ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------TGA------------------TGA------ATG---------------------------------------------TGATGA------------------------------------------------------TAA---------------------------------------------------TAG---------------------------------------------------------------------------TAATAA---------------------TAG------------TGA------------TAG---------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------ATGTAA---------TGA---------------------------------------------------------------------------TAA------------------TGA------------------------------TAA------TGA------------------------ATGTAA---TGATAATAA---------------TAA
                                                                   ORF                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   1           AbdN FL                     IMAGE:7020769.FL-MGC                                                  CTGAGTTCGGTAGTTCCAGCCGGAGAGACGATGAACCCGGACTTGAGCAGGGAGAGGGCCGCCGCCTCATTCAACCCCGAAACCATCACCGTCATCCTGGATGGCAGCCCTGAGAGGACCCGCAGGAGGAGGGAGATTGAGGGCCTGGTTCTCAATGACCCCAGCTTCCAGCATGAGGACCCCAACTTTCTGTCTCGCAGTGAGCGCTACGAGCTGGCCATCAAGAAGAGCGCCCTGATGGTTCAGAAGATGAGGGAGCATGGCATCTCCGACCCAGAGGAGATCTACTGGTTCAAGAGTTTTGTTCACCGGGGCCGCCCTGAGCCCCTAGATCTTCACCTGGGCATGTTCTTGCCCACGCTATTGAACCAGGCTACGCCCGAGCAGCAGGAGCGTCTCTTCATGCCTGCCTGGAACCTGGAGATCATTGGGACCTATGCTCAAACTGAGATGGGACATGGAACCCACCTTCGAGGGCTGGAGACCACAGCTACCTATGACCCATCTACTCAGGAGTTCATCCTCAATAGCCCAACGGTCTCTTCTATCAAGTGGTGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAACTTTACACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCTTAAGTTTGACAAGCTTCGGATTCCTCGAGAGAATATGCTGATGAAGTACGCCAAGGTGGAGCCAGACGGCACCTATGTGAAGCCGCTCAGTGACAAACTGACCTACGGCACTATGGTGTTCATTCGTTCAATGATCGTAGGAGACTCCGCGCGCAGCCTTTCCCGGGCCTGTACCATTGCCATCCGCTATAGTGCTGTGAGGCACCAGTCAGAGATCAGAGCGGGGGAGCCGGAGCCCCAAATCCTAGACTTTCAGACTCAGCAGTACAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTATATGAGCCACACGTACCACAGAATCAGCGCTGAAATCCAAGCTGGTAACCTGAACGAACTGCCCGAGCTGCACGCCCTTTCTGCGGGCTTAAAAGCCTTCACCACGTGGGCAGCCAACACGGGTATCGAGGAGTGCCGGATGGCATGTGGGGGGCATGGATACTCCCGTTGCAGTGGGATCCCCGATATCTATGTGACCTTTACCCCCGCCTGCACATATGAGGGGGAAAACACAGTGATGATGCTGCAGACTGCAAGATTTTTGGTGAAAAGCTACAAAGCGGTTCTTTCTGGGAAACGACTTGACGGGATGGTGTCGTACCTTAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCCGTGGCCGGCCGATCCTTGGTCAAAGACATCAACGACATTCAAAATCTGGTCGAGGCCTACAAACAGCGAGCTGCTTGGCTAGTGGTGGCCGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGATCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCTCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2   14  bld Brn3 5g3  in                         CAAK1925.5p CTGACAGTAGGGAGGGCGGGGCTTGCCTGACAGTAGGGAGGCCGAAGGTCTGAGTTCGGTAGTTCCAGCCGGAGAGACGATGAACCCGGACTTGAGCAGGGAGAGGGCCGCCGCCTCATTCAACCCCGAAACCATCACCGTCATCCTGGATGGCAGCCCTGAGAGGACCCGCAGGAGGAGGGAGATTGAGGGCCTGGTTCTCAATGACCCCAGCTTCCAGCATGAGGACCCCAACTTTCTGTCTCGCAGTGAGCGCTACGAGCTGGCCATCAAGAAGAGCGCCCTGATGGTTCAGAAGATGAGGGAGCATGGCATCTCCGACCCAGAGGAGATCTACTGGTTCAAGAGTTTTGTTCACCGGGGCCGCCCTGAGCCCCTAGATCTTCACCTGGGCATGTTCTTGCCCACGCTATTGAACCAGGCTACGCCCGAGCAGCAGGAGCGTCTCTTCATGCCTGCCTGGAACCTGGAGATCATTGGGACCTATGCTCAAACTGAGATGGGACATGGAACCCACCTTCGAGGGCTGGAGACCACAGCTACCTATGATCCATCTACTCAGGAGTTCATCCTCAATAGCCCAACGGTCTCTTCTATCAAGTGGTGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAACTTTACACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAA
  5   1   2   14  bld Brn3 5g3  in                         CAAK1510.5p .............................ACAGTAGGGAGGCCGAAGGTCTGAGTTCGGTAGTTCCAGCCGGAGAGACGATGAACCCGGACTTGAGCAGGGAGAGGGCCGCCGCCTCATTCAACCCCGAAACCATCACCGTCATCCTGGATGGCAGCCCTGAGAGGACCCGCAGGAGGAGGGAGATTGAGGGCCTGGTTCTCAATGACCCCAGCTTCCAGCATGAGGACCCCAACTTTCTGTCTCGCAGTGAGCGCTACGAGCTGGCCATCAAGAAGAGCGCCCTGATGGTTCAGAAGATGAGGGAGCATGGCATCTCCGACCCAGAGGAGATCTACTGGTTCAAGAGTTTTGTTCACCGGGGCCGCCCTGAGCCCCTAGATCTTCACCTGGGCATGTTCTTGCCCACACTATTGAATCAGGCTACGCCCGAGCAGCAGGAGCGTCTCTTCATGCCTGCCTGGAACCTGGAGATCATTGGGACCTATGCTCAAACTGAGATGGGACATGGAACCCACCTTCGAGGGCTGGAGACCACAGCTACCTATGATCCATCTACTCAGGAGTTCATCCTCAATAGCCCAACGGTCTCTTCTATCAAGTGGTGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAACTTTACACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCTTAAGTTTGACAAGCTTCGGATTCCTCGAGAGAATATGCTGATGAAGTACGCCAAGGT
  5   1   2       bld Gas8 5g                               st25h03.5p                                       AGGCCGAAGGTCTGAGTTCGGTAGTTCCAGCCGGAGAGACGATGAACCCGGACTTGAGCAGGGAGAGGGCCGCCGCCTCATTCAACCCCGAAACCATCACCGTCATCCTGGATGGCAGCCCTGAGAGGACCCGCAGGAGGAGGGAGATTGAGGGCCTGGTTCTCAATGACCCCAGCTTCCAGCATGAGGACCCCAACTTTCTGTCTCGCAGTGAGCGCTACGAGCTGGCCATCAAGAAGAGCGCCCTGATGGTTCAGAAGATGAGGGAGCATGGCATCTCCGACCCAGAGGAGATCTACTGGTTCAAGAGTTTTGTTCACCGGGGCCGCCCTGAGCCCCTAGATCTTCACCTGGGCATGTTCTTGCCCACGCTATTGAACCAGGCTACGCCCGAGCAGCAGGAGCGTCTCTTCATGCCTGCCTGGAACCTGGAGATCATTGGGACCTATGCTCAAACTGAGATGGGACATGGAACCCACCTTCGAGGGCTGGAGACCACAGCTACCTATGATCCATCTACTCAGGAGTTCATCCTCAATAGCCCAACGGTCTCTTCTATCAAGTGGTGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAACTTTACACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAG
  5   1   2   10  bld Spl2 5g3  in                        CBSS6883.fwd ............................................AAGGTCTGAGTTCGGTAGTTCCAGCCGGAGAGACGATGAACCCGGACTTGAGCAGGGAGAGGGCCGCCGCCTCATTCAACCCCGAAACCATCACCGTCATCCTGGATGGCAGCCCTGAGAGGACCCGCAGGAGGAGGGAGATTGAGGGCCTGGTTCTCAATGACCCCAGCTTCCAGCATGAGGACCCCAACTTTCTGTCTCGCAGTGAGCGCTACGAGCTGGCCATCAAGAAGAGCGCCCTGATGGTTCAGAAGATGAGGGAGCATGGCATCTCCGACCCAGAGGAGATCTACTGGTTCAAGAGTTTTGTTCACCGGGGCCGCCCTGAGCCCCTAGATCTTCACCTGGGCATGTTCTTGCCCACACTATTGAATCAGGCTACGCCCGAGCAGCAGGAGCGTCTCTTCATGCCTGCCTGGAACCTGGAGATCATTGGGACCTATGCTCAAACTGAGATGGGACATGGAACCCACCTTCGAGGGCTGGAGACCACAGCTACCTATGATCCATCTACTCAGGAGTTCATCCTCAATAGCCCAACGGTCTCTTCTATCAAGTGGTGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAACTTTACACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCTTAAGTTTGACAAGCTTC
  5   1   2       bld Te4       in                        CAAN12287.5p                                                       TTCGGTAGTTCCAGCCGGAGAGACGATGAACCCGGACTTGAGCAGGGAGAGGGCCGCCGCCTCATTCAACCCCGAAACCATCACCGTCATCCTGGATGGCAGCCCTGAGAGGACCCGCAGGAGGAGGGAGATTGAGGGCCTGGTTCTCAATGACCCCAGCTTCCAGCATGAGGACCCCAACTTTCTGTCTCGCAGTGAGCGCTACGAGCTGGCCATCAAGAAGAGCGCCCTGATGGTTCAGAAGATGAGGGAGCATGGCATCTCCGACCCAGAGGAGATCTACTGGTTCAAGAGTTTTGTTCACCGGGGCCGCCCTGAGCCCCTAGATCTTCACCTGGGCATGTTCTTGCCCACACTATTGAATCAGGCTACGCCCGAGCAGCAGGAGCGTCTCTTCATGCCTGCCTGGAACCTGGAGATCATTGGGACCTATGCTCAAACTGAGATGGGACATGGAACCCACCTTCGAGGGCTGGAGACCACAGCTACCTATGATCCATCTACTCAGGAGTTCATCCTCAATAGCCCAACGGTCTCTTCTATCAAGTGGTGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAACTTTACACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCTTAAGTTTGACAAGCTTCGGATTCCTCGAGAGAATATGCTGATGAAGTA
  5   1   2   10  bld Eye  5g3  in                         CCAX1305.b1 .................................................................CAGCCGGAGAGACGATGAACCCGGACTTGAGCAGGGAGAGGGCCGCCGCCTCATTCAACCCCGAAACCATCACCGTCATCCTGGATGGCAGCCCTGAGAGGACCCGCAGGAGGAGGGAGATTGAGGGCCTGGTTCTCAATGACCCCAGCTTCCAGCATGAGGACCCCAACTTTCTGTCTCGCAGTGAGCGCTACGAGCTGGCCATCAAGAAGAGCGCCCTGATGGTTCAGAAGATGAGGGAGCATGGCATCTCCGACCCAGAGGAGATCTACTGGTTCAAGAGTTTTGTTCACCGGGGGCCGCCCTGAGCCCCTAGATCTTCACCTGGGCATGTTCTTGCCCACACTATTGAATCAGGCTACGCCCGAGCAGCAGGAGCGTCTCTTCATGCCTGCCTGGAACCTGGAGATCATTGGGGACCTATGCTCAAACTGAGATGGGACATGGAACCCACCTTCGAGGGCTGGAGACCACAG
  5   1   2       chi AbdN FL                            IMAGE:7020769                                                                   TGCCGGAGAGACGATGAACCCGGACTTGAGCAGGGAGAGGGCCGCCGCCTCATTCAACCCCGAAACCATCACCGTCATCCTGGATGGCAGCCCTGAGAGGACCCGCAGGAGGAGGGAGATTGAGGGCCTGGTTCTCAATGACCCCAGCTTCCAGCATGAGGACCCCAACTTTCTGTCTCGCAGTGAGCGCTACGAGCTGGCCATCAAGAAGAGCGCCCTGATGGTTCAGAAGATGAGGGAGCATGGCATCTCCGACCCAGAGGAGATCTACTGGTTCAAGAGTTTTGTTCACCGGGGCCGCCCTGAGCCCCTAGATCTTCACCTGGGCATGTTCTTGCCCACGCTATTGAACCAGGCTACGCCCGAGCAGCAGGAGCGTCTCTTCATGCCTGCCTGGAACCTGGAGATCATTGGGACCTATGCTCAAACTGAGATGGGACATGGAACCCACCTTCGAGGGCTGGAGACCACAGCTACCTATGACCCATCTACTCAGGAGTTCAATCCTCAATAGCCCAACGGTCTCTTCTATCAAGTGGTGGCCCGGAGGATTGGGGAAAGACCTCAAACCATGCAGTAGTTTTTGGGCTCAAACTTTACACACAAGGAAGAATGTTAAAAGGGCTTTCATGCTTTTCATAAGTGCCCATCCGCCACATGGGGTACCCCACGAACCCTCTCCCCTGGTGTGGTGGGTTGGAAGGACAATAGGGCCCCAAGTTTTGGGGTTTTGAATGAAAACGGAACAACGGGGTTCCCTTTAATTTTGAACAAGCCTTCCGGATTTCCTTCGAAAAGAAAAATTGCTGAATAAAATTACCCCCAAGGGTGGAAGCCCAGAAGGGGCACCCTATTGTGGAAAGCCCCCCTTCAGTGAGACAAAATTGGACCCTTCCGGGGAAGTAATGGGTGGTTCCATATCTCCGTTCCAAATGGAATCCCGAAGGGGAGAACTTCCGCGCGCGGCCAAGTCCTTTNTTCCCGAGGGGCCTTGGTAACCAATATGGCCCAATTCAGCGCTT
  5   1   2   14  bld Te4  5g3  in                         CAAN9895.5p ............................................................................ACGATGAACCCGGACTTGAGCAGGGAGAGGGCCGCCGCCTCATTCAACCCCGAAACCATCACCGTCATCCTGGATGGCAGCCCTGAGAGGACCCGCAGGAGGAGGGAGATTGAGGGCCTGGTTCTCAATGACCCCAGCTTCCAGCATGAGGACCCCAACTTTCTGTCTCGCAGTGAGCGCTACGAGCTGGCCATCAAGAAGAGCGCCCTGATGGTTCAGAAGATGAGGGAGCATGGCATCTCCGACCCAGAGGAGATCTACTGGTTCAAGAGTTTTGTTCACCGGGGCCGCCCTGAGCCCCTAGATCTTCACCTGGGCATGTTCTTGCCCACACTATTGAATCAGGCTACGCCCGAGCAGCAGGAGCGTCTCTTCATGCCTGCCTGGAACCTGGAGATCATTGGGACCTATGCTCAAACTGAGATGGGACATGGAACCCACCTTCGAGGGCTGGAGACCACAGCTACCTATGATCCATCTACTCAGGAGTTCATCCTCAATAGCCCAACGGTCTCTTCTATCAAGTGGTGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAACTTTACACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCT
  5   1   2       bld TbA       in                   TTbA028n08.p1kSP6                                                                                      CCGGACTTGAGCAGGGAGAGGGCCGCCGCCTCATTCAACCCCGAAACCATCACCGTCATCCTGGAAGGCAGCCCTGAGAGGACCCGCAGGAGGAGGGAGATCGAGGGCCTGGTTCTCAATGACCCCAGCTTCCAGCATGAGGACCCCAACTTTCTGTCTCGCAGTGAGCGCTACGAGCTGGCCATCAAGAAGAGCGCCCTGATGGTTCAGAAGATGAGGGAGCATGGCATCTCCGACCCAGAGGAGATCTACTGGTTCAAGAGTTTTGTTCACCGGGGCCGCCCTGAGCCCCTAGATCTTCACCTGGGCATGTTCTTGCCCACGCTATTGAACCAGGCTACGCCCGAGCAGCAGGAGCGTCTCTTCATGCCTGCCTGGAACCTGGAGATCATTGGGACCTATGCTCAAACTGAGATGGGACATGGAACCCACCTTCGAGGGCTGGAGACCACAGCTACCTATGATCCATCTACTCAGGAGTTCATCCTCAATAGCCCAACGGTCTCTTCTATCAAGTGGTGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAACTTTACACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCTTAAGTTTGACAAGCTTCGGATTCCTCGAGAGAATATGCTGATGAAGTACGCCAAGGTGGAGCCAGACGGCACCTATGTGAAGCCGCTGAGTGACAAACTGACCTACGGCACTATGGTGTTCAT
  5   1   2       bld Lun1      in                         CABD8689.5p                                                                                           CTTGAGCAGGGAGAGGGCCGCCGCCTCATTCAACCCCGAAACCATCACCGTCATCCTGGATGGCAGCCCTGAGAGGACCCGCAGGAGGAGGGAGATTGAGGGCCTGGTTCTCAATGACCCCAGCTTCCAGCATGAGGACCCCAACTTTCTGTCTCGCAGTGAGCGCTACGAGCTGGCCATCAAGAAGAGCGCCCTGATGGTTCAGAAGATGAGGGAGCATGGCATCTCCGACCCAGAGGAGATCTACTGGTTCAAGAGTTTTGTTCACCGGGGCCGCCCTGAGCCCCTAGATCTTCACCTGGGCATGTTCTTGCCCACGCTATTGAACCAGGCTACGCCCGAGCAGCAGGAGCGTCTCTTCATGCCTGCCTGGAACCTGGAGATCATTGGGACCTATGCTCAAACTGAGATGGGACATGGAACCCACCTTCGAGGGCTGGAGACCACAGCTACCTATGATCCATCTACTCAGGAGTTCATCCTCAATAGCCCAACGGTCTCTTCTATCAAGTGGTGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAACTTTACACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCTTAAGTTTGACAAGCTTCGGATTC
  5   1   2       bld Tad5      in                          XZT9180.5p                                                                                           CTTGAGCAGGGAGAGGGCCGCCGCCTCATTCAACCCCGAAACCATCACCGTCATCCTGGATGGCAGCCCTGAGAGGACCCGCAGGAGGAGGGAGATTGAGGGCCTGGTTCTCAATGACCCCAGCTTCCAGCATGAGGACCCCAACTTTCTGTCTCGCAGTGAGCGCTACGAGCTGGCCATCAAGAAGAGCGCCCTGATGGTTCAGAAGATGAGGGAGCATGGCATCTCCGACCCAGAGGAGATCTACTGGTTCAAGAGTTTTGTTCACCGGGGCCGCCCTGAGCCCCTAGATCTTCACCTGGGCATGTTCTTGCCCACGCTATTGAACCAGGCTACGCCCGAGCAGCAGGAGCGTCTCTTCATGCCTGCCTGGAACCTGGAGATCATTGGGACCTATGCTCAAACTGAGATGGGACATGGAACCCACCTTCGAGGGCTGGAGACCACAGCTACCTATGATCCATCTACTCAGGAGTTCATCCTCAATAGCCCAACGGTCTCTTCTATCAAGTGGTGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAACTTTTCACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCTTAAGTTTGACAAGCTTCGGATTCCTCGAGAGAATATGCTGATGAAGTACGCCAAGGTGGAGCCAGACGGCACCTATGTGAAGCCGCTGAGTGANCAACTGACCTACGGCACTATGGTGTTCATTCCGTCAATGATCG
  5   1   2       bld Liv1      in                         CAAR7699.5p                                                                                                                                 AAACCATCACCGTCATCCTGGATGGCAGCCCTGAGAGGACCCGCAGGAGGAGGGAGATTGAGGGCCTGGTTCTCAATGACCCCAGCTTCCAGCATGAGGACCCCAACTTTCTGTCTCGCAGTGAGCGCTACGAGCTGGCCATCAAGAAGAGCGCCCTGATGGTTCAGAAGATGAGGGAGCATGGCATCTCCGACCCAGAGGAGATCTACTGGTTCAAGAGTTTTGTTCACCGGGGCCGCCCTGAGCCCCTAGATCTTCACCTGGGCATGTTCTTGCCCACGCTATTGAACCAGGCTACGCCCGAGCAGCAGGAGCGTCTCTTCATGCCTGCCTGGAACCTGGAGATCATTGGGACCTATGCTCAAACTGAGATGGGACATGGAACCCACCTTCGAGGGCTGGAGACCACAGCTACCTATGATCCATCTACTCAGGAGTTCATCCTCAATAGCCCAACGGTCTCTTCTATCAAGTGGTGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAACTTTACACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCTTAAGTTTGACAAGCTTCGGATTCCTCGAGAGAATATGCTGATGAAGTACGCCAAGGTGGAGCCAGACGGCACCTATGTGAAGCCGCTGAGTGACAAACTGACCTACGGCACTATGGTGTTCATTCGTTCAATGATCGTAGGAGACTCCGCTCGCAGCCTTTCCCGGGCCTGTACCATTGCCATCCGCTATAGTGCT
  5   1   2       chi In63                            IMAGE:8957765.5p                                                                                                                                                                                                                                                     CACGTTGAGCGCTACGAGCTGGCCATCAAGAAGAGCGCCCTGATGGTTCAGAAGATGAGGGAGCATGGCATCTCCGACCCAGAGGAGATCTACTGGTTCAAGAGAACCTGCCTTGGCTCTCAAACCGACCCCCTGGGCTTACACTTCAGTATGTTCAGCAACATGTTAGCCCAGCAATTGACGGACGAGCAGAACCAGAAATGGTATCCCCTTACCAGCCGCCTACAGGCCATTGGCACCTATGCCCAGACCGAGCTGGGACATGGAACCCACCTTCGAGGGCTGGAGACCACAGCTACCTATGATCCATCTACTCAGGAGTTCATCCTCAATAGCCCAACGGTCTCTTCTATCAAGTGGTGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAACTTTACACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCTTAAGTTTGACAAGCTTCGGATTCCTCGAGAGAATATGCTGATGAAGTACGCCAAGGTGGAGCCAGACGGCACCTATGTGAAGCCGCTGAGTGACAAACTGACCTACGGCACTATGGTGTTCATTCGTTCAATGATCGTAGAGACTCCGCTCGCAGCCTTTCCCGGGCCTGTACCATTGCCATCCGCTATAGTGCTGTGAGCACAGTCAGAGATCAGAGCTGGGGGAGCGGAGCCCCAAATCTAGACTTTCGACTCAGCAGTACAAGTTATCGCTGCTGCTACGCCATACGCTCAGTTGTGGATCTAATTGAGCCAACGTACCACAGATTCAGC
  3   1   2       bld Lun1      in                         CABD8689.3p                                                                                                                                                                                                                                                                                                                                GACCCAGAGGAGATCTACTGGTTCAAGAGTTTTGTTCACCGGGGCCGCCCTGAGCCCCTAGATCTTCACCTGGGCATGTTCTTGCCCACGCTATTGAACCAGGCTACGCCCGAGCAGCAGGAGCGTCTCTTCATGCCTGCCTGGAACCTGGAGATCATTGGGACCTATGCTCAAACTGAGATGGGACATGGAACCCACCTTCGAGGGCTGGAGACCACAGCTACCTATGATCCATCTACTCAGGAGTTCATCCTCAATAGCCCAACGGTCTCTTCTATCAAGTGGTGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAACTTTACACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCTTAAGTTTGACAAGCTTCGGATTC
  5   1   2       bld In54                            IMAGE:8947254.5p                                                                                                                                                                                                                                                                                                                                  TAGTCTTTGTGGGAGGGAAATTAAATGTATTCAAAATTCGTCCCGCCCTGAGCCCCTAGATCTTCACCTGGGCATGTTCTTGCCCACGCTATTGAACCAGGCTACGCCCGAGCAGCAGGAGCGTCTCTTCATGCCTGCCTGGAACCTGGAGATCATTGGGACCTATGCTCAAACTGAGATGGGACATGGAACCCACCTTCGAGGGCTGGAGACCACAGCTACCTATGATCCATCTACTCAGGAGTTCATCCTCAATAGCCCAACGGTCTCTTCTATCAAGTGGTGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAACTTTACACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCTTAAGTTTGACAAGCTTCGGATTCCTCGAGAGAATATGCTGATGAAGTACGCCAAGGTGGAGCCAGACGGCACCTATGTGAAGCCGCTGAGTGACAAACTGACCTACGGCACTATGGTGTTCATTCGTTCAATGATCGTAGGAGACTCCGCTCGCAGCCTTTCCCGGGCCTGTACCATTGCCATCCGCTATAGTGCTGTGAGGCACCAGTCAGAGATCAGAGCTGGGGAGCCGGAGCCCCAAATCCTAGACTTTCAGACTCAGCAGTACAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTATATGAGCCACACGTACCACAGAATCAGCGCTGAATCCAAGCGGGTACTGACGACTGCCCGAGCTGCACGCCCTTTCTGCGGCTAAAGCTCACACGTGGGCAGCACACGGGTATCGAGATGCGATGCATGGTGGGGGGCATGGGATACCTCCG
  5   1   2       bld Fat1      in                         CABC5872.5p                                                                                                                                                                                                                                                                                                                                                                               CCCTGAGCCCCTAGATCTTCACCTGGGCATGTTCTTGCCCACGCTATTGAACCAGGCTACGCCCGAGCAGCAGGAGCGTCTCTTCATGCCTGCCTGGAACCTGGAGATCATTGGGACCTATGCTCAAACTGAGATGGGACATGGAACCCACCTTCGAGGGCTGGAGACCACAGCTACCTATGATCCATCTACTCAGGAGTTCATCCTCAATAGCCCAACGGTCTCTTCTATCAAGTGGTGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAACTTTACACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCTTAAGTTTGACAAGCTTCGGATTCCTCGAGAGAATATGCTGATGAAGTACGCCAAGGTGGAGCCAGACGGCACCTATGTGAAGCCGCTGAGTGACAAACTGACCTACGGCACTATGGTGTTCATTCGTTCAATGATCGTAGGAGACTCCGCTCGCAGCCTTTCCCGGGCCTGTACCATTGCCATCCGCTATAGTGCTGTGAGGCACCAGTCAGAGATCAGAGCTGGGGAGCCGGAGCCCCAAATCCTAGACTTTCAGACTCAGCAGTACAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTATATGAGCCACACGTACCACAGAATCAGCGCTGAAATCCAGCGGGTAACCTGAACGAACTGCCCGAGCTGCACGCCCTTTCTGCGGGCTTAAAAGCCTTCACCAC
  5   1   2       bld Tad5      in                         XZT36413.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAACCTGGAGATCATTGGGACCTATGCTCAAACTGAGATGGGACATGGAACCCACCTTCGAGGGCTGGAGACCACAGCTACCTATGATCCATCTACTCAGGAGTTCATCCTCAATAGCCCAACGGTCTCTTCTATCAAGTGGTGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAACTTTACACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCTTAAGTTTGACAAGCTTCGGATTCCTCGAGAGAATATGCTGATGAAGTACGCCAAGGTGGAGCCAGACGGCACCTATGTGAAGCCGCTGAGTGACAAACTGACCTACGGCACTATGGTGTTCATTCGTTCAATGATCGTAGGAGACTCCGCTCGCAGCCTTTCCCGGGCCTGTACCATTGCCATCCGCTATAGTGCTGTGAGGCACCAGTCAGAGATCAGAGCTGGGGAGCCGGAGCCCCAAATCCTAGACTTTCAGACTCAGCAGTACAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTATATGAGCCACACGTACCACAGAATCAGCGCTGAAATCCAAGCGGGTAACCTGAACGAACTGCCCGAGCTGCACGCCCTTTCTGCGGGC
  5   1   2       bld In60                            IMAGE:8951301.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATTTGTTTCTTTTTGTTTGTATATTTTTAAAAATAAAATTTTCCCCTCAGGAGTTCATCCTCAATAGCCCAACGGTCTCTTCTATCAAGTGGTGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAACTTTACACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCTTAAGTTTGACAAGCTTCGGATTCCTCGAGAGAATATGCTGATGAAGTACGCCAAGGTGGAGCCAGACGGCACCTATGTGAAGCCGCTGAGTGACAAACTGACCTACGGCACTATGGTGTTCATTCGTTCAATGATCGTAGGAGACTCCGCTCGCAGCCTTTCCCGGGCCTGTACCATTGCCATCCGCTATAGTGCTGTGAGGCACCAGTCAGAGATCAGAGCTGGGGAGCCGGAGCCCCAAATCCTAGACTTTCAGACTCAGCAGTACAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTATATGAGCCACACGTACCACAGAATCAGCGCTGAAATCCAAGCGGGTAACCTGAACGAACTGCCCGAGCTGCACGCCCTTTCTGCGGGCTTAAAAGCCTTCACCACGTGGGCAGCCAACACGGGTATCGAGGAGTGCCGGATGGCATGTGGGGGCATGGATACTCCCGTTGCAGTGGGATCCCCGATATCTATGTGACTTTACCCCGCCTGCACATATGAGGGGAAAACACAGTGATGATGCTGCAGACTGCAGAATTTTTGGGTGAAAAGCCTACCAAAGGCGG
  5   1   2       bld In62                            IMAGE:8954648.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAATACCATTCTAACTCAGGAGTTCATCCTCAATAGCCCAACGGTCTCTTCTATCAAGTGGTGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAACTTTACACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCTTAAGTTTGACAAGCTTCGGATTCCTCGAGAGAATATGCTGATGAAGTACGCCAAGGTGGAGCCAGACGGCACCTATGTGAAGCCGCTGAGTGACAAACTGACCTACGGCACTATGGTGTTCATTCGTTCAATGATCGTAGGAGACTCCGCTCGCAGCCTTTCCCGGGCCTGTACCATTGCCATCCGCTATAGTGCTGTGAGGCACCAGTCAGAGATCAGAGCTGGGGAGCCGGAGCCCCAAATCCTAGACTTTCAGACTCAGCAGTACAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTATATGAGCCACACGTACCACAGAATCAGCGCTGAAATCCAAGCGGGTAACCTGAACGAACTGCCCGAGCTGCACGCCCTTTCTGCGGGCTTAAAGCCTTCACACGTGGCAGCACACGGGTATCGAGGAGTGCGGATGCATGTGGGGCATGATACTCCCGTTGCATGGGATCCCGATATCTATGTGACTTTACCCGGCTGCACATATGAGGGAAACCAGTGATGATGCTGCGACTGCAGATTTTGTGAAGCTACAGCGGTCTTTCTGGG
  5   1   2       bld In54                            IMAGE:8945262.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTTGTTTAATTAAAGGAAAATTTTATTTATCTAATTCGTCCCCTATCAAGTGGTGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAACTTTACACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCTTAAGTTTGACAAGCTTCGGATTCCTCGAGAGAATATGCTGATGAAGTACGCCAAGGTGGAGCCAGACGGCACCTATGTGAAGCCGCTGAGTGACAAACTGACCTACGGCACTATGGTGTTCATTCGTTCAATGATCGTAGGAGACTCCGCTCGCAGCCTTTCCCGGGCCTGTACCATTGCCATCCGCTATAGTGCTGTGAGGCACCAGTCAGAGATCAGAGCTGGGGAGCCGGAGCCCCAAATCCTAGACTTTCAGACTCAGCAGTACAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTATATGAGCCACACGTACCACAGAATCAGCGCTGAAATCCAAGCGGGTAACCTGAACGAACTGCCCGAGCTGCACGCCCTTTCTGCGGGCTTAAAAGCCTTCACCACGTGGGCAGCCAACACGGGTATCGAGGAGTGCCCGGATGGCATGTGGGGGGCATGGATACTCCCGTTGCAGTGGATCCCGATATCTATGTGACCTTTACCCCCGCCTGCCCATAATGAGGGGAAAACACAGTGATGATGCTGCAGACTGCAGATTTTTTGTGAAAGCTACAAGCTGTTCTTTTCTGGAACGAACTTGACGGGATGGTGTCGTAACTATGAGGTTTCCTAGCACGGTAAGCCCACCTGTGTCAGCCGATCTTTGTCAAGACATCAAACGACAATTTAAAATC
  5   1   2       bld In66                            IMAGE:8963219.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGTGGGCCCGGAGGATTGGGAAAGACCTCAAACCATGCAGTAGTTTTGGCTCAATCTATTACACACAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCTTAAGTTTGACAAGCTTCGGATTCCTCGAGAGAATATGCTGATGAAGTACGCCAAGGTGGAGCCAGACGGCACCTATGTGAAGCCGCTGAGTGACAAACTGACCTACGGCACTATGGTGTTCATTCGTTCAATGATCGTAGGAGACTCCGCTCGCAGCCTTTCCCGGGCCTGTACCATTGCCATCCGCTATAGTGCTGTGAGGCACCAGTCAGAGATCAGAGCTGGGGAGCCGGAGCCCCAAATCCTAGACTTTCAGACTCAGCAGTACAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTATATGAGCCACACGTACCACAGAATCAGCGCTGAAATCCAAGCGGGTAACCTGAACGAACTGCCCGAGCTGCACGCCCTTTCTGCGGGCTTAAAAGCCTTCACCACGTGGGCAGCCAACACGGGTATCGAGGAGTGCCGGATGGCATGTGGGGGGCATGGATACTCCCGTTGCAGTGGGATCCCCGATATCTATGTGACTTTACCCCGCCTGCACATATGAGGGGAAAACACAGTGATGATGCTGCAGACTGCAGATTTTGGTGAAGCTACAAGCGTCTTTCTGGCAACGACTGACGATGTGTCGTACTTCATGATGTTTCCCAGCACGTTACGCTCACTCGTGACCGCCGATCTGTCCAAGAACTCACGACATCCAAAATCGGATCGAGGCTTATCA
  5   1   2       bld In54                            IMAGE:8946132.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCCCCCCATATAATACGATCCCGGCGACTCGAATTCGTCCCCAAGGAGAATGTAGAGGGCTTCATGCTTTCATAGTGCCCATCCGCCACATGGGTACCCACGAGCCTCTCCCTGGTGTGGTGGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCTTAAGTTTGACAAGCTTCGGATTCCTCGAGAGAATATGCTGATGAAGTACGCCAAGGTGGAGCCAGACGGCACCTATGTGAAGCCGCTGAGTGACAAACTGACCTACGGCACTATGGTGTTCATTCGTTCAATGATCGTAGGAGACTCCGCTCGCAGCCTTTCCCGGGCCTGTACCATTGCCATCCGCTATAGTGCTGTGAGGCACCAGTCAGAGATCAGAGCTGGGGAGCCGGAGCCCCAAATCCTAGACTTTCAGACTCAGCAGTACAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTATATGAGCCACACGTACCACAGAATCAGCGCTGAAATCCAAGCGGGTAACCTGAACGAACTGCCCGAGCTGCACGCCCTTTCTGCGGGCTTAAAAGCCTTCACCACGTGGGCAGCCAACACGGGTATCGAGGAGTGCCGGATGGCATGTGGGGGGCATGGATACTCCCGTTGCAGTGGGATCCCCGATATCTATGTGACCTTTACCCCCGCCTGCACATATGAGGGGAAAACACAGTGATGATGCTGCAGACTGCAAGATTTTTGGTGAAAGCTACAAAGCGGTTCTTTCTGGGAAACGACTTGACGGGATGGTGTCGTACCTCAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCCGTTGTCGCCGATCCTGGTCAGAACATTCACGACAATTTCAAAATCTGTGTCGAAAGCCTACCAAACCACTCGGAC
  5   1   2       bld In60                            IMAGE:8949596.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTAATATTTCAGGATCCTTCATATTCGAATTCGTCCCGTTGGAGACATAGGGCCCAAGTTTGGGTTTGATGAAACGGACAACGGGTTCCTTAAGTTTGACAAGCTTCGGATTCCTCGAGAGAATATGCTGATGAAGTACGCCAAGGTGGAGCCAGACGGCACCTATGTGAAGCCGCTCAGTGACAAACTGACCTACGGCACTATGGTGTTCATTCGTTCAATGATCGTAGGAGACTCCGCGCGCAGCCTTTCCCGGGCCTGTACCATTGCCATCCGCTATAGTGCTGTGAGGCACCAGTCAGAGATCAGAGCGGGGGAGCCGGAGCCCCAAATCCTAGACTTTCAGACTCAGCAGTACAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTATATGAGCCACACGTACCACAGAATCAGCGCTGAAATCCAAGCGGGTAACCTGAACGAACTGCCCGAGCTGCACGCCCTTTCTGCGGGCTTAAAAGCCTTCACCACGTGGGCAGCCAACACGGGTATCGAGGAGTGCCGGATGGCATGTGGGGGGCATGGATACTCCCGTTGCAGTGGGATCCCCGATATCTATGTGACCTTTACCCCCGCCTGCACATATGAGGGGGAAAACACAGTGATGATGCTGCAGACTGCAAGATTTTTGGTGAAAAGCTACAAAGCGGTTCTTTCTGGGAAACGACTTGACGGGATGGTGTCGTACCTTAATGATGTTTCCCAGCACCGTGTACAGCCCACCCGTGGCAGCCGATCCTTGGTCAAGACATCAACGACATTCAAAATTCTGGTCGAGGCTACAAACAGCGGAGCTGCTGCTAGTGTGCGCTGCAAGAATGTCCAACCTGACTTCAACTGGCAAGCGCAGAGATGCATGGACAGAACTCTGTGGATCTGATTACGGCTCTCCGAGGGCCACTGTCACTATGTGGT
  5   1   2       bld In66                            IMAGE:8965939.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTTTGACAAGCTTCGGATTCCTCGAGAGAATATGCTGATGAAGTACGCCAAGGTGGAGCCAGACGGCACCTATGTGAAGCCGCTCAGTGACAAACTGACCTACGGCACTATGGTGTTCATTCGTTCAATGATCGTAGGAGACTCCGCGCGCAGCCTTTCCCGGGCCTGTACCATTGCCATCCGCTATAGTGCTGTGAGGCACCAGTCAGAGATCAGAGCGGGGGAGCCGGAGCCCCAAATCCTAGACTTTCAGACTCAGCAGTACAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTATATGAGCCACACGTACCACAGAATCAGCGCTGAAATCCAAGCGGGTAACCTGAACGAACTGCCCGAGCTGCACGCCCTTTCTGCGGGCTTAAAAGCCTTCACCACGTGGGCAGCCAACACGGGTATCGAGGAGTGCCGGATGGCATGTGGGGGGCATGGATACTCCCGTTGCAGTGGGATCCCCGATATCTATGTGACCTTTACCCCCGCCTGCACATATGAGGGGGAAAACACAGTGATGATGCTGCAGACTGCAAGATTTTTGGTGAAAAGCTACAAAGCGGTTCTTTCTGGGAAACGACTTGACGGGATGGTGTCGTACCTTAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCCGTACCGGGCCGATCCTTGGTCAAAGACATCAACGACATTCAAAATCTGGTCGAGGCCTACAACAGCGAGCTGCTTGGCTAGTGTGTCGCTGCCAGAATGTCACACTGACTCAAACGTGCAGCGCAGAGATGCATGACAAGACTCTGTGAATCTAGTACGCGCATCGAAGCCACTGTCACTATGTGTCCGGACTCTCGCAGACATTGTCTGGAGGTTCCTCGGATGGTCGCTGTGCCCACTCTTCGGAT
  3  -1   2       bld Hrt1      in                         CAAQ5318.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATATGCTGATGAAGTACGCCAAGGTGGAGCCAGACGGCACCTATGTGAAGCCGCTGAGTGACAAACTGACCTACGGCACTATGGTGTTCATTCGTTCAATGATCGTAGGAGACTCCGCTCGCAGCCTTTCCCGGGCCTGTACCATTGCCATCCGCTATAGTGCTGTGAGGCACCAGTCAGAGATCAGAGCTGGGGAGCCGGAGCCCCAAATCCTAGACTTTCAGACTCAGCAGTACAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTATATGAGCCACACGTACCACAGAATCAGCGCTGAAATCCAAGCGGGTAACCTGAACGAACTGCCCGAGCTGCACGCCCTTTCTGCGGGCTTAAAAGCCTTCACCACGTGGGCAGCCAACACGGGTATCGAGGAGTGCCGGATGGCATGTGGGGGGCATGGATACTCCCGTTGCAGTGGGATCCCCGATATCTATGTGACCTTTACCCCCGCCTGCACATATGAGGGGGAAAACACAGTGATGATGCTGCAGACTGCAAGATTTTTGGTGAAAAGCTACAAAGCGGTTCTTTCTGGGAAACGACTTGACGGGATGGTGTCGTACCTTAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCCGTGGCCGGCCGATCCTTGGTCAAAGACATCAACGACATTCAAAATCTGGTCGAGGCCTACAAACAGCGAGCTGCTTGGCTAGTGGTGGCCGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAAACAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTT
  5   1   2       bld Eye       in                         CCAX9404.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACAAACTGACCTACGGCACTATGGTGTTCATTCGTTCAATGATCGTAGGAGACTCCGCGCGCAGCCTTTCCCGGGCCTGTACCATTGCCATCCGCTATAGTGCTGTGAGGCACCAGTCAGAGATCAGAGCGGGGGAGCCGGAGCCCCAAATCCTAGACTTTCAGACTCAGCAGTACAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTATATGAGCCACACGTACCACAGAATCAGCGCTGAAATCCAAGCGGGTAACCTGAACGAACTGCCCGAGCTGCACGCCCTTTCTGCGGGCTTAAAAGCCTTCACCACGTGGGCAGCCAACACGGGTATCGAGGAGTGCCGGATGGCATGTGGGGGGCATGGATACTCCCGTTGCAGTGGGATCCCCGATATCTATGTGACCTTTACCCCCGCCTGCACATATGAGGGGGAAAACACAGTGATGATGCTGCAGACTGCAAGATTTTTGGTGAAAAGCTACAAAGCGGTTCTTTCTGGGAAACGACTTGACGGGATGGTGTCGTACCTTAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCCGTGGCCGGCCGATCCTTGGTCAAAGACATCAACGACATTCAAAATCTGGTCGAGGCCTACAAACAGC
  5   1   2       bld In60                            IMAGE:8950638.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGGGATAATTGCATGATCTCACATGATTCAGAATTCGTCCCATCCGCTATAGTGCTGTGAGGCACCAGTCAGAGATCAGAGCTGGGGAGCCGGAGCCCCAAATCCTAGACTTTCAGACTCAGCAGTACAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTATATGAGCCACACGTACCACAGAATCAGCGCTGAAATCCAAGCGGGTAACCTGAACGAACTGCCCGAGCTGCACGCCCTTTCTGCGGGCTTAAAAGCCTTCACCACGTGGGCAGCCAACACGGGTATCGAGGAGTGCCGGATGGCATGTGGGGGGCATGGATACTCCCGTTGCAGTGGGATCCCCGATATCTATGTGACCTTTACCCCCGCCTGCACATATGAGGGGGAAAACACAGTGATGATGCTGCAGACTGCAAGATTTTTGGTGAAAAGCTACAAAGCGGTTCTTTCTGGGAAACGACTTGACGGGATGGTGTCGTACCTTAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCCGTGGCCGGCCGATCCTTGGTCAAAGACATCAACGACATTCAAAATCTGGTCGAGGCCTACAAACAGCGAGCTGCTTGGCTAGTGGTGGCCGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTCTACGCGCTGCATGGGATCAGCAGAACACTGAGACTTCCTTCAGCTGGACTCTGACCACTCTCCAGGTGAACTTAGTACAGCAGCGATGAAGGAATCTGCTGGCAGTATCCGGTCCAATTGCAGTGCTTTGGGTTGCAATGC
  5   1   2       bld In54                            IMAGE:8943152.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCCCTGATATAGACGATCACCCCGCTTCGAATTCGTCCCGGGAGCCGGAGCCCCAAATCCTAGACTTTCAGACTCAGCAGTACAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTATATGAGCCACACGTACCACAGAATCAGCGCTGAAATCCAAGCGGGTAACCTGAACGAACTGCCCGAGCTGCACGCCCTTTCTGCGGGCTTAAAAGCCTTCACCACGTGGGCAGCCAACACGGGTATCGAGGAGTGCCGGATGGCATGTGGGGGGCATGGATACTCCCGTTGCAGTGGGATCCCCGATATCTATGTGACCTTTACCCCCGCCTGCACATATGAGGGGGAAAACACAGTGATGATGCTGCAGACTGCAAGATTTTTGGTGAAAAGCTACAAAGCGGTTCTTTCTGGGAAACGACTTGACGGGATGGTGTCGTACCTTAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCCGTGGCCGGCCGATCCTTGGTCAAAGACATCAACGACATTCAAAATCTGGTCGAGGCCTACAAACAGCGAGCTGCTTGGCTAGTGGTGGCCGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTTCTTCACGCGCTGCATGGGATCAGCCAGACACTGGAGAACTTCCTTCAGCTGGACTTCTGACCACTCTCCAGTGACTAGTACAGCAGCGATGAAGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCCTTTGGTGGAAGC
  5   1   2       bld In60                            IMAGE:8949044.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATCATTGTTTGCATGAAATAGAATCATCCACTATTTCGTCCCTAGACTTTCAGACTCAGCAGTACAAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTATATGAGCCACACGTACCACAGAATCAGCGCTGAAATCCAAGCGGGTAACCTGAACGAACTGCCCGAGCTGCACGCCCTTTCTGCGGGCTTAAAAGCCTTCACCACGTGGGCAGCCAACACGGGTATCGAGGAGTGCCGGATGGCATGTGGGGGGCATGGATACTCCCGTTGCAGTGGGATCCCCGATATCTATGTGACCTTTACCCCCGCCTGCACATATGAGGGGGAAAACACAGTGATGATGCTGCAGACTGCAAGATTTTTGGTGAAAAGCTACAAAGCGGTTCTTTCTGGGAAACGACTTGACGGGATGGTGTCGTACCTCTTGATGTTTCCCAGCACCGTGTATAGCCCCACCCCGTGGCCGGCCGATCCTTGGTAAAGACTTCAACGACTTTCAAAATCTG
  5   1   2       bld In54                            IMAGE:8946443.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACCAGTCAGAGATCAGAGCTGGGGAGCCGGAGCCCCAAATCCTAGACTTTCAGACTCAGCAGTACAAGTTATTCCCGCTGCTGGCTACAGCATACGCCTTCCAGTTTGTGGGATCCTATATGAGCCACACGTACCACAGAATCAGCGCTGAAATCCAAGCGGGTAACCTGAACGAACTGCCCGAGCTGCACGCCCTTTCTGCGGGCTTAAAAGCCTTCACCACGTGGGCAGCCAACACGGGTATCGAGGAGTGCCGGATGGCATGTGGGGGGCATGGATACTCCCGTTGCAGTGGGATCCCCGATATCTATGTGACCTTTACCCCCGCCTGCACATATGAGGGGGAAAACACAGTGATGATGCTGCAGACTGCAAGATTTTTGGTGAAAAGCTACAAAGCGGTTCTTTCTGGGAAACGACTTGACGGGATGGTGTCGTACCTTAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCCGTGGCCGGCCGATCCTTGGTCAAAGACATCAACGACATTCAAAATCTGGTCGAGGCCTACAAACAGCGAGCTGCTTGGCTAGTGGTGGCCGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCTCTTCTACGCGCTGCATGGGATCAGCAGGAAAACTGGAAACTTCCTCAGCTGACTTCTTACCCCTCCTCCAGGTTGACCTAGTACAGCAGCGAAGTGAAGAAATCTTGCTGGCAAGTTATATCGGTTTC
  5   1   2       bld In66                            IMAGE:8966955.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTTTTTAAAATATGAAAGATATTCCTAAATAAATAAATTCGTCCCCGGGCTTAAAAGCCTTCACCACGTGGGCAGCCAACACGGGTATCGAGGAGTGCCGGATGGCATGTGGGGGGCATGGATACTCCCGTTGCAGTGGGATCCCCGATATCTATGTGACCTTTACCCCCGCCTGCACATATGAGGGGGAAAACACAGTGATGATGCTGCAGACTGCAAGATTTTTGGTGAAAAGCTACAAAGCGGTTCTTTCTGGGAAACGACTTGACGGGATGGTGTCGTACCTTAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCCGTGGCCGGCCGATCCTTGGTCAAAGACATCAACGACATTCAAAATCTGGTCGAGGCCTACAAACAGCGAGCTGCTTGGCTAGTGGTGGCCGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGATCTAGTACAGCAGCGAGTGAAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTCTGGGCAGAATATGACGCAACGTCTATGAAAATATGTTCGAATGGGCAAGAATCCCCGCTGAACAAACACAGTGCACGATCTCCACAGTATTTAAAACCACTACAGTCAACTGGTGAATCCGCCCATCAGTC
  5   1   2       bld In66                            IMAGE:8962481.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCCTTTTTTTTGCGGGCTTAAAAGCCTTCACCACGTGGGCAGCCAACACGGGTATCGAGGAGTGCCGGATGGCATGTGGGGGGCATGGATACTCCCGTTGCAGTGGGATCCCCGATATCTATGTGACCTTTACCCCCGCCTGCACATATGAGGGGGAAAACACAGTGATGATGCTGCAGACTGCAAGATTTTTGGTGAAAAGCTACAAAGCGGTTCTTTCTGGGAAACGACTTGACGGGATGGTGTCGTACCTCAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCCGTGGCCGGCCGATCCTTGGTCAAAGACATCAACGACATTCAAAATCTGGTCGAGGCCTACAAACAGCGAGCTGCTTGGCTAGTGGTGGCTGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTCGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGCTGGACTTCTGACCACTCTCCAGGTTGATCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTTATCCGTCCCAATGCAGTGGCTTTGGTGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGCACGTCTATGAGATATGTTCGATGGACAAGATCCTCGCTGAACAAAACACAGGTGCACGATCTCCACAGTATTAAACACTACAGTCAACTGTGATCCGCCCATCAGTCTGCTTGACCTCAAATGTGGTGAA
  5   1   2       bld Sto1      in                         CABG9359.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGATGGCATGTGGGGGGCATGGATACTCCCGTTGCAGTGGGATCCCCGATATCTATGTGACCTTTACCCCCGCCTGCACATATGAGGGGGAAAACACAGTGATGATGCTGCAGACTGCAAGATTTTTGGTGAAAAGCTACAAAGCGGTTCTTTCTGGGAAACGACTTGACGGGATGGTGTCGTACCTTAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCCGTGGCCGGCCGATCCTTGGTCAAAGACATCAACGACATTCAAAATCTGGTCGAGGCCTACAAACAGCGAGCTGCTTGGCTAGTGGTGGCCGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGATCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCTCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAACCACTACAGTCCCAACTGTGATCCGCCCATCAGTCCTGCTG
  5   1   2       bld Liv1      in                        CAAR13024.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCGATTCGCCGATATCTATGTGACCTTTACCCCCGCCTGCACATATGAGGGGGAAAACACAGTGATGATGCTGCAGACTGCAAGATTTTTGGTGAAAAGCTACAAAGCGGTTCTTTCTGGGAAACGACTTGACGGGATGGTGTCGTACCTTAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCCGTGGCCGGCCGATCCTTGGTCAAAGACATCAACGACATTCAAAATCTGGTCGAGGCCTACAAACAGCGAGCTGCTTGGCTAGTGGTGGCCGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGACCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCTCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTT
  5   1   2       bld TpA       in                  TTpA047a18.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGGGGCCGGGGGCACATATGAGGGGGAAATCCAGTGATGATGCTGCAGACTGCAAGATTTTTGGTGAAAAGCTACAAAGCGGTTCTTTCTGGGAAACGACTTGACGGGATGGTGTCGTACCTTAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCCGTGGCCGGCCGATCCTTGGTCAAAGACATCAACGACATTCAAAATCTGGTCGAGGCCTACAAACAGCGAGCTGCTTGGCTAGTGGTGGCCGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGACCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCTCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTTGTGTCCCTATTGCTGTCAAATTCTGTC
  5   1   2       bld TpA       in                  TTpA047b01.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGGGGGCACATATGAGGGGGAAAACACAGTGATGATGCTGCAGACTGCAAGATTTTTGGTGAAAAGCTACAAAGCGGTTCTTTCTGGGAAACGACTTGACGGGATGGTGTCGTACCTTAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCCGTGGCCGGCCGATCCTTGGTCAAAGACATCAACGACATTCAAAATCTGGTCGAGGCCTACAAACAGCGAGCTGCTTGGCTAGTGGTGGCCGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGACCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCTCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCATACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCCTATTGCTGTCAAATTCTGTCTATTAA
  3  -1   2       bld Liv1                                 CAAR3172.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAGCGGTTCTTTCTGGGAAACGACTTGACGGGATGGTGTCGTACCTTAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCCGTGGCCGGCCGATCCTTGGTCAAAGACATCAACGACATTCAAAATCTGGTCGAGGCCTACAAACAGCGAGCTGCTTGGCTAGTGGTGGCCGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGACCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCTCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAG
  5   1   2       bld Tad5                                 XZT32060.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCGGTTCTTTCTGGGAAACGACTTGACGGGATGGTGTCGTACCTTAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCCGTGGCCGGCCGATCCTTGGTCAAAGACATCAACGACATTCAAAATCTGGTCGAGGCCTACAAACAGCGAGCTGCTTGGCTAGTGGTGGCCGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGACCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCTCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTT
  5   1   2       bld In54                            IMAGE:8946026.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACGGGATGGTGTCGTACCTTAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCCGTGGCCGGCCGATCCTTGGTCAAAGACATCAACGACATTCAAAATCTGGTCGAGGCCTACAAACAGCGAGCTGCTTGGCTAGTGGTGGCCGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGATCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCCCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCGAATGTGGAAACAAAGCAATTCCCTTTCCTTAAATAACCTCCCATCTAAGTGATGAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTACATGGGGCCAAAGCTATAAGCAGAGCATGGCACTTCCAATTGACTTCTTTGGGCGCTGCCTGGTGGCTGCTCTAGGTTACAG
  5   1   2       bld In54                            IMAGE:8944710.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGTGTCGTACCTTAATGATGTTTCCCAGCACCGTGTACAGCCCCACCCCGTGGCCGGCCGATCCTTGGTCAAAGACATCAACGACATTCAAAATCTGGTCGAGGCCTACAAACAGCGAGCTGCTTGGCTAGTGGTGGCCGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGATCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCCCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGACCCGAATGTGGAAACAAAGCAATTCCCTTTCCTTAATACCTCCCATCTAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTACATGGGGCCAAAGCTATAGCAGAGCATGGCACTTCATTGACTCTTTGGCGCTGCCTGTGCTGCTCTAGTAAGCACGACTAGAAGCTAGCCTAGCCCTCAGCCTTTAAAAAAGCATTGTTGTAGCGGTATACCACCTCCAGTACTTTAAATATAAACATGTTTCAGTATGGAGGTTGACCTCAAGTCCTGTCGTCAGTCTGACTGACAGCTACGAAGGAGCGTGTGGAAACTACATTTAACTCGTCTTTGGTGCGGG
  5   1   2       bld In63                            IMAGE:8957415.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTACAAATTATTTTTATTAATAAAATAAAATAAAAAATTTCCCGTGGCGGCGATCCTTGGTCAAAGACATCAACGACATTCAAAATCTGGTCGAGGCCTACAAACAGCGAGCTGCTTGGCTAGTGGTGGCCGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGATCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCCCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCGAATGTGGAAACAAAGCAATTCCCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAATTCTGTCTATTAACATGGGGCCAAAGCTATAAGCAGAGCAATGGCACTTTCCAATTGACTCTTTGGCGCTGCCTGTGCTGCTCTAGGTACAGCACCGACCCTTAAGAAAGCTAGGCCTAAGCA
  5   1   2       bld In66                            IMAGE:8962679.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TACCCACCCCGTGGCCGGCCGATCCTTGGTCAAAGACATCAACGACATTCAAAATCTGGTCGAGGCCTACAAACAGCGAGCTGCTTGGCTAGTGGTGGCTGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTCGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAAGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGATCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAAAATATGTTCGAATGGGCAAAGAAATCCCCGCTGAACAAAACACAGGTGCACGAATTCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATCTCTTTTCTTAAATAACTCCCATCTAAGTGATGAAATGTGTTCCTAATGCTGTCAAATCTGTCTATTAACATGGGCAAGCTATAGCAGAGCATGGACTTCAAATGACTCTTTGCGCTGCCTGTGGCTGCTCTAGTACAGCACCGAACTTAAGAAAAGCTT
  5   1   2       bld AbdN                               IMAGE:7006666                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAAAATCTGGTCTAGGCCAACAAACAGCGAGCTGCTTGGCTAGTGGTGGCCGCTGCCAAGAATGGCTCACTCCCTCAAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCATGTTGACCTACCCACACCCGCGAGTGAAGGATCTGCTGGCAGTTATCCGGCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCTCCGCTGAACAAAACACAGGTGCACGAATCCTTCCCCAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAAGGGGGAAAACAAAGCAACTTACCTTTCCCTTAAAAAAACCCGCCCACCCCAAAATGGATAGAATACTGGGGGTTCCCAAAATTGGCCGGGGCAAAAATTCCCGGTCCTAATTAAAAACAAGGGGGGGCCCAAAAAGCTGGTTAAGGCCAGAAGACCAATGGGGCACCTTTCCAAAATTGAACCTCCTATTGGGGGGGCCGGCCCCTGAGGGGCATGGCACCCTAGGGGTAAAGGCAACCCCAACCTTGAAAAAAAGACCAAAAGGGCCAAAAAGACAAAACAAGCCGTTGTAAGAAAAAAAAAGGCCAATGGGATTTGGTAAAAGGGGGGGTTAAAATAAAACCCAACCCCCCCCAAGTTAAACCCTCCTTCAATAATCGATAGGGCGCCAGGGGAAGTCCCCGGAAAGCCATTAAAGG
  5   1   2       bld TpA                            TTpA037d06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACCTACAAACAGTCGAGTCTGCTTTGGTCTAGTTGGTGGCCGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGACCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCTCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTTCACAGTTTCCTGTC
  5   1   2       bld Tad5      in                         XZT37595.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGTCTGTACTCCAGGCTAGTGGTGGCCGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGACCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCTCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTC
  5   1   2       bld In66                            IMAGE:8963862.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGGCCGCTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGATCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCCCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCGAATGTGGAAACAAAGCAATTCCCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACATGGGGCCAAAGCTATAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACGACCTTAAGAAAGCTAAGCTAGCACTCAGCTTTAGAAAAAACAGCATGTTTGTATAGCGTAATAACACTCAGTACTTTTAGAATAATAGACATGATATTCTAAGTTATGAGCTAGAATCTTCACAGGTTCTGTCTGTGCAGTCACTGACTAGCACAGCATACCGAGATGAGGAGGCTGCTAGAAGTACATACCAGTATCATCGTGTGTCAGAGTCTTAACCATTAGGAATTTCG
  5   1   2       bld In66                            IMAGE:8963628.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCTTTGCCAAGAATGTCAACACTGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGACCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCTCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAGGCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTGTATAGCGTAATAACACTCAGTACTCTAGAATAATAGACAATGATATTCTAAGGTATGAGATCTAGACTCTCACAGTTTCTGTCTGCTGCAGGTTCACTGACTTAGCACAG
  5   1   2       bld Eye       in                         CCAX6326.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGACTCCAAACGTGGCAAGCGCAAGGAAGATGCATGGAACAAGAACTCTGTCGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGATCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCTCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCA
  5   1   2       bld AbdN                               IMAGE:7025181                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAGAACTCTGTGGATCTAGTACGCGCATCAGAGGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGATCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATNGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCTCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTTAGAAAAAAAGCATTGGTTGTATAGCGGGTTAATAAACCAACCCTCCAGTTAACCTCTTTAGAATAATTAGACAATGATTATTCCTAAAAGTTTAGGGGAGGGGTCTAAAAACTCTTTCAACAGTTTTCCTGGTCTGGGTTGCCCCAGGGTCACTGGACCTTTAAGCA
  5   1   2       bld Tad5                                 XZT27950.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGATCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCCCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCGAATGTGGAAACAAAGCAATTCCCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACATGGGGCCAAAGCTATAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTTAAGAAAGCTAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTTTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAG
  5   1   2       bld Tbd1      in                         CBXT5804.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGCACTGTCACTATGTGGTCGTGAAACTCTTCGCAGACAAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGACCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCTCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAAGGGAAAGATA
  5   1   2       bld Tad5                                 XZT20889.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAATTGTCTGAGGTTCTCGATGTCGCTGCCCATCGTATTCTGAGCTCTCTCTGCCTCTTCTACGCGCTGCATGGGATCAGCAAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGATCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCCCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCGAATGTGGAAACAAAGCAATTCCCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACATGGGGCCAAAGCTATAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTTAAGAAAGCTAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTTTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGA
  5   1   2       bld Tad5      in                         XZT36461.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGAACACTGGAGACTTCCTTCAGGCTGGACTTCTGACCACTCTCCAGGTTGATCTAGTACAGCAGCGAGTGAAGGATCTGCTGGCAGTTATCCGTCCCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCCCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCGAATGTGGAAACAAAGCAATTCCCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACATGGGGCCAAAGCTATAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTTAAGAAAGCTAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTTTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGNGAACGTCCTTAAAAACACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCA
  5   1   2       bld Tad5      in                         XZT32194.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAATGCAGTGGCTTTGGTGGATGCCTTCGACTACTCCGACACACAACTGGGCTCAGTTCTGGGCAGATATGACGGCAACGTCTATGAGAATATGTTCGAATGGGCAAAGAAATCTCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGNGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGANACAATACAGATCTGCTTTTGACCACATGGCNCAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCA
  3   1   2       bld Brn3 5g3  in                         CAAK1510.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATATGTTCGATGGGCAAAGAAATCCCCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCGAATGTGGAAACAAAGCAATTCCCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACATGGGGCCAAAGCTATAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTTAAGAAAGCTAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTTTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCTTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTT
  5   1   2       bld Neu       in                   TNeu126g16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATGGGCAAAGAAATCTCCGCTGAACAAACACAGGTGCGGCGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATGGTGTGTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAAAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCT
  5  -1   2       bld Hrt1      in                         CAAQ5318.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGCTGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTT
  3   1   2       bld Sto1      in                         CABG9359.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTGACAAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCNCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTTAAAAAAA
  3   1   2       bld Liv1      in                        CAAR13024.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAACAAAACACAGGTGCACGAATCTTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTT
  3   1   2       bld Fat1      in                         CABC5872.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCNCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTTAAA
  3   1   2      seed Liv1      in                         CAAR7699.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACAAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTT
  3   1   2       bld Tad5      in                         XZT32194.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAACAAAACACAGGTGCACGAATCCTTCCACAAGTATTTAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTT
  3   1   2       bld Neu       in                    TNeu126g16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGGTGCACGAATCCTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATGTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTGTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCTGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTGTAAGACAAATGTGCTTTTTGGGTTTCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTTAGTTTTGCTTCGGAAAGAAACCAAATAGAAGAGCATGTGAAAGACCAACTGAAACAATACAGATCTGATTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAAGGCACTGGGCAGTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCTCCCTCGGTATAAAGAGTAGGAAAGGTAATTAATTTGTTAATTTTTAGTGTAAGGATGTTAATAAAGTTTTGTCTTCTAAAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                         CBXT5804.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGTGCACGAATCCTTTCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTTAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT37595.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCACAAGTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCNCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Brn3 5g3  in                         CAAK1925.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGTTTTAAAACCACTACAGTCCAAACTGTGATCCGCCATTCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATCTCTTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACATGGGGCCAAAGCTATAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTTAAGAAAGCTAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTTTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACCTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCGGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTT
  3   1   2       bld TbA       in                    TTbA028n08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTATTTAAAACCACTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTAAAAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Te4  5g3  in                         CAAN9895.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTACAGTCCAAACTGTGATCCGCCCATCAGTCCTGCTGAACCCCAATGTGGAAACAAAGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGACAAGATGATAATAAAGTTCTGTCCTTTCTT
  3   1   2       bld Spl2 5g3  in                        CBSS6883.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAACCCGAATGTGGAAACAAAGCAATTCCCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACATGGGGCCAAAGCTATAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTTAAGAAAGCTAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTTTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCTTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTTACTCTG
  3   1   2       bld Tad5      in                         XZT36461.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATGTGGAAACAAAGCAATTCCCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACATGGGGCCAAAGCTATAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTTAAGAAAGCTAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTTTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCTTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Tad5      in                          XZT9180.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACCAAAGGAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGTTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTT
  3   1   2       bld Neu0      in                       IMAGE:6992749                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCCTTTAATTTTTAGTAAA
  5   1   2       bld Neu0      in                       IMAGE:6992749                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATTCTCTTTCCTTAAATAACCTCCCATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTTAANNAAAAAANAANNAN
  3   1   2       bld Te4       in                        CAAN12287.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCTAAGTGATGAAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACATGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGCTCTGTCCTTTCTTACTCTG
  3   1   2       bld Tad5      in                         XZT36413.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATTGTGTTCCTAATTGCTGTCAAATTCTGTCTATTAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAACCAATACCCAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCCCATGGCCAAGGAAGGGAATATTTGACCAATGCCCTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCCCCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTT
  3   1   2       bld TpA       in                   TTpA047a18.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTGCTGTCAAATTCTGTCTATAACAAGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTTACTCTGCAAAAAAAAAAAAAAAAA
  3   1   2       bld Eye       in                         CCAX6326.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGGGCCAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTTA
  3   1   2       bld TpA       in                   TTpA047b01.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAAGCTGTAAGCAGAGCAATGGCACTTCCAATTGACTCTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAAGATGATAATAAAGTTCTGTCCTTTCTTACTC
  3   1   2       bld Eye       in                         CCAX9404.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTCTTTTGGCGCTGCCTGTGGCTGCTCTAGGTACAGCACCGACCTGAAGAAAGCAAAGGCCTAAGCACTCAGCCTTTAGAAAAACAGCATTGTTTGTATAGCGGTTAATAAACCAACCTCCAGTTAACCTCTTAGAATAATAGACAATGATATTCTAAAGTTTAGTGGAGGGTCTAGAACTCTTCAACAGTTTCCTGTCTGGTTGCCAGGGTCACTGACTTTAGCAACCAGCCATTACCAGAAGAAAGAGGGAGGCGTGCTGAAGGGAAAGATAAACAATACACAATTATAATACAAATCTGCTTTTTGGGTTGCCAGGGGAACGTCCCTAAAAACAACATAGGATTTTCAGTTTTGCTTCAGAAAGAAACCAAATAGAAGAGCATGTAAAAGACCAACTGAAACAATACAGATCTGCTTTTGACCACATGGCCAAGGAAGGGAATATTTGACCAATGCACTGGGCAGTGTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTTA
  3   1   2       bld Eye  5g3  in                         CCAX1305.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATATTTGACCAATGCACTGGGCAGTGTTTTACTGTAATGTTTCACTGTTGCCTTCTGATGGGGCGGCTGAGACGGTCTCACCATCGGGATAAAGAGTATGAAATGTAATTAATCTGTTAATTTTTATGTAAAGATGATAATAAAGTTCTGTCCTTTCTTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)