Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xt7.1-TGas124g20.3                         11 END     1           1       11                Cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012074424 Xt7.1-TTpA008n06.5.5 - 74 ESTs
                                                                       ....-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TTpA008n06.5.5                                                                                                         GCCCTCTTGTAGCGGATATTCGCTCACAGTATCTTCCTGCTCATCTATTAAATTAGCCAATCACTGTATCTCCAGGCGATTAGTGCCCGCCCCCCTGGATAAGATCTACTAAAAACAGAAAGCGGCAGGGACCAAACAGCATGAAAGGGCAAAACGTACGATTAATGGGGTAGCGATGAGCTGCTCAGGCCTGTGACGGGAGGTCAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTTCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTATATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTACGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTCAGTGACTCCGGGTCTCGCACACTGAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGGAGAACGCCGACCGGGTGGCGAATAGGGGGCGCATCATCTGCATCACCAATGCCAAAAGTGACAGCCACGTCCAGATGCTGGAGGACTGCGTCAATGAGACGATCCACGAACATAACAAACTGGCCGCCGGGTCGGATCATCTCATGCAGATACAGAAATGCCATCTGGTGCTGATCCACACTTACCCGGTGGGAGAAGACAGCCTGGTATCCGATCGTCCCAAGAAGGAGCTCTCCAACGTGTTGATCAGCGAGGTGCACAGCGTCAAGGCCGGCCGCCATCTTTCCACCAAACTCAACCAGTTGGTCCAGCTGCACTTCGACCTGGCTTCCACCACCATTACCAACATTCCCATGAAGGAAGAGCAACATGCAAACACGTCCGCAAACTACGATGTGGAGCTTCTGCACCACAAAGAGGCGCATGTCGAGTTCAACAAAAGTGCAGGGGAAGGCTACAACGGCAGCAGCAGCAGAGAGAACTGCCTGAAGGAGACGGTGACGCTGAAGTGGTGCACCCCCAGGACCAACAGTGTGGAGCTGCACTATTGCACGGGAGCGTTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGGATCTATTGGGGGTTCTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGCGATTCCCTTGCACCCCCCCCCCCCCAAACCCGGGAGTTTGTTCCGTGTCTGGAGATTAAAGGCGATTCTTTCCTATTGGTTCCGTGTCTGGAGATTAAAGGCAATTCTTTCC
                                                  Xt7.1-CHK-1008224198                                                                                                               TTGTAGCGGATATTCGCTCACAGTATCTTCCTGCTCATCTATTAAATTAGCCAATCACTGTATCTCCAGGCGATTAGTGCCCGCCCCCCTGGATAAGATCTACTAAAAACAGAAAGCGGCAGGGACCAAACAGCATGAAAGGGCAAAACGTACGATTAATGGGGTAGCGATGAGCTGCTCAGGCCTGTGACGGGAGGTCAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTTCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTATATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTACGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTCAGTGACTCCGGGTCTCGCACACTGAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGGAGAACGCCGACCGGGTGGCGAATAGGGGGCGCATCATCTGCATCACCAATGCCAAAAGTGACAGCCACGTCCAGATGCTGGAGGACTGCGTCAATGAGACGATCCACGAACATAACAAACTGGCCGCCGGGTCGGATCATCTCATGCAGATACAGAAATGCCATCTGGTGCTGATCCACACTTACCCGGTGGGAGAAGACAGCCTGGTATCCGATCGTCCCAAGAAGGAGCTCTCCAACGTGTTGATCAGCGAGGTGCACAGCGTCAAGGCCGGCCGCCATCTTTCCACCAAACTCAACCAGTTGGTCCAGCTGCACTTCGACCTGGCTTCCACCACCATTACCAACATTCCCATGAAGGAAGAGCAACATGCAAACACGTCCGCAAACTACGATGTGGAGCTTCTGCACCACAAAGAGGCGCATGTCGAGTTCAACAAAAGTGCAGGGGAAGGCTACAACGGCAGCAGCAGCAGAGAGAACTGCCTGAAGGAGACGGTGACGCTGAAGTGGTGCACCCCCAGGACCAACAGTGTGGAGCTGCACTATTGCACGGGAGCGTTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGGATCTATTGGGGGTTCTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGCGATTCCCTTGCACCCCCCCCCCCCCAAACCCGGGAGTTTGTTCCGTGTCTGGAGATTAAAGGCGATTCTTxxxxxTTGGTTCCGTGTCTGGAGATTAAAGGCAATT
                                                      consensus depths                                                                                                              2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     9    11     9    11     9    12    10    13    12    14    15    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    17    17    16    16    16    16    16    16    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    15    15    15    15    15    15    16    15    16    13    14    13    14    12    13    12    13    11    12    11    12    11    11    11    11    11    11    11    11    11    11    10    10     9     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     7     7     4     4     4     4     4     4     4     4     5     6     5     6     5     6     6     7     7     7     7     7     7     7     7     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     8     9     8     9     7     8     7     8     9    10     9    11     9    11    10    12    10    12    10    12    10    12    10    12    10    12    11    13    11    13    12    14    12    15    12    16    13    16    14    16    14    16    14    16    15    17    14    16    14    16    14    16    14    16    14    16    14    16    14    16    14    16    14    16    15    17    16    18    18    20    18    20    18    19    18    19    19    20    19    20    19    20    19    20    19    20    17    19    18    20    18    20    16    19    17    19    17    20    18    20    19    22    17    20    17    19    17    18    18    19    19    20    19    20    19    20    19    20    20    21    20    21    20    21    23    24    24    25    24    25    23    24    22    23    22    24    22    26    23    26    24    27    23    26    23    26    23    26    23    26    25    27    25    27    24    26    26    28    26    29    25    29    26    29    26    29    25    29    24    29    24    29    24    29    25    29    24    29    23    29    24    29    22    27    21    27    24    29    24    29    24    29    24    30    23    29    22    30    23    30    23    29    23    30    24    30    23    29    21    30    15    29    14    29    18    29    16    28    13    25    15    26    18    25    14    25    14    25    15    25    14    25    14    25    11    23    10    23     8    23     7    22     6    16     2     8     2     4     2     2
  5   1   2  SIG                                    Xt7.1-TTpA008n06.5                                                                                               ACAGCGCAAAGCCCTCTTGTAGCGGATATTCGCTCACAGTATCTTCCTGCTCATCTATTAAATTAGCCAATCACTGTATCTCCAGGCGATTAGTGCCCGCCCCCCTGGATAAGATCTACTAAAAACAGAAAGCGGCAGGGACCAAACAGCATGAAAGGGCAAAACGTACGATTAATGGGGTAGCGATGAGCTGCTCAGGCCTGTGACGGGAGGTCAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTTCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTATATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTACGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTCAGTGACTCCGGGTCTCGCACACTGAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGGAGAACGCCGACCGGGTGGCGAATAGGGGGCGCATCATCTGCATCACCAATGCCAAAAGTGACAGCCACGTCCAGATGCTGGAGGACTGCGTCAATGAGACGATCCACGAACATAACAAACTGGCCGCCGGGTCGGATCATCTCATGCAGATACAGAAATGCCATCTGGTGCTGATCCACACTTACCCGGTGGGAGAAGACAGCCTGGTATCCGATCGTCCCAAGAAGGAGCTCTCCAACGTGTTGATCAGCGAGGTGCACAGCGTCAAGGCCGGCCGCCATCTTTCCACCAAACTCAACCAGTTGGTCCAGCTGCACTTCGACCTGGCTTCCACCACCATTACCAACATTCCCATGAAGGAAGAGCAACATGCAAACACGTCCGCAAACTACGATGTGGAGCTTCTGCACCACAAAGAGGCGCATGTCGAGTTCAACAAAAGTGCAGGGGAAGGCTACAACGGCAGCAGCAGCAGAGAGAACTGCCTGAAGGAGACGGTGACGCTGAAGTGGTGCACCCCCAGGACCAACAGTGTGGAGCTGCACTATTGCACGGGAGCGTTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGGATCTATTGGGGGTTCTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGCGATTCCCTTGCACCCCCCCCCCCCCAAACCCGGGAGTTTGTTCCGTGTCTGGAGATTAAAGGCGATTTCTTTCCTATCAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CBSW8279.5                                                                                                                                                                                                                                                       GAAAGGGCAAAACGTACGATTAATGGGGTAGCGATGAGCTGCTCAGGCCTGTGACGGGAGGTCAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTTCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTACATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTACGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTGAGTGACTCCGGGTCTCGCACACTAAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGGAGAACGCCGACCGGGTGGCGAATAGGGGGCGCATCATCTGCATCACCAATGCCAAAAGTGACAGCCATGTCCAGATGCTGGAGGACTGTGTCAATGAGACGATCCACGAACATAACAAACTGGCCGCCGGGTCGGATCATCTCATGCAGATACAGAAATGCCATCTGGTGCTGATCCACACTTACCCGGTGGGAGAAGACAGCCTGGTATCCGATCGTCCCAAGAAGGAGCTCTCCAACGTGTTGATCAGCGAGGTGCACAGCGTCAAGGCCGGCCGCCATCTTTCCACCAAACTCAACCAGTTGGTCCAGCTGCACTTCGACCTGGCTTCCACCACCATTACCAACATTCCCATGAAGGAAGAGCAACATGCAAACACGTCCGCAAACTACGATGTGGAGCTTCTGCACCACAAAGAGGCGCATGTCGAGTTCAACAAAAGTGGGGAAGGCTACAACGGCAGCAGCAGCAGAGAGAACTGCCTGAAGGAGACGGTGACGCTGAAGTGGTGCACCCCCAGGACCAACAGTGTGGAGCTGCACTATTGCACGGGAGCGTTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCTTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTCGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGACATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCC------------------------CCGTAAGGGAAAGTTGAAAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCATGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATTTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGTTGCGGAGGGATCCATTGGGAGATCCATTGGGGGATCCATTGGGGGATCCATTGGGGGTTCCGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAAATTTTTTTAGAACTTTTTTCCGACCCACGAGAATGAATTTTTAGTACCGGGATTCCCTTGCACCCCCCCCCCCCAAACCCGCGTGCCCGGGAGTTGGTTCCGTGTCTGGAGATTAAAGGCAATTCTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCCCCCGAGCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCCCACATCATGGTTGAGGATACGGGTCCTGCAGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCCATGTCCTTGTTGTCTTTATG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAGGCTGAGTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGAGGGATCCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAGTTTGTTCCGTGTCTGGAGATTAAAGGCGATTC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------AT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------G----
                                               BLH ATG     322    1782                                                                                                         
                                               BLH MIN     313     251                                                                                                         
                                               BLH OVR     322      30                                                                                                         
                                               EST CLI     149      19                                                                                                         
                                               ORF LNG     322       7                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---= 3e-033     NP_499881.1 maternal transcript 89Bb like (89.7 kD) (4A986) [Caenorhabditis elegans] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dm ==== 8e-116     NP_524379.2 Maternal transcript 89Bb CG6814-PA [Drosophila melanogaster] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Sp ==== 2e-178     XP_791410.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Dr ==== 0          XP_702157.1 PREDICTED: hypothetical protein XP_697065 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Mm ==== 0          NP_620096.1 hypothetical protein MGC28965 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Hs ==== 0          NP_060634.1 hypothetical protein FLJ10637 [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Gg ---- 0          XP_416439.2 PREDICTED: hypothetical protein [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 0          AAH74308.1 MGC84115 protein [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === ?? ==== 0          NP_001086192.1 MGC84115 protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xt ==== 0          AAH75538.1 MGC89452 protein [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TTpA008n06.5.5                                                                                                                                                                                                                      TAA---------------------------------------------------------------ATG---------------TGA------------ATG---------------------------------------------------TAA---------------------------------------------------------ATG------------------------------------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------ATG---------------------------------------------------------------------ATG---------------------------ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------TGA---------------------------------------------------TAG------------------------------------------------------------------------------------------------TAA------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                           [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2  SIG                                    Xt7.1-TTpA008n06.5                                                                                               ACAGCGCAAAGCCCTCTTGTAGCGGATATTCGCTCACAGTATCTTCCTGCTCATCTATTAAATTAGCCAATCACTGTATCTCCAGGCGATTAGTGCCCGCCCCCCTGGATAAGATCTACTAAAAACAGAAAGCGGCAGGGACCAAACAGCATGAAAGGGCAAAACGTACGATTAATGGGGTAGCGATGAGCTGCTCAGGCCTGTGACGGGAGGTCAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTTCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTATATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTACGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTCAGTGACTCCGGGTCTCGCACACTGAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGGAGAACGCCGACCGGGTGGCGAATAGGGGGCGCATCATCTGCATCACCAATGCCAAAAGTGACAGCCACGTCCAGATGCTGGAGGACTGCGTCAATGAGACGATCCACGAACATAACAAACTGGCCGCCGGGTCGGATCATCTCATGCAGATACAGAAATGCCATCTGGTGCTGATCCACACTTACCCGGTGGGAGAAGACAGCCTGGTATCCGATCGTCCCAAGAAGGAGCTCTCCAACGTGTTGATCAGCGAGGTGCACAGCGTCAAGGCCGGCCGCCATCTTTCCACCAAACTCAACCAGTTGGTCCAGCTGCACTTCGACCTGGCTTCCACCACCATTACCAACATTCCCATGAAGGAAGAGCAACATGCAAACACGTCCGCAAACTACGATGTGGAGCTTCTGCACCACAAAGAGGCGCATGTCGAGTTCAACAAAAGTGCAGGGGAAGGCTACAACGGCAGCAGCAGCAGAGAGAACTGCCTGAAGGAGACGGTGACGCTGAAGTGGTGCACCCCCAGGACCAACAGTGTGGAGCTGCACTATTGCACGGGAGCGTTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGGATCTATTGGGGGTTCTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGCGATTCCCTTGCACCCCCCCCCCCCCAAACCCGGGAGTTTGTTCCGTGTCTGGAGATTAAAGGCGATTTCTTTCCTATCAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008283388                                                                                                     CAAAGCCCTCTTGTAGCGGATATTCGCTCACAGTATCTTCCTGCTCATCTATTAAATTAGCCAATCACTGTATCTCCAGGCGATTAGTGCCCGCCCCCCTGGATAAGATCTACTAAAAACAGAAAGCGGCAGGGACCAAACAGCATGAAAGGGCAAAACGTACGATTAATGGGGTAGCGATGAGCTGCTCAGGCCTGTGACGGGAGGTCAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTTCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTATATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTACGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTCAGTGACTCCGGGTCTCGCACACTGAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGGAGAACGCCGACCGGGTGGCGAATAGGGGGCGCATCATCTGCATCACCAATGCCAAAAGTGACAGCCACGTCCAGATGCTGGAGGACTGCGTCAATGAGACGATCCACGAACATAACAAACTGGCCGCCGGGTCGGATCATCTCATGCAGATACAGAAATGCCATCTGGTGCTGATCCACACTTACCCGGTGGGAGAAGACAGCCTGGTATCCGATCGTCCCAAGAAGGAGCTCTCCAACGTGTTGATCAGCGAGGTGCACAGCGTCAAGGCCGGCCGCCATCTTTCCACCAAACTCAACCAGTTGGTCCAGCTGCACTTCGACCTGGCTTCCACCACCATTACCAACATTCCCATGAAGGAAGAGCAACATGCAAACACGTCCGCAAACTACGATGTGGAGCTTCTGCACCACAAAGAGGCGCATGTCGAGTTCAACAAAAGTGCAGGGGAAGGCTACAACGGCAGCAGCAGCAGAGAGAACTGCCTGAAGGAGACGGTGACGCTGAAGTGGTGCACCCCCAGGACCAACAGTGTGGAGCTGCACTATTGCACGGGAGCGTTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGGATCTATTGGGGGTTCTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGCGATTCCCTTGCACCCCCCCCCCCCCAAACCCGGGAGTTTGTTCCGTGTCTGGAGATTAAAGGCGATTxxTTx
  5   1   1           Neu0 FL                     IMAGE:6991282.FL-MGC                                                                                                                                                                                                                                                                    AAAACGTACGATTAATGGGGTAGCGATGAGCTGCTCAGGCCTGTGACGGGAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTTCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTATATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTACGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTCAGTGACTCCGGGTCTCGCACACTGAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGGAGAACGCCGACCGGGTGGCGAATAGGGGGCGCATCATCTGCATCACCAATGCCAAAAGTGACAGCCACGTCCAGATGCTGGAGGACTGCGTCAATGAGACGATCCACGAACATAACAAACTGGCCGCCGGGTCGGATCATCTCATGCAGATACAGAAATGCCATCTGGTGCTGATCCACACTTACCCGGTGGGAGAAGACAGCCTGGTATCCGATCGTCCCAAGAAGGAGCTCTCCAACGTGTTGATCAGCGAGGTGCACAGCGTCAAGGCCGGCCGCCATCTTTCCACCAAACTCAACCAGTTGGTCCAGCTGCACTTCGACCTGGCTTCCACCACCATTACCAACATTCCCATGAAGGAAGAGCAACATGCAAACACGTCCGCAAACTACGATGTGGAGCTTCTGCACCACAAAGAGGCGCATGTCGAGTTCAACAAAAGTGCAGGGGAAGGCTACAACGGCAGCAGCAGCAGAGAGAACTGCCTGAAGGAGACGGTGACGCTGAAGTGGTGCACCCCCAGGACCAACAGTGTGGAGCTGCACTATTGCACGGGAGCGTTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGATCTATTGGGGGTTCTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACAAACAAAAAAAAAGAAACAAATAAAAAAAAAAAAAAA
  0   1   1           Gas  FL                     TGas007o21.FL-Sanger                                                                                                                                                                                                                                                                                                                                             CCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTCCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTATATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTATGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTCAGTGACTCCGGGTCTCGCACACTGAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGGAGAACGCCGACCGGGTGGCGAATAGGGGGCGCATCATCTGCATCACCAATGCCAAAAGTGACAGCCACGTCCAGATGCTGGAGGACTGCGTCAATGAGACGATCCACGAACATAACAAACTGGCCGCCGGGTCGGATCATCTCATGCAGATACAGAAATGCCATCTGGTGCTGATCCACACTTACCCGGTGGGAGAAGACAGCCTGGTATCCGATCGTCCCAAGAAGGAGCTCTCCAACGTGTTGATCAGCGAGGTGCACAGCGTCAAGGCCGGCCGCCATCTTTCCACCAAACTCAACCAGTTGGTCCAGCTGCACTTCGACCTGGCTTCCACCACCATTACCAACATTCCCATGAAGGAAGAGCAACATGCAAACACGTCCGCAAACTACGATGTGGAGCTTCTGCACCACAAAGAGGCGCATGTCGAGTTCAACAAAAGTGCAGGGGAAGGCTACAATGGCAGCAGCAGCAGAGAGAACTGCCTGAAGGAGACGGTGACGCTGAAGTGGTGCACCCCCAGGACCAACAGCGTGGAGCTGCACTATTGCACGGGGGCATTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGGATCTATTGGGGGTTCTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAAAAAAAAAAAAAAA
  5   1   2       add Gas1 5x3  in                     NISC_mq23a02.y1                                                                                 TGCTAGAGGTCCGGCTCCCTACAGCGAAAGCCCTCTTGTAGCGGATATTCGCTCACAGTATCTTCCTGCTCATCTATTAAATTAGCCAATCACTGTATCTCCAGGCGATTAGTGCCCGCCCCCCTGGATAAGATCTACTAAAAACAGAAAGCGGCAGGGACCAAACAGCATGAAAGGGCAAAACGTACGATTAATGGGGTAGCGATGAGCTGCTCAGGCCTGTGACGGGAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTTCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTATATG
  5   1   2   20  ext Int1 5g                              CAAP9020.5p ............................................................................................CTACAGCGCAAAGCCCTCTTGTAGCGGATATTCGCTCACAGTATCTTCCTGCTCATCTATTAAATTAGCCAATCACTGTATCTCCAGGCGATTAGTGCCCGCCCCCCTGGATAAGATCTACTAAAAACAGAAAGCGGCAGGGACCAAACAGCATGAAAGGGCAAAACGTACGATTAATGGGGTAGCGATGAGCTGCTCAGGCCTGTGACGGGAGGTCAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTTCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTATATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTACGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTCAGTGACTCCGGGTCTCGCACACTGAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACG
  5   1   2   24  ext Brn3 5g   ?                          CAAK8472.5p ..............................................................................................ACAGCGCAAAGCCCTCTTGTAGCGGATATTCGCTCACAGTATCTTCCTGCTCATCTGTTAAATTAGCCAATCACTGTATCTCCAGGCGCTTAGTGCCCGCCCCTCTGGATAAGATCGACTAAAAACAGAAAGCGGCAGGGACCAAACAGCATGAAAGGGCAAAACGTACGATTAATGGGGTAGCGATGAGCTGCTCAGGCCTGTGACGGGAGGTCAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTTCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTATATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTACGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTCAGTGACTCCGGGTCTCGCACACTGAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGGAGAACGCCGACCGGGTGGCGAATAGGGNGCGCATCATCTGCATCACCAATGCCAAAAGTGACAGCCACGTCCAGATGCT
  5   1   2       ext TpA  5g                        TTpA077g15.p1kSP6                                                                                                                                                                                                                                                             GGCAAACGTACGATTAATGGGGTAGCGATGAGCTGCTCAGGCCTGTGACGGGAGGTCAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTCCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTATATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTATGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTCAGTGACTCCGGGTCTCGCACACTGAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGGAGAACGCCGACCGGGTGGCGAATAGGGGGCGCATCATCTGCATCACCAATGCCAAAAGTGACAGCCACGTCCAGATGCTGGAGGACTGCGTCAATGAGACGATCCACGAACATAACAAACTGGCCGCCGGGTCGGATCATCTCATGCAGATACAGAAATGCCATCTGGTGCTGAT
  5   1   3        nb Egg  5g                        TEgg116a01.p1kSP6                                                                                                                                                                                                                                                              CAAAACGTACGATTAATGGGGTAGCGATGAGCTGCTCAGGCCTGTGACGGGAGGTCAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTTCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTATATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTACGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTCAGTGACTCCGGGTCTCGCACACTGAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGT
  5   1   3        nb Gas  5g   ?                    TGas105m24.p1kSP6                                                                                                                                                                                                                                                              CAAAACGTACGATTAATGGGGTAGCGATGAGCTGCTCAGGCCTGTGACGGGAGGTCAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTCCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTATATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTATGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTCAGTGACTCCGGGTCTCGCACACTGAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCT
  5   1   2       ext TpA  5g3  in                   TTpA030p11.p1kSP6                                                                                                                                                                                                                                                              GCAAACGTACGATTAATGGGGTAGCGATGAGCTGCTCAGGCCTGTGACGGGAGGTCAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTTCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTATATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTACGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTCAGTGACTCCGGGTCTCGCACACTGAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGGAGAACGCCGACCGGGTGGCGAATAGGGGGCGCATCATCTGCATCACCAATGCCAAAAGTGACAGCCACGTCCAGATGCTGGAGGACTGCGTCAATGAGACGATCCACGAACATAACAAACTGGCCGCCGGGTCGGATCATCTCATGCAGATACAGAAATGCCATCTGGTGCTGATCCACACTT
  5   1   3   22   nb Gas7 5g   ?                          XZG49062.5p ...............................................................................................................................................................................................................................................................AAACGTACGATTCATGGGGTAGCGATGAGCTGCTCAGGCCTGTGACGGGAGGTCAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTTCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTATATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTACGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTCAGTGACTCCGGGTCTCGCACACTGAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGGAGAACGCCGACCGGGTGGCGAATAGGGGGCGCATCATCTGCATCACCAATGCCAAAAGTGACAGCCACGTCCAGATGCTGGAGGACTGCGTCAATGAGACGATCCACGAACATAACAAACTGGCCGCCGGGTCGGATCATCTCATGCAGATACAGAAATGCCATCTGGTGCTGATCCACACTTACCCCG
  5   1   3        nb Neu  5g   ?                    TNeu109a05.p1cSP6                                                                                                                                                                                                                                                                     TACGATTAATGGGGTAGCGATGAGCTGCTCAGGCCTGTGACGGGAGGTCAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTTCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTC
  5   1   2       add Neu0 FL                            IMAGE:6991282                                                                                                                                                                                                                                                                     AAACGTACGATTAATGGGGTAGCGATGAGCTGCTCAGGCCTGTGACGGGAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTTCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTATATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTACGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTCAGTGACTCCGGGTCTCGCACACTGAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGGAGAACGCCGACCGGGTGGCGAATAGGGGGCGCATCATCTGCATCACCAATGCCAAAAGTGACAGCCACGTCCAGATGCTGGAGGACGCTATGAATCAAAGCCGACGN
  5   1   2       add Gas       in                   TGas123j10.p1cSP6                                                                                                                                                                                                                                                                                            AGCTGCTCAGGCCTGTGACGGGAGGTCAAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTTCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTATATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAAGATCATGTACGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTCAGTGACTCCGGGTCTCGCACACTGAATTCCTGGAATCAAGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGGTGGAGGCCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGG
  5   1   3        nb Gas8 5g                               st25h07.5p                                                                                                                                                                                                                                                                                              TGCTCAGGCCTGTGACGGGAGGTCAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTTCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTATATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTACGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTCAGTGACTCCGGGTCTCGCACACTGAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGGAGAACGCCGACCGGGTGGCGAATAGGGGGCGCATCATCTGCATCACCAATGCCAAAAGTGACAGCCACGTCCAGATGCTGGAGGACTGCGTCAATGAGACGATCCACGAACATAACAAACTGGCCGCCGGGTCGGATCATCTCATGCAGATACAGAAATGCCATCTGGTGCTGATC
  5   1   3        nb Gas0 5g                              dad25d09.y1                                                                                                                                                                                                                                                                                                          ACGGGAGGTCAGAATGGCTGAGCAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTCCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTATATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTATGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTCAGTGACTCCGGGTCTCGCACACTGAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTG
  5   1   4   12 seed Tad5 5g3  in                         XZT63658.5p ...........................................................................................................................................................................................................................................................................................................................GTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTTCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTATATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTACGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTCAGTGACTCCGGGTCTCGCACACTGAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGGAGAACGCCGACCGGGTGGCGAATAGGGGGCGCATCATCTGCATCACCAATGCCAAAAGTGACAGCCACGTCCAGATGCTGGAGGACTGCGTCAATGAGACGATCCACGAACATAACAAACTGGCCGCCGGGTCGGATCATCTCATGCAGATACAGAAATGCCATCTGGTGCTGATCCACACTTACCCGGTGGGAGAAGACAGCCTGGTATCCGATCGTCCCAAGAAGGAGCTCTCNCACGTGTTGATCAGCGAGGTGCACAGCGTCAAGGCCGGCCGCCATCTTTC
  5   1   3        nb Gas  FL                        TGas007o21.p1kSP6                                                                                                                                                                                                                                                                                                                                             CCCAGGTGCATCCANACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTCCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTATATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTATGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTCAGTGACTCCGGGTCTCGCACACTGAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGGAGAACGCCGACCGGGTGGCGAATAGGGGGCGCATCATCTGCATCACCAATGCCAAAAGTGACAGC
  5   1   3        nb HdA  5g                        THdA020n06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGACAGGATGAAGACTTTCTCGGAATCGCACGAGACGGTGTTCGTGGTGGATCACTGCCCGTATATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACGACACTCTGGGGATCATCCCCCTGGCGCCCATCTCAGAGTCCCTGGGGACGTGTGCCATAAAAGCGTCCATGGAATATTGTAAGATCATG
  5   1   3        nb Tad5                                 XZT30902.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGGAGAACGCCGACCGGGTGGCGAATAGGGGGCGCATCATCTGCATCACCAATGCCAAAAGTGACAGCCACGTCCAGATGCTGGAGGACTGCGTCAATGAGACGATCCACGAACATAACAAACTGGCCGCCGGGTCGGATCATCTCATGCAGATACAGAAATGCCATCTGGTGCTGATCCACACTTACCCGGTGGGAGAAGACAGCCTGGTATCCGATCGTCCCAAGAAGGAGCTCTCCAACGTGTTGATCAGCGAGGTGCACAGCGTCAAGGCCGGCCGCCATCTTTCCACCAAACTCAACCAGTTGGTCCAGCTGCACTTCGACCTGGCTTCCACCACCATTACCAACATTCCCATGAAGGAAGAGCAACATGCAAACACGTCCGCAAACTACGATGTGGAGCTTCTGCACCACAAAGAGGCGCATGTCGAGTTCAACAAAAGTGCAGGGGAAGGCTACAACGGCAGCAGCAGCAGAGAGAACTGCCTGAAGGAGACGGTGACGCTGAAGTGGTGCACCCCCAGGACCAACAGTGTGGAGCTGCACTATTGCACGGGAGCGTTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCT
  5   1   3        nb Neu                            TNeu004b17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGCATACCCGGAGTGCTGCAGTATCCTGCTGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGGAGAACGCCGACCGGGTGGCGAATAGGGGGCGCATCATCTGCATCACCAATGCCAAAAGTGACAGCCACGTCCAGATGCTGGAGGACTGCGTCAATGAGACGATCCACGAACATAACAAACTGGCCGCCGGGTCGGATCATCTCATGCAGATACAGAAATGCCATCTGGTGCTGATCCACACTTACCCCGTGGGAGAAGACAGCCTGGTATCCGATCGTCCCAAGAAGGAGCTCTCCAACGTGTTGATCAGCGAGGTGCACAGCGTCAAGGCCGGCCGCCATCTTTCCACCAAACTCAACCAGTTGGTCCAGCTGCACTTCGACCTGGCTTCCACCACCATTACCAACATTCCCATGAAGGAAGAGCAACATGCAAACACGTCCGCAAACTACGATGTGGAGCTTCTGCACCACAAAGAGGCGCATGTCGAGTTCAACAAAAGTGCAGGGGAAGGCTACAACGGCAGCAGCAGCAGAGAGAACTGCCT
  5   1   2       ext Spl1      in                         CABK1572.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCAAGAAGGAGCTCTCCAACGTGTTGATCAGCGAGGTGCACAGCGTCAAGGCCGGCCGCCATCTTTCCACCAAACTCAACCAGTTGGTCCAGCTGCACTTCGACCTGGCTTCCACCACCATTACCAACATTCCCATGAAGGAAGAGCAACATGCAAACACGTCCGCAAACTACGATGTGGAGCTTCTGCACCACAAAGAGGCGCATGTCGAGTTCAACAAAAGTGCAGGGGAAGGCTACAACGGCAGCAGCAGCAGAGAGAACTGCCTGAAGGAGACGGTGACGCTGAAGTGGTGCACCCCCAGGACCAACAGTGTGGAGCTGCACTATTGCACGGGAGCGTTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAAC
  5   1   2       add In63                            IMAGE:8957647.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTCACGTTTTATTTTGGAGTCTTCCAAAAAAAAAAAAACGTCCGGTCAGGCGGCCGCCATCTTTCCACCAAACTCAACCAGTTGGTCCAGCTGCACTTCGACCTGGCTTCCACCACCATTACCAACATTCCCATGAAGGAAGAGCAACATGCAAACACGTCCGCAAACTACGATGTGGAGCTTCTGCACCACAAAGAGGCGCATGTCGAGTTCAACAAAAGTGCAGGGGAAGGCTACAACGGCAGCAGCAGCAGAGAGAACTGCCTGAAGGAGACGGTGACGCTGAAGTGGTGCACCCCCAGGACCAACAGTGTGGAGCTGCACTATTGCACGGGAGCGTTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGCGGTGGTGCCGCTCGCAGCGTGATAGTGAAGAGTCGCTGAGTGAGGAGACGTGCTCACTGCCAGAAACATCTATAACTTGGTCGATATGGAACGGAAAACGATCTCTC
  5   1   3        nb Gas7                                 XZG36033.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACAGCGTCAAGGCCGGCCGCCATCTTTCCACCAAACTCAACCAGTTGGTCCAGCTGCACTTCGACCTGGCTTCCACCACCATTACCAACATTCCCATGAAGGAAGAGCAACATGCAAACACGTCCGCAAACTACGATGTGGAGCTTCTGCACCACAAAGAGGCGCATGTCGAGTTCAACAAAAGTGCAGGGGAAGGCTACAATGGCAGCAGCAGCAGAGAGAACTGCCTGAAGGAGACGGTGACGCTGAAGTGGTGCACCCCCAGGACCAACAGCGTGGAGCTGCACTATTGCACGGGGGCATTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTG
  5   1   3        nb Gas7      in                         XZG23872.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCCGCCNATCTTTCCACCAAACTCAACCAGTTGGTCCAGCTGCACTTCGACCTGGCTTCCACCACCATTACCAACATTCCCATGAAGGAAGAGCAACATGCAAACACGTCCGCAAACTACGATGTGGAGCTTCTGCACCACAAAGAGGCGCATGTCGAGTTCAACAAAAGTGCAGGGGAAGGCTACAACGGCAGCAGCAGCAGAGAGAACTGCCTGAAGGAGACGGTGACGCTGAAGTGGTGCACCCCCAGGACCAACAGTGTGGAGCTGCACTATTGCACGGGAGCGTTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGG
  5   1   3        nb Gas7      in                         XZG31480.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTGCACTTCGACCTCGGCTTCCACCACCATTACCAACATTCCCATGAAGGAAGAGCAACATGCAAACACGTCCGCAAACTACGATGTGGAGCTTCTGCACCACAAAGAGGCGCATGTCGAGTTCAACAAAAGTGCAGGGGAAGGCTACAACGGCAGCAGCAGCAGAGAGAACTGCCTGAAGGAGACGGTGACGCTGAAGTGGTGCACCCCCAGGACCAACAGTGTGGAGCTGCACTATTGCACGGGAGCGTTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCAGGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTNCACTGCCCAGAAACCATCTATAACTTGGTCGATATGGGACGGGAAAACGACCCCCCTCCCATCTCCAC
  5   1   3        nb Tad5                                 XZT64226.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCATTACCAACATTCCCATGAAGGAAGAGCAACATGCAAACACGTCCGCAAACTACGATGTGGAGCTTCTGCACCACAAAGAGGCGCATGTCGAGTTCAACAAAAGTGCAGGGGAAGGCTACAACGGCAGCAGCAGCAGAGAGAACTGCCTGAAGGAGACGGTGACGCTGAAGTGGTGCACCCCCAGGACCAACAGTGTGGAGCTGCACTATTGCACGGGAGCGTTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAAC
  5   1   2       ext TpA       out                  TTpA060b13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGCTGAAGTGGTGCACCCCCAGGACCAACAGTGTGGAGCTGCACTATTGCACGGGAGCGTTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGAACGGCACCAGAGGNTGATGGACTGCCTTATGGCCTGC
  5   1   3        nb TpA       out                  TTpA060b14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGCTGAAGTGGTGCACCCCCAGGACCAACAGTGTGGAGCTGCACTATTGCACGGGAGCGTTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGAACGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGC
  5   1   3        nb Eye       in                         CCAX5273.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCACTATTGCACGGGAGCGTTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTT
  5   1   3        nb Gas8                                  st29i03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGA
  5   1   3        nb Gas8                                  st78m20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAG
  3  -1   3        nb Int1      in                         CAAP7261.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGCCGCGAAAATCCGGCTCCAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCCTGTTGTCTTTATGGAGCTCTCGGATCACACGGCCAAT
  5   1   2       add Gas7      in                         XZG46053.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGTTCGATTCGTCGACCCACGCGTCCGCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATG
  5   1   0       chi Gas       out                  TGas124g20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGACGCTGAAGTGGTGCACCCCCAGGACCAACAGTGTGGAGCTGCACTATTGCACGGGAGCGTTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAG
  5   1   3        nb Tbd1      in                        CBXT14776.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCA
  5   1   2       ext Gas7      in                          XZG5263.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGTAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGG
  5   1   0       chi Gas                            TGas057c16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGAGTTGGCGCATTGGATTAACTTCCCCCTTAATCCAGATTAAAGGGGAAGTTAACCCTTCCGCTCGAACCAATGATTATTCAGCCTCATCCTAACCTTTAGGCTGCGGCATAGAAAGAGTCAAAAATAAAAAAATGCACATTCGCCCCCTCACCCGTTTCCCAGAAATCTCCAGGAAAAGGAGGGACCATTTGTCTGCGCCGTGTAGGGGGAAACCCCCAGGAAACCACATGGAAAAGTCCCAATAACCAGAATGTTCCCTGAGGTTCCGAGCGGCTCCCAAATACACACGGGGGGAGGGTATATAAATAGCATAGATTTGGGGGCGCAGAGCCCTGGCCCCAACCCAACTGAACCCCCGTGGGATGAATTGGAACCCCGATTGTGAGCCTGATCCCCCAACATTAGTTCCCAACCTCACTAATGCTCTTTTGGCTGAATGGCAGCAACTCCCAGCAACCCTTCTGACATCTAGT
  5   1   3        nb Gas8                                  st29b20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCA
  5   1   3        nb Gas8                                  st30b20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCA
  5   1   3        nb Gas8                                  st35p04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACGGGCCAAGGAGCANCTGGAGAGGCNCACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGANTCNCTGAGTGAGGANGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACNGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCANGAGCAAGCCCCCCNANGAGGANGAGCGCANGANNCGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCNGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGA
  5   1   3        nb TpA                            TTpA008n06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGAATCTATTGNGGGGTTCTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGCGATTCCCTTGCACCCCCCCCA
  5   1   3        nb Gas8                                  st90d16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGG
  3  -1   3        nb Ovi1      ?                          CABI7562.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGATATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGGATCTATTGGGGGTTCTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGCGATTCCCTTGCACCCC
  5   1   3        nb Gas8                                  st91d16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ANNTTGGTCGATATGGAACGGAAAAACGACCCCCTTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGNCGCCAGTGACGCTGCGG
  5   1   3        nb Gas8                                 st105i22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGGATCTATTGGGGGTTCTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGA
  3   1   3        nb Gas       ?                     TGas124g18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGGATCTATTGGGGGTTCTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGCGATTCCCTTGCACCCCCCCCCCCCCAAACCCGGGAGTTTGTTACACGTGTCTGGAGATTAAAGGCGATTCTTTCCTATAAAAAAAAAAAAAAAAAA
  5   1   2       add Tbd1      in                        CBXT18674.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAGCGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGATCCATTGGGGGATCCATTGGGGGTTCCGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAAATTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGCGATTCTCTTGCACCCCCCCCCCCAAACCCGCCCGGGAGTTGGTTCCGTGTCTGGAGATTAAAGGCGATTCTTTCCTAAAAAAAAAAAAAAAG
  5   1   0       chi Gas                            TGas076m24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAAACGTACGATTAATGGGGTAGCGATGAGCTGCTCAGGCCTGTGACGGGAGGTCAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTCCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGGATCTATTGGGGGTTCTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTT
  5  -1   3        nb Int1      in                         CAAP7261.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGCCAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGGATCTATTGGGGGTTTTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGCGATTCCCTTGCACCCCCCCCCCCCCAAACCCGGGAGTTTGTTCCGTGTCTGGAGATTAAA
  3   1   2       ext Spl1      in                         CABK1572.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGGATCTATTGGGGGTTTTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGGGATTCCCTTGCACCCCCCCCCCCCCAAACCCGGGAGTTTGTTCCGTGTCTGGAGATTAAAGGCGATTCTTTCCTATT
  3   1   4      seed Tad5 5g3  in                         XZT63658.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGATCTATTGGGGGTTTTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGCGATTCCCTTGCACCCCCCCCCCAAACCCGGGAGTTTGTTCCGTGTCTGGAGATTAAAGGCGATTCTTTCCT
  3   1   2       ext TpA  5g3  in                    TTpA030p11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGAGGGTGATGGACTGCCTTATGGCGTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGCCAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCCCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGATCTATTGGGGGTTTTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGCGATTCCCTTGCACCCCCCCCCCAAACCCGGGAGTTTGTTCCGTGTCTGGAGATTAAAGGCGATTCTTTCCTATTCAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       add Gas7      in                         XZG46053.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGCCAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTAGGGAGCTCTGGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGCCAAGGGGAGCCCCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGGATCTATTGGGGGTTTTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGCCCCAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGGGATTCCCTTGCACCCCCCCCCCCCCAAACCCGGGAGTTTGTTCCGTGTCTGGAGATTAAAGGCGATTCTTTCCTATT
  3   1   2       add Tbd1      in                        CBXT18674.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCTGCAGGAGCAAGCCCCCCGAGGAGGAGGAGCGCAAGAAGCGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGATCCATTGGGGGATCCATTGGGGGTTCCGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAAATTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGCGATTCCCTTGCCCCCCCCCCCCCAAACCCGCCCGGGAGTTGGTTCCGTGTCTGGAGATTAAAGGCGATTCTTTCCTAAAAAAAAAAAAAAA
  3   1   2       add Gas       in                    TGas123j10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGAGGAGGAGCGCAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGANAAAGGGAAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGAGACAGGAATCGAGAGGGTAAAATATGTCATGAACCGAGAGAAGGAGGATTTGGGGGAGGCAGAAATGATAAAAAACTTTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTCAGGATACGGGTCTTGCAGAGAAATCTAAAGGCCCCATATCCCGGGAATCTAAGAGAGCACTGGACCAACACGGCCAAACCAGGAAACACAAGGAGCCGGCGGGAGCCGAACCGGCAAAGAACAAGGGGAGCAAATCAGCATCACAAGGAGGAGAAAGGGGCGGAAGGGGNGAGAACGGCAAGGGG
  5   1   3        nb Gas                            TGas027m14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGGATCTATTGGGGGTTCTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGCGATTCCCTTGCACCCCCCCCCCCCCCAAACCCGGGAGTTTGTTCCGTGTCTGGAGATTAAAGGCGATTCTTTCC
  3   1   0       chi Lun1      out                        CABD2872.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATGCAAAATCCTAGCCAATATAAAATTCCTGACTGGTTTTTGAACAGACAGAAGGCCTTTAAGGATGGAAAATACAGCCAGGTTCTTGCCAACGGTCTGGACAATAAACTCCGTGAAGATTTAGAGCGACTCAAAAAGATCAAGGCTCACAGAGGACTGGGTCACTTCTGGGGTTTGCGTGTCGGAGGTCCGCACACAGGGCCCACGGCGGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTAGGGAGCTCTGGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGGATCTATTGGGGGTTTTGCGCTGGACATTTCAATGAATTCATGAATATTCGGGACCCAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAAGGAATTTTTAGTACCGGGATTCCCTTGCACCCCCCCCCCCCCAAACCCGGGAGTTTGTTCCGTGTCTGGAGATTAAAGGCGATTCTTTCCTAT
  5   1   3        nb Gas7      ?                          XZG25503.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCACGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGGATCTATTGGGGGTTCTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGCGATTCCCTTGCACCCCCNCCCCCCCAAACCCGGGAGTTTGTTCCGTGTCTGGAGATTAAAGGCGATTCTTTCCTATTTAAAGGGA
  3   1   2       ext Gas7      in                          XZG5263.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCCCGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTGGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGTAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGGATCTATTGGGGGTTTTGCGCTGGACATTTCAATGAATTCATGAA
  3   1   3        nb Eye       in                         CCAX5273.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACCCCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCCCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGATCTATTGGGGGTTCTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCCCGAGAATGAATTTTTAGTACCGCGATTCCCTTGCACCCCCCCCCCAAACCCGGGAGTTTGTTCCGTGTCTGGAGATTAAAGGCGATTCTTTCCTATTC
  3   1   3        nb Gas7      in                         XZG23872.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTTTCCAGATTCCCCCGAGCCCCTTAACAAGAAGCCCCCCATCATGGTTGGGGATACGGGTCCTGCAGAGAAATTTAAAGGCCCCATGTCCTTGTTGTTTTTAGGGAGCTTTGGGATCAACACGGCCAATTCCGGGAAACCCCGGGAGTTTGTGGGGCGCCTGAATTTTGTTAATAACAAGGGGGGGTTATTTCAGCTTTTCAAGGAGGAAAATGGGGCGGAAGGGGTGGAAAACGCCAAGGGGACCCCCCAGTGACGCTGGGGGGGGATCCATTGGGGGATCCATTGGGGGGATTTTTTGGGGGTTTTGCGCGGGCCATTTCAAGGAATTCAGGAATTTTCGGGCCCCAAAGTGGAAAAATTTTTTTTAAACTTTTTTTAGAACTTTTTTCCGCCCCCGGGGAAGGAATTTTTAGTACCGGGATTCCTTTGCACCCCCCCCCCCCCAAACCCGGGAGTTTGTTCCGTGTCTGGAGATTAAAGGGGATTCTTTCCTTTT
  5   1   2       add Neu                            TNeu047c12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACAAGGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGTTCTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGCGATTCCCTTGCACCCCCCCCCCCCCAAACCCGGGAGTTTGTTCCGTGTCTGGAGATTAAAGGCGATTCTTTCCTATT
  5   1   3        nb Gas       in                  TGas096b22.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGGATCTATTGGGGGTTCTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGCGATTCCCTTGCACCCCCCCCCCCCCAAACCCGGGAGTTTGTTCCGTGTCTGGAGATTAAAGGCGATTCTTTCCTATTC
  3   1   3        nb Gas       in                    TGas096b22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGGATCTATTGGGGGTTCTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGCGATTCCCTTGCACCCCCCCCCCCCCAAACCCGGGAGTTTGTTCCNGTGTCTGGAGATTAAAGGCGATTCTTTCCTATCAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG31480.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGTTATATCAGCTTCTCAAGGAGGAGAATGGGGGGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGTTGGGGAGGGATCCATTGGGGGATCCATGGGGGGATTTATTGGGGGTTTTGCGCGGGACATTTCAAGGAATTCAGGAATTTTCGGGCCCCAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTTTTCGGACCCAGGAGAAGGAATTTTTAGTACCGGGATTCCCTTGCACCCCCCCCCCCCCCAAACCCGGGAGTTTGTTCCGTGTCTGGAGATTAAAGGGGATTCTTTCCTATTC
  5   1   3        nb Neu                            TNeu050l16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCGGGGCCCGGGGAGGGCGGAAGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGATCTATTGGGGGTTCTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGCGATTCCCTTGCACCCCCCCCCCAAACCCGGGAGTTTGTTCCGTGTCTGGAGATTAAAGGCGATTCTTTCCTATTC
  5   1   2       add Bone                                CBTC9939.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCGGGGGGATCCATTGGGGGATCCATTGGGGGATCCATTGGGGGATCCATTGGGGGATCCATTGGGGGTTCCGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAAATTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGCGATTCCCTTGCACCCCCCCCCCCCCCCAAAACCGCGTGCCCGGGAGTTTGTTCCGTGTCTGGAGATTAAAGGCGATTCTTTCCTATTC
  3   1   2       add Gas1 5x3  in                     NISC_mq23a02.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGGATCTATTGGGGGTTCTGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAACTTTTTTTAGAACTTTCTTCCGACCCACGAGAATGAATTTTTAGTACCGCGATTCCCTTGCACCCCCCCCCCCCAAACCCGGGAGTTTGTTCCGTGTCTGGAGATTAAAGGCGATTCTTTCCTATTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   3        nb Tbd1      in                        CBXT14776.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGACCCAGGGGGGGGATATTTTGGGGGTTATGGGCCGGACATTTCAAGGAATGCATGAATATCCGGGACTCAAAGTAGAAAAATACTTTTTAAACTTTTTTTTAACCTTTTTTCCGACCCACGAGAATGAATTTTTATTCCCGGGATTCCCTTCCCCCCCCCCCCCCCCAAACCCGGGAGTTTGTTCCGTGTCTGGAGATTAAAGGCGATTCTTTCCTAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CBSW8279.5                                                                                                                                                                                                                                                       GAAAGGGCAAAACGTACGATTAATGGGGTAGCGATGAGCTGCTCAGGCCTGTGACGGGAGGTCAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTTCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTACATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTACGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTGAGTGACTCCGGGTCTCGCACACTAAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGGAGAACGCCGACCGGGTGGCGAATAGGGGGCGCATCATCTGCATCACCAATGCCAAAAGTGACAGCCATGTCCAGATGCTGGAGGACTGTGTCAATGAGACGATCCACGAACATAACAAACTGGCCGCCGGGTCGGATCATCTCATGCAGATACAGAAATGCCATCTGGTGCTGATCCACACTTACCCGGTGGGAGAAGACAGCCTGGTATCCGATCGTCCCAAGAAGGAGCTCTCCAACGTGTTGATCAGCGAGGTGCACAGCGTCAAGGCCGGCCGCCATCTTTCCACCAAACTCAACCAGTTGGTCCAGCTGCACTTCGACCTGGCTTCCACCACCATTACCAACATTCCCATGAAGGAAGAGCAACATGCAAACACGTCCGCAAACTACGATGTGGAGCTTCTGCACCACAAAGAGGCGCATGTCGAGTTCAACAAAAGTGGGGAAGGCTACAACGGCAGCAGCAGCAGAGAGAACTGCCTGAAGGAGACGGTGACGCTGAAGTGGTGCACCCCCAGGACCAACAGTGTGGAGCTGCACTATTGCACGGGAGCGTTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCTTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTCGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGACATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCC------------------------CCGTAAGGGAAAGTTGAAAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCATGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATTTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGTTGCGGAGGGATCCATTGGGAGATCCATTGGGGGATCCATTGGGGGATCCATTGGGGGTTCCGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAAATTTTTTTAGAACTTTTTTCCGACCCACGAGAATGAATTTTTAGTACCGGGATTCCCTTGCACCCCCCCCCCCCAAACCCGCGTGCCCGGGAGTTGGTTCCGTGTCTGGAGATTAAAGGCAATTCTTT
                                                  Xt7.1-CHK-1008283390                                                                                                                                                                                                                                                             GCAAAACGTACGATTAATGGGGTAGCGATGAGCTGCTCAGGCCTGTGACGGGAGGTCAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTTCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTACATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTACGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTGAGTGACTCCGGGTCTCGCACACTAAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGGAGAACGCCGACCGGGTGGCGAATAGGGGGCGCATCATCTGCATCACCAATGCCAAAAGTGACAGCCATGTCCAGATGCTGGAGGACTGTGTCAATGAGACGATCCACGAACATAACAAACTGGCCGCCGGGTCGGATCATCTCATGCAGATACAGAAATGCCATCTGGTGCTGATCCACACTTACCCGGTGGGAGAAGACAGCCTGGTATCCGATCGTCCCAAGAAGGAGCTCTCCAACGTGTTGATCAGCGAGGTGCACAGCGTCAAGGCCGGCCGCCATCTTTCCACCAAACTCAACCAGTTGGTCCAGCTGCACTTCGACCTGGCTTCCACCACCATTACCAACATTCCCATGAAGGAAGAGCAACATGCAAACACGTCCGCAAACTACGATGTGGAGCTTCTGCACCACAAAGAGGCGCATGTCGAGTTCAACAAAAGTGGGGAAGGCTACAACGGCAGCAGCAGCAGAGAGAACTGCCTGAAGGAGACGGTGACGCTGAAGTGGTGCACCCCCAGGACCAACAGTGTGGAGCTGCACTATTGCACGGGAGCGTTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCTTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTCGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGACATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAG------------CAAGTACCGTAAGGGAAAGTTGAAAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCATGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATTTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGAGATCCATTGGGGGATCCATTGGGGGATCCATTGGGGGTTCCGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAAATTTTTTTAGAACTTTTTTCCGACCCACGAGAATGAATTTTTAGTACCGGGATTCCCTTGCACCCCCCCCCCCCAAACCCGCGTGCCCGGGAGTTGGTTCCGTGTCTGGAGATTAAAGGCAATTCTTTCCTATT
  5   1   4   10 seed Tail 5g3  in                         CBSW4047.b1 ......................................................................................................................................................................................................................................................GAAAGGGCAAAACGTACGATTAATGGGGTAGCGATGAGCTGCTCAGGCCTGTGACGGGAGGTCAGAATGGTGAGAAAAGGAGACACCCCAGGTGCATCCAGACTCCCTGCATCTCGTCTGTAACGGCCATTGTGTTCCCCCCATCCCTGCATCACCCCAGCCCAGGGGGCAAAGGACAAGATGAAGACTTTCTCGGAGTCGCACAAGACGGTGTTCGTGGTGGATCACTGCCCGTACATGTCGGAGTCGTGCCGGCAGCACGTGGAGTTCGATATGCTCACCAAGAACCGCACTCAGGGGATCATCCCCCTGGCGCCCATCTCCAAGTCCCTGTGGACGTGTGCCATAGAAGCTTCCATGGAATATTGTAGGATCATGTACGATATATTTCCCTTCAGAAAACTGGTGAATTTCATTGTGAGTGACTCCGGGTCTCGCACACTAAATTCCTGGAATCAGGAAGACCAGAATCTGCAAGAGCTAATGGCCGCTTTAGCCGTTATCGGACCGCCCAACCCGCGCGCAGACCCGGAGTGCTGCAGTATCCTGCATGGGCTGGTGGAGGCCGTTGAATCCCTGTGTAAAATAACCGATTATCAGCACGAATCCAGGACTGAGCTGATGGAGAACGCCGACCGGGTGGCGAATAGGGGGCGCATCATCTGCATCACCAATGCCAAAAGTGACAGCCATGTCCAGATGCTGGAGGACTGTGTCAATGAGACGATCCACGAACATAACAAACTGGCCGCCGGGTCGGATCATCTCATGCAGATACAGAAATGCCATCTGGTGCTGATCCACACTTACCCG
  5   1   2       ext Te4       ?                         CAAN11679.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGACGATCCACGAACATAACAAACTGGCCGCCGGGTCGGATCATCTCATGCAGATACAGAAATGCCATCTGGTGCTGATCCACACTTACCCGGTGGGAGAAGACAGCCTGGTATCCGATCGTCCCAAGAAGGAGCTCTCCAACGTGTTGATCAGCGAGGTGCACAGCGTCAAGGCCGGCCGCCATCTTTCCACCAAACTCAACCAGTTGGTCCAGCTGCACTTCGACCTGGCTTCCACCACCATTACCAACATTCCCATGAAGGAAGAGCAACATGCAAACACGTCCGCAAACTACGATGTGGAGCTTCTGCACCACAAAGAGGCGCATGTCGAGTTCAACAAAAGTGGGGAAGGCTACAACGGCAGCAGCAGCAGAGAGAACTGCCTGAAGGAGACGGTGACGCTGAAGTGGTGCACCCCCAGGACCAACAGTGTGGAGCTGCACTATTGCACGGGAGCGTTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCACGGCGGCGAGATCTTCCTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTTGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGG
  5   1   2       ext Tail      in                         CBSW8279.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCGTGCACCCCCGGACCAACAGTGTGGAGCTGCACTATTGCACGGGGGCATTCCGGATTTCCCCGGTGGATGTAAATAGCCGGCCCTCCTCCTGCCTCACCAACTTCCTGTTGAATGGTCGATCTGTGCTGCTGGAACAGCCGCGAAAATCCGGCTCCAAAGTGATCAGCCACATGCTGAGCAGCCATGGCGGCGAGATCTTCTTGCACGTGCTCAGTAGCTCCCGCTCCATCCTGGAGGACCCCCCGTCTATCAGCGAGGGCTGCGGGGGCAGAGTGACCGATTATAGGATCACGGACTTTGGCGAGTTTATGAGGGAGAACCGATTGATGCCATTCGCAGAGCCGCGTTATTGCATGGACGGTGGCCCGGAGGTGCCGCTGGAACGGGCCAAGGAGCAGCTGGAGAGGCACACGCGCTATTGGCCCATGATCATCTCGCAGACCACCATATTTAACATGCAGGCGGTGGTGCCGCTCGCCAGCGTGATAGTGAAGGAGTCGCTGAGTGAGGAGGACGTGCTCAACTGCCAGAAAACCATCTATAACTTGGTCGACATGGAACGGAAAAACGACCCCCTCCCCATCTCCACGGCTGGGACCCGAGGGAAAGGCCCAAAGAGGGACGAGCAGTACCGCATCATGTGGAACGAGCTGGAGACGCTGGTGCGAGCCCACGTGCGCGGCTCCGACCGGCACCAGAGGGTGATGGACTGCCTTATGGCCTGCAGGAGCAAGCCCCCCGAG
  3   1   2       ext HeRe      in                     EC2CAA11CF03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGACAAGTACCGTAAGGGAAAGTTGAAAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCATGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGGATCCATTGGGGGATCCATTGGGGGTTCCGCGCTGGACATTC
  5   1   2       ext HeRe      in                     EC2CAA11CF03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACAAGTACCGTAAGGGAAAGTTGAAAAGAAACGGGGCAGGAAGAGAGAGGACAAGGAAGAGAAAGCGGAGAAACCCCCCAAGGAGAACGAGCATGAGAAAAAGTGGCAGGAATCGGAGAGGGTAAAATCTGTCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTCTCCAGATTCCCCCGAGCCCCCTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATCTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTCTCGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAACTCTGTTAATAACAAGGCTGAGTTATATCAGCATCTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGCTGCGGAGGGATCCATTGGGGG
  3   1   4      seed Tail 5g3  in                         CBSW4047.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCTGGACCGAGAGAAGGAGGATTTGGCTGAGGCCGAAGTGATAAAAGACTTTCCAGATTCCCCCGAGCCCCTTAACAAGAAGCCCCACATCATGGTTGAGGATACGGGTCCTGCAGAGAAATTTAAAGGCCCCATGTCCTTGTTGTCTTTATGGAGCTTTGGGATCAACACGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAATTCTGTTAATAACAAGGCTGAGTTATATCAGCATTTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGTTGCGGAGGGATCCATTGGGAGATCCATTGGGGGATCCATTGGGGGATCCATTGGGGGTTCCGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAAATTTTTTTAGAACTTTTTTCCGACCCACGAGAATGAATTTTTAGTACCGGGATTCCCTTGCACCCCCCCCCCCCAAACCCGCGTGCCCGGGAGTTGGTTCCGTGTCTGGAGATTAAAGGCAATTCTTTCCTATTCAAAAAAAAAAAAAAA
  3   1   2       ext Tail      in                         CBSW8279.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGCTTTGGGATCAACAGGGCCAATTCCAGGAAACACCAGGAGTTTGTTGGGCGCCTGAATTTTGTTAATAACAAGGTTGAGTTATATCAGCATTTCAAGGAGGAGAATGGGGCGGAAGGGGTGGAGAACGGCAAGGGGAGCCGCCAGTGACGTTGGGGAGGGATCCATTGGGAGATCCATTGGGGGATCCATTGGGGGATCCATTGGGGGTTCCGCGCTGGACATTTCAATGAATTCATGAATATTCAGGACACAAAGTAGAAAAATATTTTTTAAAATTTTTTTAGAACTTTTTTCGGACCCAGGAGAATGAATTTTTAGTACCGGGATTCCCTTGCACCCCCCCCCCCCAAACCCGCGTGCCCGGGAGTTGGTTCCGTGTCTGGAGATTAAAGGCAATTCTTTCCTATTCAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)