Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 92%

 1012074459 Xt7.1-CAAJ16702.3.5 - 40 ESTs
                                                                       ....-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CAAJ16702.3.5                                                                                                                                                                                                                       CTTCCGCAACCCGCTGTACAGAGTTCCTGCTGTATTTATCTCACAGCGCACAGGTGATAATGGAGGACCAGTGGCAAGAGAGCATGGATTTTGCTATTTTGATAGCCAGAAAGGCAGGCTCAGTGGTGTGTGCGGCACTAAAGGAAGATGTTTCCATAATGGTTAAAAGTTCCCCTGCAGATCTGGTGACAGCCACAGACCAAAAAGTCGAAGAAATGCTTATCTCATCCATTAAGGAGAAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAATTTTTATTCTGTGTTACTAATTATTTTAACCATTTTGTGCAATAGAATCTACATTGCAGATATTAAAGTGCCATATTCCTGACACCAAAGGTTCTACAGTTCCACGTCTCTTTTTGATCTGCGCTGCGCTTTGTTTACTGGCAGCATGCAGCATGGCAAGATCAGATAAAATAAACACTAAAAGGGTTACAACACTATTACTGTGAATTTTATAGGGAGGTGAAAAGGAACACATATATGCTTCCCCCCAAATTACCTGAAAGGACCACAATATGTTAGAATATCTTTTCCATTAGGTTAATGTCTGTGTAGTACTCAATTACAATGGACGAAATCAATAAAATCTGATTCTGTCTCCTAAAAAAAAAAAAAGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAA
                                                  Xt7.1-CHK-1008226826                                                                                                                                                                                                                             CAACCCGCTGTACAGAGTTCCTGCTGTATTTATCTCACAGCGCACAGGTGATAATGGAGGACCAGTGGCAAGAGAGCATGGATTTTGCTATTTTGATAGCCAGAAAGGCAGGCTCAGTGGTGTGTGCGGCACTAAAGGAAGATGTTTCCATAATGGTTAAAAGTTCCCCTGCAGATCTGGTGACAGCCACAGACCAAAAAGTCGAAGAAATGCTTATCTCATCCATTAAGGAGAAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAATTTTTATTCTGTGTTACTAATTATTTTAACCATTTTGTGCAATAGAATCTACATTGCAGATATTAAAGTGCCATATTCCTGACACCAAAGGTTCTACAGTTCCACGTCTCTTTTTGATCTGCGCTGCGCTTTGTTTACTGGCAGCATGCAGCATGGCAAGATCAGATAAAATAAACACTAAAAGGGTTACAACACTATTACTGTGAATTTTATAGGGAGGTGAAAAGGAACACATATATGCTTCCCCCCAAATTACCTGAAAGGACCACAATATGTTAGAATATCTTTTCCATTAGGTTAATGTCTGTGTAGTACTCAATTACAATGGACGAAATCAATAAAATCTGATTCTGTCTCCTAAAAAAAAAAAAAxxAxxxACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTT
                                                      consensus depths                                                                                                                                                                                                                            6     9     6     9     8    11     9    12    11    13    13    15    13    15    13    15    13    15    13    15    14    15    14    15    14    15    14    15    14    16    14    16    14    16    14    16    14    17    14    17    16    19    17    19    18    20    21    23    21    23    20    23    21    23    21    23    21    23    21    23    21    23    22    24    22    24    22    24    20    25    20    25    21    26    23    28    23    28    23    28    23    28    23    28    23    28    23    28    23    28    24    29    24    28    24    29    25    29    25    30    24    28    23    28    25    29    24    28    24    29    24    29    24    29    26    30    26    30    26    31    27    32    26    30    25    29    22    29    20    28    23    28    23    27    23    27    21    25    21    25    21    25    20    24    20    24    20    23    18    21    17    20    17    20    18    21    18    20    18    20    18    20    18    20    18    20    18    20    18    20    16    20    12    19    12    19    12    18     8    13     7    11     7    12     7    12     6    12     6    12     6    12     6    12     4     9     4     9     4     9     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     3     7     5     7     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   2  SIG                                     Xt7.1-CAAJ16702.3                                                                                                                                                                                                                 CTGAGACTTCCGCAACCCGCTGTACAGAGTTCCTGCTGTATTTATCTCACAGCGCACAGGTGATAATGGAGGACCAGTGGCAAGAGAGCATGGATTTTGCTATTTTGATAGCCAGAAAGGCAGGCTCAGTGGTGTGTGCGGCACTAAAGGAAGATGTTTCCATAATGGTTAAAAGTTCCCCTGCAGATCTGGTGACAGCCACAGACCAAAAAGTCGAAGAAATGCTTATCTCATCCATTAAGGAGAAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAATTTTTATTCTGTGTTACTAATTATTTTAACCATTTTGTGCAATAGAATCTACATTGCAGATATTAAAGTGCCATATTCCTGACACCAAAGGTTCTACAGTTCCACGTCTCTTTTTGATCTGCGCTGCGCTTTGTTTACTGGCAGCATGCAGCATGGCAAGATCAGATAAAATAAACACTAAAAGGGTTACAACACTATTACTGTGAATTTTATAGGGAGGTGAAAAGGAACACATATATGCTTCCCCCCAAATTACCTGAAAGGACCACAATATGTTAGAATATCTTTTCCATTAGGTTAATGTCTGTGTAGTACTCAATTACAATGGACGAAATCAATAAAATCTGATTCTGTCTCCTAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CCAX2877.5                                                                                                                                                                                                                                                                                                                                                                                            GAAATACCCAGCTCCTGCAGCCACTGACTCCTCGCCAATAAAACTGTGTGATGGGTATTTCTCCTTAATGGATGAGATAAGCATTACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAATATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCGTTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGGGGCTGTTTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAATTTTTATTCTGTGTTACTAATTATTTTAACCATTTTGTGCAATAGAATTTACATTGCGGATATTAAAGTGCCATATTCCAAAGGTTTAAAAAAAAAAAAAAAAAAAAAAAATAAAA
  5   1   2  SIG                                       Xt7.1-XZT3182.3                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCATTAAGGAGAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTAGATATGTAGTATTATTTGCTGATTGGATGATTTGTAAAGAGCTGTCACAGAAACAAACAAGGCATCTCAGGCTGCTCCTGGGAGCCTCTACACAGATTCTACAAGGGGGCTGTGTTATCCCTAGCTGCATAAAGTCAATTCTGGGTGCTGGACAGTTTTATGGTTAATAAAAAAAAAATGCAATAAAACATTACACACAAATGTCTGTATGTACAGTTACAGGGAGAACAGTCTGATACCTGTACATATTTTTATTTTAAGTTGCATAAGGAACATAACTTTTTTCATTGTGCTTCCAGTATATTTTTTTCTAATATACCTTTCTACACTTCTACTTGCTGCAATTAATCATAATTTCAGATGTGTAGATGTATAGACTGCATATGCTCTTGTTTCAAGCCAAGTAATACCAGCAGGTTTCATGTATCTGGAGACAAGACTTTTTTGGGCAAAGGAGCACTGATTTCTGCCTTCACACATAAGCACAGAGCACTTACATCCCTCACTTGCACTGAAATTGTGTCAATGTACTCAAAGGGGTAGATTTATCAAAATGTGAATTCGAGCTCACCACAGAAAAACTCACCCACTTCCTGTTTATTCCTATGGGATCTTTAGAAGCATATATATATATATATATCAGTGGGTGAAAGTGAGAG------------TTGCTAACATTGCTGGTTTATGTGCATTGGGCATGGTGTATTCCGATGTTATTCTGTTTCTGCTGTTCTTTCTCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGTTTACTTTTGTAAGTAATTGTTAGTTAAAGTCCCTAAACTTGACTGTTTTACCACCCTGACTGTCCCTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCCTCATAGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCAGATAGGTAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGCAAACAGCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTTATTAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTATGCATAAAGCATTGGAATTAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                   ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----A-------
                                               BLH ATG      59     521                                                                                                                                                                                                                       
                                               BLH MIN      35     116                                                                                                                                                                                                                       
                                               BLH MPR      35     116                                                                                                                                                                                                                       
                                               BLH OVR      59      68                                                                                                                                                                                                                       
                                               EST CLI      -6      38                                                                                                                                                                                                                       
                                               ORF LNG      59       4                                                                                                                                                                                                                       
                                                                                                                                                                                                                                                                                                                                               PREDICTED - Sp ---- 1e-011     XP_001177897.1 PREDICTED: similar to biphosphate nucleotidase isoform 1 [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Sc ---- 9e-039     NP_011912.1 inositol monophosphatase; Inm1p [Saccharomyces cerevisiae] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ==== 3e-039     NP_492064.2 inositol monophosphatase (23.3 kD) (1H878) [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                PROTEIN === Dm ==== 2e-066     NP_649294.1 CG9391-PA [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Dr ==== 1e-108     XP_701403.1 PREDICTED: hypothetical protein XP_696311 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Mm ==== 2e-123     NP_061352.2 Inositol (myo)-1(or 4)-monophosphatase 1; lithium-sensitive myo-inositolmonophosphatase A1 [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Hs ==== 3e-129     NP_005527.1 inositol(myo)-1(or 4)-monophosphatase 1 [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Gg ==== 3e-130     XP_418310.2 PREDICTED: hypothetical protein [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Xl ==== 6e-151     AAH54268.1 Unknown (protein for MGC:64501) [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                        PROTEIN === ?? ==== 6e-151     NP_001080635.1 inositol(myo)-1(or 4)-monophosphatase 1 [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Xt ==== 8e-158     AAI21540.1 Hypothetical protein LOC549811 [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CAAJ16702.3.5                                                                                                                                                                                                                                                                                  ATG---------------------ATG------------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------ATG------------ATG------------------------------------------------------------ATG---------------------------------------ATG------------------ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------TGA---------------TAG---------------------------TAA------------TAG------ATG------------TAA---------------------ATG---------------------------------TAA------------------------------------------------TAA------TAA---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------TGA------TAG------------------------------------------TGA------------ATG------------------TAG------------------------------------------TAA------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------TGA---------------TAG---------------------------TAA------------TAG------ATG------------TAA---------------------ATG---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  5   1   2  SIG                                     Xt7.1-CAAJ16702.3                                                                                                                                                                                                                 CTGAGACTTCCGCAACCCGCTGTACAGAGTTCCTGCTGTATTTATCTCACAGCGCACAGGTGATAATGGAGGACCAGTGGCAAGAGAGCATGGATTTTGCTATTTTGATAGCCAGAAAGGCAGGCTCAGTGGTGTGTGCGGCACTAAAGGAAGATGTTTCCATAATGGTTAAAAGTTCCCCTGCAGATCTGGTGACAGCCACAGACCAAAAAGTCGAAGAAATGCTTATCTCATCCATTAAGGAGAAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAATTTTTATTCTGTGTTACTAATTATTTTAACCATTTTGTGCAATAGAATCTACATTGCAGATATTAAAGTGCCATATTCCTGACACCAAAGGTTCTACAGTTCCACGTCTCTTTTTGATCTGCGCTGCGCTTTGTTTACTGGCAGCATGCAGCATGGCAAGATCAGATAAAATAAACACTAAAAGGGTTACAACACTATTACTGTGAATTTTATAGGGAGGTGAAAAGGAACACATATATGCTTCCCCCCAAATTACCTGAAAGGACCACAATATGTTAGAATATCTTTTCCATTAGGTTAATGTCTGTGTAGTACTCAATTACAATGGACGAAATCAATAAAATCTGATTCTGTCTCCTAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008290874                                                                                                                                                                                                                       CTTCCGCAACCCGCTGTACAGAGTTCCTGCTGTATTTATCTCACAGCGCACAGGTGATAATGGAGGACCAGTGGCAAGAGAGCATGGATTTTGCTATTTTGATAGCCAGAAAGGCAGGCTCAGTGGTGTGTGCGGCACTAAAGGAAGATGTTTCCATAATGGTTAAAAGTTCCCCTGCAGATCTGGTGACAGCCACAGACCAAAAAGTCGAAGAAATGCTTATCTCATCCATTAAGGAGAAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAATTTTTATTCTGTGTTACTAATTATTTTAACCATTTTGTGCAATAGAATCTACATTGCAGATATTAAAGTGCCATATTCCTGACACCAAAGGTTCTACAGTTCCACGTCTCTTTTTGATCTGCGCTGCGCTTTGTTTACTGGCAGCATGCAGCATGGCAAGATCAGATAAAATAAACACTAAAAGGGTTACAACACTATTACTGTGAATTTTATAGGGAGGTGAAAAGGAACACATATATGCTTCCCCCCAAATTACCTGAAAGGACCACAATATGTTAGAATATCTTTTCCATTAGGTTAATGTCTGTGTAGTACTCAATTACAATGGACGAAATCAATAAAATCTGATTCTGTCTCCTAAAAAAAAAAAAA
  0   1   1           Gas  FL                     TGas051k15.FL-Sanger                                                                                                                                                                                                                 CTGAGACTTCCGCAACCCGCTGTACAGAGTTCCTGCTGTATTTATCTCACAGCGCACAGGTGATAATGGAGGACCAGTGGCAAGAGAGCATGGATTTTGCTATTTTGATAGCCAGAAAGGCAGGCTCAGTGGTGTGTGCGGCACTAAAGGAAGATGTTTCCATAATGGTTAAAAGTTCCCCTGCAGATCTGGTGACAGCCACAGACCAAAAAGTTGAAGAAATGCTTATCTCATCCATTAAGGAGAAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACAGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAATTTTTATTCTGTGTTACTAATTATTTTAACCATTTTGTGCACTAGAATCTACATTGCGGATATTAAAGTGCCATATTCCTGACACCAAAAAAAAAAAAAAAAAA
  0   1   1           Ovi1 FL                         CABI12511.FL-MGC                                                                                                                                                                                                                                                             TCTCACAGCGCACAGGTGATAATGGAGGACCAGTGGCAAGAGAGCATGGATTTTGCTATTTTGATAGCCAGAAAGGCAGGCTCAGTGGTGTGTGCGGCACTAAAGGAAGATGTTTCCATAATGGTTAAAAGTTCCCCTGCAGATCTGGTGACAGCCACAGACCAAAAAGTCGAAGAAATGCTTATCTCATCCATTAAGGAGAAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAATTTTTATTCTGTGTTACTAATTATTTTAACCATTTTGTGCAATAGAATCTACATTGCAGATATTAAAGTGCCATATTCCTGACACCAAAGGTTCTACAGTTCCACGTCTCTTTTTGATCTGCGCTGCGCTTTGTTTACTGGCAGCATGCAGCATGGCAAGATCAGATAAAATAAACACTAAAAGGGTTACAACACTATTACTGTGAATTTTATAGGGAGGTGAAAAGGAACACATATATGCTTCCCCCCAAATTACCTGAAAGGACCACAATATGTTAGAATATCTTTTCCATTAGGTTAATGTCTGTGTAGTACTCAATTACAATGGACGAAATCAATAAAATCTGATTCTGTCTCCTAAAAAAAAAAAAAA
  5   1   1       add Tbd1      in                        CBXT22744.b1 CAACAGGTTTGGCATTTAAACTTTATAGCCTCATATGAACACTCAGAGCTACATAACAGTTTGACAGCAACAAGTAAATCTTGGTCATTTTATTTAATTTTTGATTTTAATTATAATGACACAAGTAACATTTGCAAGTTATTGGGCATCACGGTACACATAACATCATTAGGCATCACATCATTATCATCACAGTACATAACATTTGTAGACACTTTCAAGTTATTCAGAATTAGCAGACTTTAGACTGAGTTGAGGTAGCACTGTTCTATTGTTTATGGGGCATGCTTTGAGCAAGACAAGGAATATTAGTGCTTAAGTAAGTGAGATTTCATTAAACTGTGAAAATTAAAAAAACAAATGCTTAACTGGTAGACTTTATTACACCTTAACCCCTAAAAGACTGGAACAAGTTATACAGACCTCAGTCATATGCAATATATATAATACTCTAATAAGATATCCAGTGTTCAGTCCATAAGGTTTTGCTGGACTTAGAATATACAAGTCATAGTATTTGCCATTTTATTTAAAGTGATAATGACACGAAAAAAACTACTTTTCAAAATATTAATGTACATAAAAAGTTACCTATATGTCATGTTGATCATTTTTCACAACCAGGTTTACTTTTGTAAGTAATTGTTAGTTAAAGTCCCTAAACTTGACTGTTTTACCACCCTGACTGTCCCTTCTCAGCCTGA
  5   1   2       ext Neu  5g3  in                   TNeu058b06.p1cSP6                                                                                                                                                                                                           GCAGAGCTGAGACTTCCGCAACCCGCTGTACAGAGTTCCTGCTGTATTTATCTCACAGCGCACAGGTGATAATGGAGGACCAGTGGCAAGAGAGCATGGATTTTGCTATTTTGATAGCCAGAAAGGCAGGCTCAGTGGTGTGTGCGGCACTAAAGGAAGATGTTTCCATAATGGTTAAAAGTTCCCCTGCAGATCTGGTGACAGCCACAGACCAAAAAGTTGAAGAAATGCTTATCTCATCCATTAAGGAGAAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACAGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGC
  5   1   2   14  ext Brn2 5g3  in                        CAAJ16702.5p ................................................................................................................................................................................................................CTGAGACTTCCGCAACCCGCTGTACAGAGTTCCTGCTGTATTTATCTCACAGCGCACAGGTGATAATGGAGGACCAGTGGCAAGAGAGCATGGATTTTGCTATTTTGATAGCCAGAAAGGCAGGCTCAGTGGTGTGTGCGGCACTAAAGGAAGATGTTTCCATAATGGTTAAAAGTTCCCCTGCAGATCTGGTGACAGCCACAGACCAAAAAGTTGAAGAAATGCTTATCTCATCCATTAAGGAGAAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACAGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCCTGGATGCACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCA
  5   1   3   12   nb Tad5 5g3  in                         XZT64272.5p ................................................................................................................................................................................................................CTGAGACTTCCGCAACCCGCTGTACAGAGTTCCTGCTGTATTTATCTCACAGCGCACAGGTGATAATGGAGGACCAGTGGCAAGAGAGCATGGATTTTGCTATTTTGATAGCCAGAAAGGCAGGCTCAGTGGTGTGTGCGGCACTAAAGGAAGATGTTTCCATAATGGTTAAAAGTTCCCCTGCAGATCTGGTGACAGCCACAGACCAAAAAGTCGAAGAAATGCTTATCTCATCCATTAAGGAGAAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGNCACA
  5   1   2   10  ext Tbd1 5g3  in                         CBXT1526.b1 ................................................................................................................................................................................................................CTGAGACTTCCGCAACCCGCTGTACAGAGTTCCTGCTGTATTTATCTCACAGCGCACAGGTGATAATGGAGGACCAGTGGCAAGAGAGCATGGATTTTGCTATTTTGATAGCCAGAAAGGCAGGCTCAGTGGTGTGTGCGGCACTAAAGGAAGATGTTTCCATAATGGTTAAAAGTTCCCCTGCAGATCTGGTGACAGCCACAGACCAAAAAGTCGAAGAAATGCTTATCTCATCCATTAAGGAGAAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCA
  5   1   3   10   nb Tbd1 5g3  in                          CBXT411.b1 ................................................................................................................................................................................................................CTGAGACTTCCGCAACCCGCTGTACAGAGTTCCTGCTGTATTTATCTCACAGCGCACAGGTGATAATGGAGGACCAGTGGCAAGAAAGCATGGATTTTGCTATTTTGATAGCCAGAAAGGCAGGCTCAGTGGTGTGTGCGGCACTAAAGGAAGATGTTTCCATAATGGTTAAAAGTTCCCCTGCAGATCTGGTGACAGCCACAGACCAAAAAGTCGAAGAAATGCTTATCTCATCCATTAAGGAGAAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAAATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCA
  5   1   3        nb Gas  FL   in                   TGas051k15.p1cSP6                                                                                                                                                                                                                  TGAGACTTCCGCAACCCGCTGTACAGAGTTCCTGCTGTATTTATCTCACAGCGCACAGGTGATAATGGAGGACCAGTGGCAAGAGAGCATGGATTTTGCTATTTTGATAGCCAGAAAGGCAGGCTCAGTGGTGTGTGCGGCACTAAAGGAAGATGTTTCCATAATGGTTAAAAGTTCCCCTGCAGATCTGGTGACAGCCACAGACCAAAAAGTTGAAGAAATGCTTATCTCATCCATTAAGGAGAAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACAGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATC
  5   1   2   20  add Mus1 5g                              CABH7466.5p ...................................................................................................................................................................................................................CCATCGATTCAATCGGCACGAGGCACACATGGCTATATTAGTGTCATTGAATTCGGGTGATAATGGAGGACCAGTGGCAAGAGAGCATGGATTTTGCTATTTTGATAGCCAGAAAGGCAGGCTCAGTGGTGTGTGCGGCACTAAAGGAAGATGTTTCCATAATGGTTAAAAGTTCCCCTGCAGATCTGGTGACAGCCACAGACCAAAAAGTCGAAGAAATGCTTATCTCATCCATTAAGGAGAAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAATACCAAC
  5   1   2       add In54 5x3                        IMAGE:8942759.5p                                                                                                                                                                                                                     AAATAGTTAAACAGAAGATATAATCGATTCGAATTCGTCCCCTCACAGCGCACAGGTGATAATGGAGGACCAGTGGCAAGAGAGCATGGATTTTGCTATTTTGATAGCCAGAAAGGCAGGCTCAGTGGTGTGTGCGGCACTAAAGGAAGATGTTTCCATAATGGTTAAAAGTTCCCCTGCAGATCTGGTGACAGCCACAGACCAAAAAGTCGAAGAAATGCTTATCTCATCCATTAAGGAGAAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGAGTTGTCCTGGATGCAACAGAGGAGCATTTGACCTGATGTCCTGCAGGTAATAGCAGCTAGCAGCAGAGGATATAGCTGACGATAGCTAGGAGCTACAGATATATACCCTTGAACGAGATGATGGCCAAATACCACTGATTCCAGTTAGCTAGGTGGCTGTCTAAATTTTTGCACAGTTATTTAATGTAAG
  5   1   3        nb TpA  5g                        TTpA029m09.p1kSP6                                                                                                                                                                                                                                     CTGTACGAGTTCCTGCTGTATTTATCTCACAGCGCACAGGTGATAATGGAGGACCAGTGGCAAGAGAGCATGGATTTTGCTATTTTGATAGCCAGAAAGGCAGGCTCAGTGGTGTGTGCGGCACTAAAGGAAGATGTTTCCATAATGGTTAAAAGTTCCCCTGCAGATCTGGTGACAGCCACAGACCAAAAAGTCGAAGAAATGCTTATCTCATCCATTAAGGAGAAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGNTAATAGCAGCTAGC
  5   1   3        nb BrSp 5g3  in                     EC2BBA24BD03.g1                                                                                                                                                                                                                                       GGGAGAGTTCCTGCTGTATTTATCTCACAGCGCACAGGTGATAATGGAGGACCAGTGGCAAGAGAGCATGGATTTTGCTATTTTGATAGCCAGAAAGGCAGGCTCAGTGGTGTGTGCGGCACTAAAGGAAGATGTTTCCATAATGGTTAAAAGTTCCCCTGCAGATCTGGTGACAGCCACAGACCAAAAAGTCGAAGAAATGCTTATCTCATCCATTAAGGAGAAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTGTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGC
  5   1   2       add Te5       in                        CAAO11254.5p                                                                                                                                                                                                                                                    ATTTATCTCACAGCGCACAGGTGATAATGGAGGACCAGTGGCAAGAGAGCATGGATTTTGCTATTTTGATAGCCAGAAAGGCAGGCTCAGTAGGTGGTGTGTGCGGCACTAAAGGAAGATGTTTCCATAATGGTTAAAAGTTCCCCTGCAGATCTGGTGACAGCCACAGACCAAAAAGTTGAAGAAATGCTTATCTCATCCATTAAGGAGAAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACAGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTA
  5   1   4      seed Ovi1 FL   in                        CABI12511.5p                                                                                                                                                                                                                                                             TCTCACAGCGCACAGGTGATAATGGAGGACCAGTGGCAAGAGAGCATGGATTTTGCTATTTTGATAGCCAGAAAGGCAGGCTCAGTGGTGTGTGCGGCACTAAAGGAAGATGTTTCCATAATGGTTAAAAGTTCCCCTGCAGATCTGGTGACAGCCACAGACCAAAAAGTCGAAGAAATGCTTATCTCATCCATTAAGGAGAAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGNATTTCCAGT
  5   1   2       ext TpA  5g3  in                   TTpA059f19.p1kSP6                                                                                                                                                                                                                                                                             TGATAATGGAGGACCAGTGGCAAGAGAGCATGGATTTTGCTATTTTGATAGCCAGAAAGGCAGGCTCAGTGGTGTGTGCGGCACTAAAGGAAGATGTTTCCATAATGGTTAAAAGTTCCCCTGCAGATCTGGTGACAGCCACAGACCAAAAAGTCGAAGAAATGCTTATCTCATCCATTAAGGAGAAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAACAGGGGGGGAGTTGTNNCCTGGATGCACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGA
  5   1   2       ext Gas8 5g3  in                          st12o06.5p                                                                                                                                                                                                                                                                                 AATGGAGGACCAGTGGCAAGAGAGCATGGATTTTGCTATTTTGATAGCCAGAAAGGCAGGCTCAGTGGTGTGTGCGGCACTAAAGGAAGATGTTTCCATAATGGTTAAAAGTTCCCCTGCAGATCTGGTGACAGCCACAGACCAAAAAGTCGAAGAAATGCTTATCTCATCCATTAAGGAGAAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCA
  3   1   2       add TbA       in                    TTbA065l09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                               ATATGCAATATATATAATACTCTAATAAGATATCCAGTGTTCAGTCCATAAGGTTTTGCTGGACTTAGAATATACAAGTCATAGTATTTGCCATTTTATTTAAAGTGATAATGACACGAAAAAAActacttttcaaaatattaatgtacataaaaagttacctatatgtcatgttgatcatttttcacaaccaggtttacttttgtaagtaattgttagttaaagtccctaaacttgactgttttaccaccctgactgtcccttctcagcctgacagttatagcttctaatgcttacggcctcctgctgcacaaatatggtagccccctcatagaagaacatggggaatcagataggtaatgtaaaagcatccggcaaaCAGCAATGTTTTGATATATTTATTAAAAAAAAATAATTTTTGGTGTCAGTATCTCTTTAAATAAATAGTTGTGTTAGTAACTATTCCTTATACAATCTTAAATGTGGATTGTAGTATGCATAAAGCATTGGAATTATTGTGGAGTATGGGCAGTAACTCATGTTTGCTTGTTGGTTTTGCAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTGTTATACTCAAAAAAAAAAAAAAAAAAGCGCC
  3   1   2       ext Brn2 5g3  in                        CAAJ16702.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACAGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTC
  3   1   2       ext Neu  5g3  in                    TNeu058b06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACAGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATGATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACACCAAGTGAGGTTTAAGGAAACCAAGTAAACCCAGTTTGTATACTCAAAACCCGGGG
  3   1   2       ext Gas8 5g3  in                          st12o06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAAC
  3   1   2       add Te5       in                        CAAO11254.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCAGTGGCTGCAGGAGCTGGAAGCACGCTACAAGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTC
  5   1   3        nb Tad5                                 XZT61561.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTTTTTTTCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACANAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAATTTTTATTCTGTGTTACTAATTATTTTAACCATTTTGTGCAATAGAATCTACATTGCAGATATTANAGTGCCATATTCCTGACACCAAAAAAAAAAAAAAAAA
  3   1   2       add Tbd1      in                        CBXT22744.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCACAACCAGGTTTACTTTTGTAAGTAATTGTTAGTTAAAGTCCCTAAACTTGACTGTTTTACCACCCTGACTGTCCCTTCTCAGCCTGACAGTTATAGCTTCTAATGCTTACGGCCTCCTGCTGCACAAATATGGTAGCCCCCTCATAGAAGAACATGGGGAATCAGATAGGTAATGTAAAAGCATCCGGCAAACAGCAATGTTTTGATATATTTATTAAAAAAAAATAATTTTTGGTGTCAGTATCTCTTTAAATAAATAGTTGTGTTAGTAACTATTCCTTATACAATCTTAAATGTGGATTGTAGTATGCATAAAGCATTGGAATTATTGTGGAGTATGGGCAGTAACTCATGTTTGCTTGTTGGTTTTGCAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAAAAAAAAAAAAAAA
  5   1   0       chi TbA       in                   TTbA065l09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAACTCCCTTTGCGCCAAGTGTAATCACTGTGTATTTTGTATGTTGATGGGTGCATTTGACATCTATTAGTGTGTGTGTGTGTAGCACTTGTGCCCTTTCATTCATAAATGAATCCTACAGAGTTTTCCTCCCTTCAGTACACTGGGCACTTGCATGACAGTGACATACTTTTTTTAAACTTTCAGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGTTTGGCATTTAAACTTTATAGCACCATATGAACACTCAGAGCTACATAACAGTTTGACAGCAACAAGTAAATCTTCGTCATTTTATTTAATTTTTGATTTTAATTATAATGACACAAGTAACATTTGCAAGTTATTGGGCATCACGGTACACATAACATCATTAGGCATCACATCATTATCTGTAGACACTTTCAAGTTATTCAGAATAAGCAGCCTTTAGACTGAGTTGAGGTAGCACTGTCCTATTGTTTATGGGGCATGCTTTGAGCAAGACAAGGAATATTAGCGCTCAAGTAAGTGGATTTCATTAAACTGTGAAAATTAAAAAAACAAATGCTTAACTGGTAGACCTTATTACACCTTAACCCCTAAAGGACTGGAACAAGTTATACAGACCTCAGTCATATGCAATATATATAATACTCTAATAAGATATCCAGTGTTCAGTCCATAAGGTTTTGCTGGACTTAGAATATACAAGTCATAGTATTTGCCATTTTATTTAAAGTGATAATGACACGAANAAAACTACTTTTCANAATATTAATGTACA
  3   1   3        nb BrSp 5g3  in                     EC2BBA24BD03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAATGGTCAAAAATTACAAGTGTCAGGACAGAAAGATATTACCAAATCCATGATAATTAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAATTTTTATTCTGTGTTACTAATTATTTTAACCATTTTGTG
  3   1   0       chi HdA       out                  THdA008n03.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTAGCCCCCTCATAGAAGAACAGGGGGAATCAGATAGGTAATGTAAAAGCTTCCGGCAAACAGCAAGGTTTTGATATATTTATTAAAAAAAAAAAATTTTGGGGGCCAGTATCTCTTAAAAAAAATAGTGGGGTTGGAAACTATTCCTTATACAATCTAAAATGGGGATTGTAGTATGCATAAAGCATTGGAATTATTGGGGAGTATGGGCAGAAACCCATGTTTGCTTGTGGGTTTTCCGGGAGGAGCTTTTCACCGGATGTCCTCCAGGGTAAAAGCAGATCCCAGCAGAGATAGAGGTGAGGGAAAAGGTAAGGCGGTACAGATTACACCCCGGGAAGGCATTTTTGGAAAAAAATCCAAATAAATTACCGCTTTACAGTGGGGTGCCCTGCAATTTTCACACATACCCTAATAAACGTAGGTCTAAATAAGGGGGTCTAATCACCCTAAGTGAAGCCCAATCATACAAGCACCTCTTTGCTGTTTATCTTCCCCAGTATATGGTGTGTGGGTTCCGCGAGATTTAACGGGTTACAATCTAAATAAAAGAAACCTGCCAGTAAAAAAAAAAAAAAAAAAAG
  3   1   4      seed Ovi1 FL   in                        CABI12511.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAATTTTTATTCTGTGTTACTAATTATTTTAACCATTTTGTGCAATAGAATCTACATTGCAGATATTAAAGTGCCATATTCCTGACACCAAAGGTTCTACAGTTCCACGTCTCTTTTTGATCTGCGCTGCGCTTTGTTTACTGGCAGCATGCAGCATGGCAAGATCAGATAAAATAAACACTAAAAGGGTTACAACACTATTACTGTGAATTTTATAGGGAGGTGAAAAGGAACACATATATGCTTCCCCCCAAATTACCTGAAAGGACCACAATATGTTAGAATATCTTTTCCATTAGGTTAATGTCTGTGTAGTACTCAATTACAATGGACGAAATCAATAAAATCTGATTCTGTCTCCTAAAAAAAAAAAAAA
  3   1   3        nb Gas  FL   in                    TGas051k15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACTTTTTAAGGAAACCGAGTAAACGGTTTGTTATACTCAATTTTTATTCTGTGTTACTAATTATTTTAACCATTTTGTGCACTAGAATCTACTTTGCGGATATTAAAGTGCCATATTCCCGACACCCAAAAAAAAAAAAAAAAA
  3   1   3        nb Tad5 5g3  in                         XZT64272.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAATTTTTATTCTGTGTTACTAATTATTTTAACCATTTTGTGCAATAGAATCTACATTGCAGATATTAAAGTGCCATATTCCTGACACCAAAGGTTCTACAGTTCCACGTCTCTTTTTGATCTGCGCTGCGCTTTGTTTACTGGCAGCATGCAGCATGGCAAGATCAGATAAAATAAACACTAAAAGGGTTACAACACTATTACTGTGAATTTTATAGGGAGGTGAAAAGGAACACATATATGCTTCCCCCCAAATTACCTGAAAGGACCACAATATGTTAGAATATCTTTTCCATTAGGTTAATGTCTGTGTAGTACTCAATTACAATGGACGAAATCAATAAAATCTGATTCTGTCTCCT
  3   1   3        nb Tbd1 5g3  in                          CBXT411.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAATTTTTATTCTGTGTTAATAATTATTTTAACCATTTTGTGCAATAGAATTTACATTGCAGATATTAAAGTGCCATATTCCTGACACCAAAGGTTTTACAGTTCCACGTTTCTTTTTGATTTGCGCTGCGCTTTGTTTACTGGCAGCATGCAGCATGGCAAGATCAGATAAAATAAACACTAAAAGGGTTACAACACTATTACTGTGAATTTTATAGGGAGGTGAAAAGGAACACATATATGCTTCCCCCCAAATTACCTGAAAGGACCACAATATGTTAGAATATTTTTTCCATTAGGTTAATGTTTGTGTAGTACTCAATTACAAAGGAAGAAATCAATAAAATTTGATTCTGTTTCCTAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAA
  3   1   2       ext Tbd1 5g3  in                         CBXT1526.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTTTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAATTTTTATTTTGTGTTACTAATTATTTTAACCATTTTGTGCAATAGAATTTACATTGCAGATATTAAAGTGCCATATTCCTGACACCAAAGGTTTTACAGTTCCACGTCTCTTTTTGATTTGCGCTGCGCTTTGTTTACTGGCAGCATGCAGCATGGCAAGATCAGATAAAATAAACACTAAAAGGGTTACAACACTATTACTGTGAATTTTATAGGGAGGTGAAAAGGAACACATATATGCTTCCCCCCAAATTACCTGAAAGGACCACAATATGTTAGAATATCTTTTCCATTAGGTTAATGTCTGTGTAGTACTCAATTACAATGGACGAAATCAATAAAATTTGATTCTGTTTCCTAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAA
  3   1   2       ext TpA  5g3  in                    TTpA059f19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAATTTTTATTCTGTGTTACTAATTATTTTAACCATTTTGTGCAATAGAATCTACATTGCAGATATTAAAGTGCCATATTCCTGACACCAAAGGTTCTACAGTTCCACGTCTCTTTTTGATTTGCGCTGCGCTTTGTTTACTGGCAGCATGCAGCATGGCAAGATCAGATAAAATAAACACTAAAAGGGTTACAACACTATTACTGTGAATTTTATAGGGAGGTGAAAAGGAACACATATATGCTTCCCCCCAAATTACCTGAAAGGACCACAATATGTTAGAATATCTTTTCCATTAGGTTAATGTCTGTGTAGTACTCAATTACAATGGACGAAATCAATAAAATCTGATTCTGTCTCCTAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext Tad5                                 XZT41819.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAATTTTTATTCTGTGTTACTAATTATTTTAACCATTTTGTGCAATAGAATCTACATTGCAGATATTAAAGTGCCATATTCCTGACACCAAAGGTTCTACAGTTCCACGTCTCTTTTTGATCTGCGCTGCGCTTTGTTTACTGGCAGCATGCAGCATGGCAAGATCAGATAAAATAAACACTAAAAGGGTTACAACACTATTACTGTGAATTTTATAGGGAGGTGAAAAGGAACACATATATGCTTCCCCCCAAATTACCTGAAAGGACCACAATATGTTAGAATATCTTTTCCATTAGGTTAATGTCTGTGTAGTACTCAATTACAATGGACGAAATCAATAAAATCTGATTCTGTCTCCTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  5   1   2  SIG                                      Xt7.1-CCAX2877.5                                                                                                                                                                                                                                                                                                                                                                                            GAAATACCCAGCTCCTGCAGCCACTGACTCCTCGCCAATAAAACTGTGTGATGGGTATTTCTCCTTAATGGATGAGATAAGCATTACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAATATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCGTTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGGGGCTGTTTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAATTTTTATTCTGTGTTACTAATTATTTTAACCATTTTGTGCAATAGAATTTACATTGCGGATATTAAAGTGCCATATTCCAAAGGTTTAAAAAAAAAAAAAAAAAAAAAAAATAAAA
                                                  Xt7.1-CHK-1008290880                                                                                                                                                                                                                                                                                                                                                                                                  CCCAGCTCCTGCAGCCACTGACTCCTCGCCAATAAAACTGTGTGATGGGTATTTCTCCTTAATGGATGAGATAAGCATTACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAATATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCGTTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGGGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAATTTTTATTCTGTGTTACTAATTATTTTAACCATTTTGTGCAATAGAATTTACATTGCGGATATTAAAGTGCCATATTCCAAAGGTTTAAAAAAAAAAAAAAAAAAAAAAAATAAAAAAAAAA
  5   1   2       ext Eye       in                         CCAX2877.b1                                                                                                                                                                                                                                                                                                                                                                                            GAAATACCCAGCTCCTGCAGCCACTGACTCCTCGCCAATAAAACTGTGTGATGGGTATTTCTCCTTAATGGATGAGATAAGCATTACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAATATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCA
  3   1   2       ext Eye       in                         CCAX2877.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAATATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAATTTTTA
  5   1   4      seed Tbd1      in                         CBXT7236.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCGTTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGGGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAATTTTTATTCTGTGTTACTAATTATTTTAACCATTTTGTGCAATAGAATCTACATTGCGGATATTAAAGTGCCATATTCCAAAGGTTTATA
  3   1   4      seed Tbd1      in                         CBXT7236.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTTTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCGTTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGGGGCTGTTTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTCAATTTTTATTCTGTGTTACTAATTATTTTAACCATTTTGTGCAATAGAATTTACATTGCGGATATTAAAGTGCCATATTCCAAAGGTTTAAAAAAAAAAAAAAAAAAAAAAAATAAAAAAAAAAAAAAA
  5   1   2  SIG                                       Xt7.1-XZT3182.3                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCATTAAGGAGAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTAGATATGTAGTATTATTTGCTGATTGGATGATTTGTAAAGAGCTGTCACAGAAACAAACAAGGCATCTCAGGCTGCTCCTGGGAGCCTCTACACAGATTCTACAAGGGGGCTGTGTTATCCCTAGCTGCATAAAGTCAATTCTGGGTGCTGGACAGTTTTATGGTTAATAAAAAAAAAATGCAATAAAACATTACACACAAATGTCTGTATGTACAGTTACAGGGAGAACAGTCTGATACCTGTACATATTTTTATTTTAAGTTGCATAAGGAACATAACTTTTTTCATTGTGCTTCCAGTATATTTTTTTCTAATATACCTTTCTACACTTCTACTTGCTGCAATTAATCATAATTTCAGATGTGTAGATGTATAGACTGCATATGCTCTTGTTTCAAGCCAAGTAATACCAGCAGGTTTCATGTATCTGGAGACAAGACTTTTTTGGGCAAAGGAGCACTGATTTCTGCCTTCACACATAAGCACAGAGCACTTACATCCCTCACTTGCACTGAAATTGTGTCAATGTACTCAAAGGGGTAGATTTATCAAAATGTGAATTCGAGCTCACCACAGAAAAACTCACCCACTTCCTGTTTATTCCTATGGGATCTTTAGAAGCATATATATATATATATATCAGTGGGTGAAAGTGAGAG------------TTGCTAACATTGCTGGTTTATGTGCATTGGGCATGGTGTATTCCGATGTTATTCTGTTTCTGCTGTTCTTTCTCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATA
                                                  Xt7.1-CHK-1008290878                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGAGAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTAGATATGTAGTATTATTTGCTGATTGGATGATTTGTAAAGAGCTGTCACAGAAACAAACAAGGCATCTCAGGCTGCTCCTGGGAGCCTCTACACAGATTCTACAAGGGGGCTGTGTTATCCCTAGCTGCATAAAGTCAATTCTGGGTGCTGGACAGTTTTATGGTTAATAAAAAAAAAATGCAATAAAACATTACACACAAATGTCTGTATGTACAGTTACAGGGAGAACAGTCTGATACCTGTACATATTTTTATTTTAAGTTGCATAAGGAACATAACTTTTTTCATTGTGCTTCCAGTATATTTTTTTCTAATATACCTTTCTACACTTCTACTTGCTGCAATTAATCATAATTTCAGATGTGTAGATGTATAGACTGCATATGCTCTTGTTTCAAGCCAAGTAATACCAGCAGGTTTCATGTATCTGGAGACAAGACTTTTTTGGGCAAAGGAGCACTGATTTCTGCCTTCACACATAAGCACAGAGCACTTACATCCCTCACTTGCACTGAAATTGTGTCAATGTACTCAAAGGGGTAGATTTATCAAAATGTGAATTCGAGCTCACCACAGAAAAACTCACCCACTTCCTGTTTATTCCTATGGGATCTTTAGAAGCATATATATATATATATATCAGTGGGTGAAAG------------------------ACATTGCTGGTTTATGTGCATTGGGCATGGTGTATTCCGATGTTATTCTGTTTCTGCTGTTCTTTCTCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTT
  5   1   2       ext Tad5      in                          XZT3182.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCATTAAGGAGAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTAGATATGTAGTATTATTTGCTGATTGGATGATTTGTAAAGAGCTGTCACAGAAACAAACAAGGCATCTCAGGCTGCTCCTGGGAGCCTCTACACAGATTCTACAAGGGGGCTGTGTTATCCCTAGCTGCATAAAGTCAATTCTGGGTGCTGGACAGTTTTATGGTTAATAAAAAAAAAATGCAATAAAACATTACACACAAATGTCTGTATGTACAGTTACAGGGAGAACAGTCTGATACCTGTACATATTTTTATTTTAAGTTGCATAAGGAACATAACTTTTTTCATTGTGCTTCCAGTATATTTTTTTCTAATATACCTTTCTACACTTCTACTTGCTGCAATTAATCATAATTTCAGATGTGTAGATGTATAGACTGCATATGCTCTTGTTTCAAGCCAAGTAATACCAGCAGGTTTCATGTATCTGGAGACAAGACTTTTTTGGGCAAAGGAGCACTGATTTCTGCCTTCACACATAAGCACAGAGCACTTACATCCCTCACTTGCACTGAAATTGTGTCAATGTACTCAAaggggtagatttatcaaaatgtgaattcgagctcaccacagaaaaactcacccacttcctgtttattcctatgggatctttagaagCATATATATATATATATATCAGTGGGTGAAAGTGAGAGTT
  5   1   4      seed Tad5      in                          XZT3181.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATTAAGGAGAATACCCATCACACAGTTTTATTGGCGAGGAGTCAGTGGCTGCAGGAGCTGGAAGCACGCTAACGGATAATCCAACCTGGATCATAGATCCCATAGATGGCACAACAAACTTTGTACACAGATTTCCATTTGTGGCTGTGTCCATTGGATTTGCTGTGAACAAGCAGGTAGATATGTAGTATTATTTGCTGATTGGATGATTTGTAAAGAGCTGTCACAGAAACAAACAAGGCATCTCAGGCTGCTCCTGGGAGCCTCTACACAGATTCTACAAGGGGGCTGTGTTATCCCTAGCTGCATAAAGTCAATTCTGGGTGCTGGACAGTTTTATGGTTAATAAAAAAAAAATGCAATAAAACATTACACACAAATGTCTGTATGTACAGTTACAGGGAGAACAGTCTGATACCTGTACATATTTTTATTTTAAGTTGCATAAGGAACATAACTTTTTTCATTGTGCTTCCAGTATATTTTTTTCTAATATACCTTTCTACACTTCTACTTGCTGCAATTAATCATAATTTCAGATGTGTAGATGTATAGACTGCATATGCTCTTGTTTCAAGCCAAGTAATACCAGCAGGTTTCATGTATCTGGAGACAAGACTTTTTTGGGCAAAGGAGCACTGATTTCTGCCTTCACACATAAGCACAGAGCACTTACATCCCTCACTTGCACTGAAATTGTGTCAATGTACTCAAaggggtagatttatcaaaatgtgaattcgagctcaccacagaaaaactcacccacttcctgtttattcctatgggatctttagaagCATATATATATATATATATCAGTGG
  3   1   2       ext Tad5      in                          XZT3182.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGCTAACATTGCTGGTTTATGTGCATTGGGCATGGTGTATTCCGATGTTATTCTGTTTCTGCTGTTCTTTCTCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTGTTATACTC
  3   1   4      seed Tad5      in                          XZT3181.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATGGTGTATTCTGATGTTATTCTGTTTCTGCTGTTCTTTCTCAGGTTGAATTTGGAGTTGTTTACAGCTGTGTGGAAGATAAAATGTACACTGGAAGAAAGGGAAAAGGGGCATTTTGTAATGGTCAAAAATTACAAGTCTCAGGACAGAAAGATATTACCAAATCCATGATAATAACAGAACTGGGATCAAATCGGAATCCAGAGGTTATTAAAATGGTGCTGTCTAACATGGAGAGACTGCTGTGCATTCCCATCCACGGGATTAGAGCAGTTGGTACAGCAGCAGTAAACATGTGTCTCGTGGCCACTGGAGGTGCCGATGCTTATTATGAGATGGGGATCCACTGCTGGGATATGGCAGCTGCATCTGTCATCATTACAGAAGCAGGGGGAGTTGTCCTGGATGCAACAGGAGGAGCATTTGACCTGATGTCCTGCAGGGTAATAGCAGCTAGCAGCAGAGATATAGCTGAGCGAATAGCTAAGGAGCTACAGATTATACCCCTGGAACGAGATGATGGCAAAAATACCAACTGAATTTCCAGTTTTAGCTAGGGTGGCTGTCTAATTTTTGCACAGTATTAATTGAAGTATCTATAGATATTTATGGAATTATGTACATAAGTTTATGTATTATGTTCTGTAATGTGTTTTGTTTTTTTATGCAACAAAAAAACATTTTAAGGAAACCAAGTAAACAGTTTTATACTCAAAAAAAAAAAAAAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)