Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 94%

 1012074520 Xt7.1-XZG49525.5 - 45 ESTs
                                                                       ........-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG49525.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCCAGGTGAAAGATTGAGGGATCATCAGGTTCCTCAGCTGTCCGGCCGGAGAAGTCTCCCTAGAGATGAATTCCTACCTAGAATACACTTCTTGCGGGGATGTTGTAGCCTTTTCACCCAAGTTCTGCCGCAGCGACCAAAGAAACATGACCTTGCAGCCTTACCCTGGCAGTGGAGCAGATCATCCCTTTATGCCAGTTGGAGGTGTGCCTGGCTCCGTTGCCCACCAGGCTTCTCACCAGTCTCCAGCACTTTATGCTCCATGCAGCCTAGATGTCGCTTATGAGCCACCCCCACCTTCTGATTACAGTTTCTTACATAGCAGCACCGATTACGACTATTATGGATCTAATCACTTGGTAGAAGAGACTGGGGGCCACATTCCCTATGGCAGTTCTGTATTCCCAGGGAATGGATCGTACATCCTCAATGGGCAGCTGAGCTACAGGACTCTTGGAGAAGAAACCCAAATGGCTCAAATCGCCCAATGTAAGGAACCACTAGAAGTTTATCCTGGGGGCAACTTGCAGAGTATCTCCCCTTCGCCTGGCACTTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTCCAACTCAACGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCAATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAAAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTATTGTGTTTTGCTGTTCCCTGGGTCTCAAGCAATTTCTTCTGAAACTGACTGAACTCATTCTGGGACGTATTGTAGTACATCAGGAAGCTATGACCTGAAGGCGAATTTTATAAAATTTTACTGCTGTATATATCTATTTTTTTATAAACTAATAAAAATAAAAATCAAATTGACTATGCAAGAGCATGTATTTTAATTGTTTTTAATAAAGAGGGCTAATA
                                                  Xt7.1-CHK-1008226231                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGAAAGATTGAGGGATCATCAGGTTCCTCAGCTGTCCGGCCGGAGAAGTCTCCCTAGAGATGAATTCCTACCTAGAATACACTTCTTGCGGGGATGTTGTAGCCTTTTCACCCAAGTTCTGCCGCAGCGACCAAAGAAACATGACCTTGCAGCCTTACCCTGGCAGTGGAGCAGATCATCCCTTTATGCCAGTTGGAGGTGTGCCTGGCTCCGTTGCCCACCAGGCTTCTCACCAGTCTCCAGCACTTTATGCTCCATGCAGCCTAGATGTCGCTTATGAGCCACCCCCACCTTCTGATTACAGTTTCTTACATAGCAGCACCGATTACGACTATTATGGATCTAATCACTTGGTAGAAGAGACTGGGGGCCACATTCCCTATGGCAGTTCTGTATTCCCAGGGAATGGATCGTACATCCTCAATGGGCAGCTGAGCTACAGGACTCTTGGAGAAGAAACCCAAATGGCTCAAATCGCCCAATGTAAGGAACCACTAGAAGTTTATCCTGGGGGCAACTTGCAGAGTATCTCCCCTTCGCCTGGCACTTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTCCAACTCAACGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCAATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAAAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTATTGTGTTTTGCTGTTCCCTGGGTCTCAAGCAATTTCTTCTGAAACTGACTGAACTCATTCTGGGACGTATTGTAGTACATCAGGAAGCTATGACCTGAAGGCGAATTTTATAAAATTTTACTGCTGTATATATCTATTTTTTTATAAACTAATAAAAATAAAAATCAAATTGACTATGCAAGAGCATGTATTTTAATTGTTTTTAATAAAGAGGx
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  2     3     3     5     5     6     6     7     6     7     6     7     7     8     7     8     7     8     7    10     7    10     7    10     8    10     8    10     8    10     8    11     8    11     8    12     9    12     8    12     8    12     8    12     8    12    10    13    11    14    11    15    13    17    13    17    13    17    13    18    14    18    14    18    14    18    14    18    14    18    15    19    16    19    16    19    16    18    17    18    16    18    15    18    16    18    16    18    16    18    16    18    16    18    18    20    19    21    19    20    19    21    20    21    20    21    21    23    21    23    23    25    24    25    24    25    24    25    22    22    22    22    22    22    21    21    20    20    20    20    20    20    19    19    20    21    20    21    19    20    20    21    21    22    20    21    20    21    23    25    23    25    24    25    25    26    26    27    24    25    26    26    27    27    27    27    27    27    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    25    25    25    25    24    24    24    24    24    24    25    25    25    25    24    24    22    22    22    22    22    22    22    22    21    21    16    21    16    21    16    21    16    21    16    21    16    21    16    21    15    20    15    20    15    19    15    19    15    19    15    19    15    19    15    19    15    18    15    18    15    17    15    17    14    17    14    17    14    16    12    14    10    12     5     9     5     5     5     5     2     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------AT
                                               BLH ATG      66     496                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               BLH MIN      66      94                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               BLH OVR      66     244                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               ORF LNG      66      13                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 3e-022     NP_498655.1 C.Elegans Homeobox, Labial/Hox1 homolog (22.9 kD) (ceh-13) [Caenorhabditiselegans] ------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 6e-026     NP_476613.1 labial CG1264-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 7e-030     XP_781966.2 PREDICTED: similar to hox1 [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ci ---- 2e-035     BAE06495.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Bf ---- 9e-040     BAA78620.2 AmphiHox1 [Branchiostoma floridae] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Gg ==== 1e-041     NP_001074328.1 homeobox B1 [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Dr ---- 1e-043     NP_571611.1 homeo box A1a [Danio rerio] ----------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Hs ==== 3e-070     NP_078777.1 homeo box D1; homeo box 4G; Hox-4.7, mouse, homolog of; homeobox protein Hox-D1;homeobox-containing transcripton factor HOXD1 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Mm ==== 2e-073     NP_034597.2 homeo box D1 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === ?? ==== 8e-155     NP_001084035.1 homeobox protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xl ==== 3e-163     AAA03480.1 homeobox protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xt ==== 7e-180     CAJ83247.1 homeo box D1 [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG49525.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGA------------------------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------TAA---TAA------------------------------------------------TAA---------------------------------------------TGA---------------------------------TAA------------------------------------------------------------------------------------------------------TGA---------------------------------------------------TAA---------------------ATG---------------------------------------------------TAA---------TGA------------------------------------------------TGA---------------------------------------------------------------------------------------------------ATG---TGA------------TAA------------------------------------TAATAA---TAA---------TGA------------ATG---------------TAATAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  0   1   1           Neu  FL                     TNeu039b14.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGATTGAGGGATCATCAGGTTCCTCAGCTGTCCGGCCGGAGAAGTCTCCCTAGAGATGAATTCCTACCTAGAATACACTTCTTGCGGGGATGTTGTAGCCTTTTCACCCAAGTTCTGCCGCAGCGACCAAAGAAACATGACCTTGCAGCCTTACCCTGGCAGTGGAGCAGATCATCCCTTTATGCCAGTTGGAGGTGTGCCTGGCTCCGTTGCCCACCAGGCTTCTCACCAGTCTCCAGCACTTTATGCTCCATGCAGCCTAGATGTCGCTTATGAGCCACCCCCACCTTCTGATTACAGTTTCTTACATAGCAGCACCGATTACGACTATTATGGATCTAATCACTTGGTAGAAGAGACTGGGGGCCACATTCCCTATGGCAGTTCTGTATTCCCAGGGAATGGATCGTACATCCTCAATGGGCAGCTGAGCTACAGGACTCTTGGAGAAGAAACCCAAATGGCTCAAATCGCCCAATGTAAGGAACCACTAGAAGTTTATCCTGGGGGCAACTTGCAGAGTATCTCCCCTTCGCCTGGCACTTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTCCAACTCAACGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCAATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAAAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTATTGTGTTTTGCTGTTCCCTGGGTCTCAAGCAATTTCTTCTGAAACTGACTGAACTCATTCTGGGACGTATTGTAGTACATCAGGAAGCTATGACCTGAAGGCGAATTTTATAAAATTTTACTGCTGTATATATCTATTTTTTTATAAACTAATAAAAATAAAAATCAAATTGACTATGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu       in                   TNeu069h22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAATTCGTCGACAGGCCAATCTGGCCGCCCCGGGGTTGAGGGATCATCAGGTTCCTCAGCTGTCCGGCCGGAGAAGTCTCCCTAGAGATGAATTCCTACCTAGAATACACTTCTTGCGGGGATGTTGTAGCCTTTTCACCCAAGTTCTGCCGCAGCGACCAAAGAAACATGACCTTGCAGCCTTACCCTGGCAGTGGAGCAGATCATCCCTTTATGCCAGTTGGAGGTGTGCCTGGCTCCGTTGCCCACCAGGCTTCTCACCAGTCTCCAGCACTTTATGCTCCATGCAGCCTAGATGTCGCTTATGAGCCACCCCCACCTTCTGATTACAGTTTCTTACATAGCAGCACCGATTACGACTATTATGGATCTAATCACTTGGTAGAAGAGACTGGGGGCCACATTCCCTATGGCAGTTCTGTATTCCCAGGGAATGGATCGTACATCCTCAATGGGCAGCTGAGCTACAGGACTCTT
  5   1   2   12  bld Gas7 5g3  in                         XZG19466.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTCCAGGTGAAAGATTGAGGGATCATCAGGTTCCTCAGCTGTCCGGCCGGAGAAGTCTCCCTAGAGATGAATTCCTACCTAGAATACACTTCTTGCGGGGATGTTGTAGCCTTTTCACCCAAGTTCTGCCGCAGCGACCAAAGAAACATGACCTTGCAGCCTTACCCTGGCAGTGGAGCAGATCATCCCTTTATGCCAGTTGGAGGTGTGCCTGGCTCCGTTGCCCACCAGGCTTCTCACCAGTCTCCAGCACTTTATGCTCCATGCAGCCTAGATGTCGCTTATGAGCCACCCCCACCTTCTGATTACAGTTTCTTACATAGCAGCACCGATTACGACTATTATGGATCTAATCACTTGGTAGAAGAGACTGGGGGCCACATTCCCTATGGCAGTTCTGTATTCCCAGGGAATGGATCGTACATCCTCAATGGGCAGCTGAGCTACAGGACTCTTGGAGAAGAAACCCAAATGGCTCAAATCGCCCAATGTAAGGAACCACTAGAAGTTTATCCTGGGGGCAACTTGCAGAGTATCTCCCCTTCGCCTGGCACTTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAAC
  5   1   2   12  bld Gas7 PIPE in                         XZG34531.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTCCAGGTGAAAGATTGAGGGATCATCAGGTTCCTCAGCTGTCCGGCCGGAGAAGTCTCCCTAGAGATGAATTCCTACCTAGAATACACTTCTTGCGGGGATGTTGTAGCCTTTTCACCCAAGTTCTGCCGCAGCGACCAAAGAAACATGACCTTGCAGCCTTACCCTGGCAGTGGAGCAGATCATCCCTTTATGCCAGTTGGAGGTGTGCCTGGCTCCGTTGCCCACCAGGCTTCTCACCAGTCTCCAGCACTTTATGCTCCATGCAGCCTAGATGTCGCTTATGAGCCACCCCCACCTTCTGATTACAGTTTCTTACATAGCAGCACCGATTACGACTATTATGGATCTAATCACTTGGTAGAAGAGACTGGGGGCCACATTCCCTATGGCAGTTCTGTATTCCCAGGGAATGGATCGTACATCCTCAATGGGCAGCTGAGCTACAGGACTCTTGGAGAAGAAACCCAAATGGCTCAAATCGCCCAATGTAAGGAACCACTAGAAGTTTATCCTGGGGGCAACTTGCAGAGTATCTCCCCTTCGCCTGGCACTTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCNAACTCCCTCCAACTCAACGATACTCAGGTTAAGATCT
  5   1   2       bld Gas       in                   TGas123n15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGGTGAAAGATTGAGGGATCATAAGTTCCTCAGCTGTCCGGCCGGAGAAGTCTCCCTAGAGATGAATTCCTACCTAAATACACTTCTTGCGGGGATGTTGTAACCTTTTCACCCAAGTTCTGCCGCAGCGACCAAAGAAACATGACCTTGCAGCCTTACCCTGGCAGTGGAGCAGATCATCCCTTTATGCCAGTTGGAAGTGTGCCTGGCTCCGTTGCCCACCAAGCTTCTCACCAGTCTCCAGCACTTTATGCTCCATGCAGCCTAATGTCGCTTATGAGCCACCCCCACCTTCTGATTACAGTTTCTTACATAGCAGCACCGATTACGACTATTATGGATCTAATCACTTGGTAGAAGAGACTGGGGGCCACATTCCCTATGGCAGTTCTGTATTCCCAGGGAATGGATCGTACATCCTCAATGGGCAGCTGAGCTACAGGACTCTTGGAGAAGAAACCCAAATGGCTCAATCGCCCAATGTAAAGAACCACTAAAGTTTATCCTGAGGGCAACTTGCAGAGTATCTCCCCTTCGCCTGGCACTTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATG
  5   1   2       bld Neu  FL                        TNeu039b14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGNATGAGGGATCATCAGGTTCCTCAGCTGTCCGGCCGGAGAAGTCTCCCTAGAGATGAATTCCTACCTAGAATACACTTCTTGCGGGGATGTTGTAGCCTTTTCACCCAAGTTCTGCCGCAGCGACCAAAGAAACATGACCTTGCAGCCTTACCCTGGCAGTGGAGCAGATCATCCCTTTATGCCAGTTGGAGGTGTGCCTGTCTCCGTTGCCCACCAGGCTTCTCACCAGTCTCCAGCACTTTATGCTCCATGCAGCCTAGATGTCGCTTATGAGCCACCCCCACCTTCTGATTACAGTTTCTTACATAGCAGCACCGATTACGACTATTATGGATCTAATCACTTGGTAGAAGAGACTGGGGGCCACATTCCCTATGGCAGTTCTGTATTCCCAGGGAATGGATCGTACATCCTCAATGGGCAGCTGAGCTACAGGACTCTTGGAGAAGAAACCCAAATGGCTCAAATCGCCCAATGTAAGGAACCACTAGAAGTTTATCCTGGGGGCAACTTGCAGAGTATCTCCCCTTCGCCTGGCACTTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAAGAAAATTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACT
  5   1   2       bld Gas8 5g3  in                          st88l16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCAGGTTCCTCAGCTGTCCGGCCGGAGAAGTCTCCCTAGAGATGAATTCCTACCTAGAATACACTTCTTGCGGGGATGTTGTAGCCTTTTCACCCAAGTTCTGCCGCAGCGACCAAAGAAACATGACCTTGCAGCCTTACCCTGGCAGTGGAGCAGATCATCCCTTTATGCCAGTTGGAGGTGTGCCTGGCTCCGTTGCCCACCAGGCTTCTCACCAGTCTCCAGCACTTTATGCTCCATGCAGCCTAGATGTCGCTTATGAGCCACCCCCACCTTCTGATTACAGTTTCTTACATAGCAGCACCGATTACGACTATTATGGATCTAATCACTTGGTAGAAGAGACTGGGGGCCACATTCCCTATGGCAGTTCTGTATTCCCAGGGAATGGATCGTACATCCTCAATGGGCAGCTGAGCTACAGGACTCTTGGAGAAGAAACCCAAATGGCTCAAATCGCCCAATGTAAGGAACCACTAGAAGTTTATCCTGGGGGCAACTTGCAGAGTATCTCCCCTTCGCCTGGCACTTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAAC
  5   1   2   12  bld Gas7 5g3  in                         XZG60213.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGCTGTCCGGCCGGAGAAGTCTCCCTAGAGATGAATTCCTACCTAGAATACACTTCTTGCGGGGATGTTGTAGCCTTTTCACCCAAGTTCTGCCGCAGCGACCAAAGAAACATGACCTTGCAGCCTTACCCTGGCAGTGGAGCAGATCATCCCTTTATGCCAGTTGGAGGTGTGCCTGGCTCCGTTGCCCACCAGGCTTCTCACCAGTCTCCAGCACTTTATGCTCCATGCAGCCTAGATGTCGCTTATGAGCCACCCCCACCTTCTGATTACAGTTTCTTACATAGCAGCACCGATTACGACTATTATGGATCTAATCACTTGGTAGAAGAGACTGGGGGCCACATTCCCTATGGCAGTTCTGTATTCCCAGGGAATGGATCGTACATCCTCAATGGGCAGCTGAGCTACAGGACTCTTGGAGAAGAAACCCAAATGGCTCAAATCGCCCAATGTAAGGAACCACTAGAAGTTTATCCTGGGGGCAACTTGCAGAGTATCTCCCCTTCGCCTGGCACTTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTCCAACTCAACGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGANACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCCATTCTCCCCCGTCCGGACAGCATCCAGTATCTGCGTAAAAACTCCACTT
  5   1   2   12  bld Gas7 5g3  in                          XZG3705.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGATGAATTCCTACCTAGAATACACTTCTTGCGGGGATGTTGTAGCCTTTTCACCCAAGTTCTGCCGCAGCGACCAAAGAAACATGACCTTGCAGCCTTACCCTGGCAGTGGAGCAGATCATCCCTTTATGCCAGTTGGAGGTGTGCCTGGCTCCGTTGCCCACCAGGCTTCTCACCAGTCTCCAGCACTTTATGCTCCATGCAGCCTAGATGTCGCTTATGAGCCACCCCCACCTTCTGATTACAGTTTCTTACATAGCAGCACCGATTACGACTATTATGGATCTAATCACTTGGTAGAAGAGACTGGGGGCCACATTCCCTATGGCAGTTCTGTATTCCCAGGGAATGGATCGTACATCCTCAATGGGCAGCTGAGCTACAGGACTCTTGGAGAAGAAACCCAAATGGCTCAAATCGCCCAATGTAAGGAACCACTAGAAGTTTATCCTGGGGGCAACTTGCAGAGTATCTCCCCTTCGCCTGGCACTTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTCCAACTCAACGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCCATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGA
  5   1   2       bld Neu                            TNeu025h06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAGCCTTTTCACCCAAGTTCTGCCGCAGCGACCAAAGAACATGACCTTGCAGCCTTACCCTGGCAGTGGAGCAGATCATCCCTTTATGCCAGTTGGAGGTGTGCCTGGCTCCGTTGCCCACCAGGCTTCTCACCAGTCTCCAGCACTTTATGCTCCATGCAGCCTAGATGTCGCTTATGAGCCACCCCCACCTTCTGATTACAGTTTCTTACATAGCAGCACCGATTACGACTATTATGGATCTAATCACTTGGTAGAAGAGACTGGGGGCCACATTCCCTATGGCAGTTCTGTATTCCCAGGGAATGGATCGTACATCCTCAATGGGCAGCTGAGCTACAGGACTCTTGGAGAAGAAACCCAAATGGCTCAAATCGCCCAATGTAAGGAACCACTAGAAGTTTATCCTGGGGGCAACTTGCAGAGTATCTCCCCTTCGCCTGGCACTTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTNCAACTCAACGATACT
  5   1   2       bld Gas7 5x3  in                         XZG21629.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGATTGAGGGATCATCAGGTTCCTCAGCTGTCCGGCCGGAGAAGTCTCCCTAGAGATGAATTCCTACCTAGAATACACTTCTTGCGGGGATGTTGTAGCCTTTTCACCCAAGTTCTGCCGCAGCGACCAAAGAAACATGACCTTGCAGCCTTACCCTGGCAGTGGAGCAGATCATCCCTTTATGCCAGTTGGAGGTGTGCCTGGCTCCGTTGCCCACCAGGCTTCTCACCAGTCTCCAGCACTTTATGCTCCATGCAGCCTAGATGTCGCTTATGAGCCACCCCCACCTTCTGATTACAGTTTCTTACATAGCAGCACCGATTACGACTATTATGGATCTAATCACTTGGTAGAAGAAACCCAAATGGCTCAAATCGCCCAATGTAAGGAACCACTAGAAGTTTATCCTGGGGGCAACTTGCAGAGTATCTCCCCTTCGCCTGGCACTTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCT
  3   1   2       chi Neu       ?                     TNeu102e19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGAGCCATTTGGGTTTCTTCTCCAAGAGTCCTGTAGCTCAGCTGCCCATTGAGGATGTACGATCCATTCCCTGGGAATACAGAACTGCCATAGGGAATGTGGCCCCCAGTCTCTTCTACCAAGTGATTAGATCCATAATAGTCGTAATCGGTGCTGCTATGTAAGAAACTGTAATCAGAAGGTGGGGGTGGCTCATAAGCGACATCTAGGCTGCATGGAGCATAAAGTGCTGGAGACTGGTGAGAAGCCTGGTGGGCAGCTGAGCTACAGGACTCTTGGAGAAGAAACCCAAATGGCTCAAATCGCCCAATGTAAGGAACCACTAGAAGTTTATCCTGGGGGCAACTTGCAGAGTATCTCCCCTTCGCCTGGCACTTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTCCAACTCAACGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAAAAAAAAAAAAAAAA
  5   1   2       chi Gas7      in                         XZG22431.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATTGAGGGATCATCAGGTTCCTCAGCTGTCCGGCCGGAGAAGTCTCCCTAGAGATGAATTCCTACCTAGAATACACTTCTTGCGGGGATGTTGTAGCCTTTTCACCCAAGTTCTGCCGCAGCGACCAAAGAAACATGACCTTGCAGCCTTACCCTGGCAGTGGAGCAGATCATCCCTTTATGCCAGTTGGAGGTGTGCCTGGCTCCGTTGCCCACCAGGCTTCTCACCAGTCTCCAGCACTTTATGCTCCATGCAGCCTAGATGTCGCTTATGAGCCACATTCCCTATGGCAGTTCTGTATTCCCAGGGAATGGATCGTACATCCTCAATGGGCAGCTGAGCTACAGGACTCTTGGAGAAGAAACCCAAATGGCTCAAATCGCCCAATGTAAGGAACCACTAGAAGTTTATCCTGGGGGCAACTTGCAGAGTATCTCCCCTTCGCCTGGCACTTACCCAAAACCTGCCTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTCCAACTCAACGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCA
  5   1   2       bld Gas                            TGas036a08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGCCTAGATGTCGCTTATGAGCCACCCCCACCTTCTGATTACAGTTTCTTACATAGCAGCACCGATTACGACTATTATGGATCTAATCACTTGGTAGAAGAGACTGGGGGCCACATTCCCTATGGCAGTTCTGTATTCCCAGGGAATGGATCGTACATCCTCAATGGGCAGCTGAGCTACAGGACTCTTGGAGAAGAAACCCAAATGGCTCAAATCGCCCAATGTAAGGAACCACTAGAAGTTTATCCTGGGGGCAACTTGCAGAGTATCTCCCCTTCGCCTGGCACTTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTCCAACTCAACGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCAATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATC
  5   1   2       bld Gas7      in                         XZG60325.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGCTTATGAGCCACCCCCACCTTCTGATTACAGTTTCTTACATAGCAGCACCGATTACGACTATTATGGATCTAATCACTTGGTAGAAGAGACTGGGGGCCACATTCCCTATGGCAGTTCTGTATTCCCAGGGAATGGATCGTACATCCTCAATGGGCAGCTGAGCTACAGGACTCTTGGAGAAGAAACCCAAATGGCTCAAATCGCCCAATGTAAAGAACCACTAGAAGTTTATCCTGGGGGCAACTTGCAGAGTATCTCCCCTTCGCCTGGCACTTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTCCAACTCAACGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCAATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCT
  5   1   2       chi Gas                            TGas036i06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGCAGTAGCTGGTATGCCCCTGTCCTGATATTGCTAAAATTCAGAAGTACGCTGAGTCTGATTCTCCAAAATTAATGCAACAGTGAGCACATTCTGTCACAAACTGGATGTGATTGCTCACAAATCTGGTGTGGTTGCTGGATTCTGGGGAGGGAGGCGACACTAACCCCAACTGGCTCATAGCGCGCAATGTCAAGAACCACTTGATGTTCATCCTGGGGGCAACTTGCATAGTATCTCCCCTTCACCTGGCACTTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATGTCATCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAATAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCACGGCA
  3   1   2       bld Neu       in                    TNeu069h22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATTACAGTTTCTTACATAGCAGCACCGATTACGACTATTATGGATCTAATCACTTGGTAGAAGAGACTGGGGGCCACATTCCCTATGGCAGTTCTGTATTCCCAGGGAATGGATCGTACATCCTCAATGGGCAGCTGAGCTACAGGACTCTTGGAGAAGAAACCCAAATGGCTCAAATCGCCCAATGTAAGGAACCACTAGAAGTTTATCCTGGGGGCAACTTGCAGAGTATCTCCCCTTCGCCTGGCACTTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTCCAACTCAACGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7      in                          XZG4497.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGTTTCTTACATAGCAGCACCGATTACGACTATTATGGATCTAATCACTTGGTAGAAGAGACTGGGGGCCACATTCCCTATGGCAGTTCTGTATTCCCAGGGAATGGATCGTACATCCTCAATGGGCAGCTGAGCTACAGGACTCTTGGAGAAGAAACCCAAATGGCTCAAATCGCCCAATGTAAGGAACCACTAGAAGTTTATCCTGGGGGCAACTTGCAGAGTATCTCCCCTTCGCCTGGCACTTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTCCAACTCAACGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCAATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAAATGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTA
  5   1   2       bld Neu       in                   TNeu075e19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGGGCACTTGGTAGAAGAGACTGGGGGCCACATTCCCTATGGCAGTTCTGTATTCCCAGGGAATGGATCGTACATCCTCAATGGGCAGCTGAGCTACAGGACTCTTGGAGAAGAAACCCAAATGGCTCAAATCGCCCAATGTAAGGAACCACTAGAAGTTTATCCTGGGGGCAACTTGCAGAGTATCTCCCCTTCGCCTGGCACTTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTCCAACTCAACGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCAATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCAT
  3   1   2       bld Gas7      in                         XZG60325.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATGGATCGTACATCCTCAATGGGCAGCTGAGCTACAGGACTCTTGGAGAAGAAACCCAAATGGCTCAAATCGCCCAATGTAAAGAACCACTAGAAGTTTATCCTGGGGGCAACTTGCAGAGTATCTCCCCTTCGCCTGGCACTTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTCCAACTCAACGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCAATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATAC
  5   1   2       bld Neu                            TNeu020m16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTCCAACTCAACGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCAATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCAATATATATCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGANAGGTGGAGATTCACAAGTACTACTCACATATACCTTTAT
  5   1   2       bld Neu                            TNeu096h04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTACCCAAAACCTGCCTCCCCGGCGTCTGACACCCATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTCCAACTCAACGATACTCAAGTTAAGATCTGGTTCCAGAATAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTGTTTGCCCAATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTC
  5   1   2      seed Gas7      in                         XZG49525.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCTCCCCGGCGTCTGACACCCATGTCAGCACGTTTGATTGGATGAAAGTTAAAAGGAACCCACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTCCAACTCAACGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCAATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAAAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTC
  3  -1   2       bld Gas7                                 XZG26908.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCGCGATCTAGAACTAGTGTTAAAAGGAACCCACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTCCAACTCAACGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCAATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAACAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTNATGTGTTTTGCTGTTCCCTGGGTCTCAATCAATTTCTTCTGAAACTGACTGAACTTATTTCTGGACGTATTGTAGTACATCAGGAAGCTATGACCCTGA
  5   1   2       bld Gas7                                 XZG20472.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACCTAAGAAAAGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTCCAACTCAACGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCAATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGTATCTATGCATTANATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGAATACACATGCCATGCATGTG
  5   1   2       bld Gas       in                   TGas059d22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTTTCTCCAGGTTTACAATCTGAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTCCAACTCAACGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCAATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTA
  5   1   2       bld Gas7      in                         XZG54556.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAATATGGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTCCAACTCAACGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCAATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAACAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCCTCACTTTATCGACTGAATTTGCACTATTGTGTTTTGCTGTTCCCTGGGTCTCAATCAATTTCTTCTGAAACTGACTGAACTTATTCTGGGAC
  5   1   2       bld Neu                            TNeu111e09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGTAGCAAGTCCCCCCTGCACCGTGAGGACAAACTTCACCACCAAACAACTGACTGAACTCGAAAAGGAGTTTCATTTTAACAAGTATCTCACCAGGGCAAGACGCATCGAAATCGCAAACTCCCTCCAACTCAACGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCAATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCAATATATATCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTAT
  3   1   2       bld Gas       in                    TGas123n15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCAATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAAAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGTCATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTATTGTGTTTTGCTGTTCCCTGGGTCTCAAGCAATTTCTTCTGAAACTGACTGAACTCATTCTGGGACGTATTGTAGTACATCAGGAAGCTATGACCTGAAGGCGAATTTTATAAAATTTTACTGCTGTATATATCTATTTTTTTATAAACTAATAAAAATAAAAATCAAATTGACTATGCAAGAGCATGTATTTTAATTGTTTTTAATAAAGAGGCNNTAATACTGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 5g3  in                          XZG3705.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGATACTCAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCAATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAAAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTATTGTGTTTTGCTGTTCCCTGGGTCTCAAGCAATTTCTTCTGAAACTGACTGAACTCATTCTGGGACGTATTGTAGTACATCAGGAAGCTATGACCTGAAGGCGAATTTTATAAAATTTTACTGCTGTATATATCTATTTTTTTATAAACTAATAAAAAT
  3   1   2       bld Gas       in                    TGas059d22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGGTTAAGATCTGGTTCCAGAATAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTTGCCCCAATTTTCCCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTNTTCAAAGTCTGTACATGAAACTGCGACGNTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAAAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTATTGTGTTTTGCTGTTCCCTGGGTCTCAAGCAATTTCTTCTGAAACTGACTGAACTCATTCTGGGACGTATTGTAGTACATCAGGAAGCTATGACCTGAAGGCGAATTTTATAAAATTTTACTGCTGTATATATCTATTTTTTTATAAACTAATAAAAATAAAAATCAAATTGAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG54556.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGGCGAATGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCAATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAACAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTATTGTGTTTTGCTGTTCCCTGGGTCTCAATCAATTTCTTCTGAAACTGACTGAACTTATTCTGGGACGTATTGTAGTACATCAGGAAGCTATGACCTGAAGGCGAATTTTATAAAATTTTACTGCTGTATATATCTATTTTTTTATAAACTAATAAAAATAAAAATCAAATTGACT
  3   1   2       bld Gas7      in                          XZG4497.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAAACAAAAGAAAAGGGAAAGGGAGGGGTCTTTGCCCAATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAAAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTATTGTGTTTTGCTGTTCCCTGGGTCTCAAGCAATTTCTTCTGAAACTGACTGAACTCATTCTGGGACGTATTGTAGTACATCAGGAAGCTATGACCTGAAGGCGAATTTTATAAAATTTTACTGCTGTATATATCTATTTTTTTATAAACTAATAAAAAT
  5   1   2       bld Gas7      out                        XZG45714.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAAGGGAGGGGTCTTTGCCCAATTCTCCCCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGATTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGTATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAAAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTATTGTGTTTTGCTGTTCCCTGGGTCTCAAGCAATTTCTTCTGAAACTGACTGAACTCATTCTGGGACGTATTGTAGTACATCAGGAAGCTATGACCTGAAGGCGAATTTTATAAAATTTTACTGCTGTATATATCTATTTTTTTATAAACTAATAAAAATAAAAATCAAATTGGAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG49525.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCGTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAAAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTATTGTGTTTTGCTGTTCCCTGGGTCTCAAGCAATTTCTTCTGAAACTGACTGAACTCATTCTGGGACGTATTGTAGTACATCAGGAAGCTATGACCTGAAGGCGAATTTTATAAAATTTTACTGCTGTATATATCTATTTTTTTATAAACTAATAAAAATAAAAATCAAATTGACTATG
  3   1   2       bld Gas7 5x3  in                         XZG21629.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAAAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTATTGTGTTTTGCTGTTCCCTGGGTCTCAAGCAATTTCTTCTGAAACTGACTGAACTCATTTTGGGACGTATTGTAGTACATCAGGAAGCTATGACCTGAAGGCGAATTTTATAAAATTTTACTGCTGTATATATCTATTTTTTTATAAACTAATAAAAATAAAAATCAAATTGACTATGCAAGAGCATGTATTTTAATTGTTTTTAATAAAGAGGGCTAATACTGT
  3   1   2       bld Gas7      in                         XZG22431.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAAAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTATTGTGTTTTGCTGTTCCCTGGGTCTCAAGCAATTTCTTCTGAAACTGACTGAACTCATTCTGGGACGTATTGTAGTACATCAGGAAGCTATGACCTGAAGGCGAATTTTATAAAATTTTACTGCTGTATATATCTATTTTTTTATAAACTAATAAAAATAAAAATCAAATTGAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7 PIPE in                         XZG34531.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTCCGGACCAGCATCCAGTATCTGCGTAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAAAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTATTGTGTTTTGCTGTTCCCTGGGTCTCAAGCAATTTCTTCTGAAACTGACTGAACTCATTCTGGGACGTATTGTAGTACATCAGGAAGCTATGACCTGAAGGCGAATTTTATAAAATTTTACTGCTGTATATATCTATTTTTTTATAAACTAATAAAAATAAAAATC
  3   1   2       bld Gas7 5g3  in                         XZG60213.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAAAAACTCCACTTTCAAAGTCTGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAAAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTATTGTGTTTTGCTGTTCCCTGGGTCTCAAGCAATTTCTTCTGAAACTGACTGAACTCATTCTGGGACGTATTGTAGTACATCAGGAAGCTATGACCTGAAGGCGAATTTTATAAAATTTTACTGCTGTATATATCTATTTTTTTATAAACTAATAAAAATAAAAATCAAATTGACTATGCAAGAGCATGTATTTTAATTGTTTTTAATAAAGAGGCTAATCCTGT
  3   1   2       bld Neu       in                    TNeu075e19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAGTCTGTACATGAAACTGCGACCGGCTTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCAATATATATCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAAAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTATTGTGTTTTGCTGTTCCCTGGGTCTCAAGCAATTTCTTCTGAAACTGACTGAACTCATTCTGGGACGTATTGTAGTACATCAGGAAGCTATGACCTGAAGGCGAATTTTATAAAATTTTACTGCTGTATATATCTATTTTTTTATAAACTAATAAAAATAAAAATCAAATTGACTATGCAAGAGCATGTATTTTAATTGTTTTTAATAAAGAGGCTAATACTGTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas088m04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAACAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTATTGTGTTTTGCTGTTCCCTGGGTCTCAAGCAATTTCTTCTGAAACTGACTGAACTTATTCTGGGACGTATTGTAGTACATCAGGAAGCTATGACCTGAAGGCGAATTTTATAAAATTTTACTGCTGTATATATCTAATTGTTTATAAACTAATAAAAATAAAAATCAAATGAAAAAAAAAAAAAAAAAAAC
  5   1   2       bld Gas       in                   TGas088m04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACATGAAACTGCGACGCTGTCGCCATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAACAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTATT
  3   1   2       bld Gas8 5g3  in                          st88l16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCCAAGGACGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGAACAGAGTTAACANCACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCAATATATATCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAAAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTATTGTGTTTTGCTGTTCCCTGGGTCTCAAGCAATTTCTTCTGAAACTGACTGAACTCATTCTGGGACGTATTGTAGTACATCAGGAAGCTATGACCTGAAGGCGAATTTTATAAAATTTTACTGCTGTATATATCTATTTTTTTATAAACTAATAAAAATAAAAATCAAAT
  3   1   2       bld Gas7 5g3  in                         XZG19466.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGTTTAAGTATAAAGACTCACAGCTAGAGACCAAATATATGCGATCGTCTCGGGACAGAGTTAACAACACGATGCATTCTGCTGCACCCCAAGCAGGCACAAACTAGGGTGACTTTGCACTATATTCCGTTACTTGTGTTACCTATAAATTGTACAGTATGTATTGTATATACAGACCTTAGCAGCTCAATCCTGCATCTATGCATTAAATACATATATAGGGTCTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAAAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTATTGTGTTTTGCTGTTCCCTGGGTCTCAAGCAATTTCTTCTGAAACTGACTGAACTCATTCTGGGACGTATTGTAGTACATCAGGAAGCTATGACCTGAAGGCGAATTTTATAAAATTTTACTGCTGTATATATCTATTTTTTTATAAACTAATAAAAATAAAAATCAAATTGACTATGCAAGAGCATGTATTTTAATTGTTTTTAATAAAGAGGGCTAATACTGTAAAAGG
  3   1   2       bld Gas8      in                          st33n18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTAGGTTGTTTGTAGAGAGAACAGCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAAAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTATTGTGTTTTGCTGTTCCCTGGGTCTCAAGCAATTTCTTCTGAAACTGACTGAACTCATTCTGGGACGTATTGTAGTACATCAGGAAGCTATGACCTGAAGGCGAATTTTATAAAATTTTANCTGCCTGTATATATCTATT
  5   1   2       bld Gas8      in                          st33n18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCATGAAGGGTGGAGATTCACAAGTACTACTCACATATACCTTTATATAATCATGGTTAAGTATGTAAGATTACACATGCCATGCATGTGCGACAGAAAAAGCAAGTCCTGCAGCCAGATACTGTACATACTGTATAAAGCCAGTACTGACATTACCAAAGATGGATAGGAGTCTGCCATTTCCTCAACTTTATCGACTGAATTTGCACTATTGTGTTTTGCTGTTCCCTGGGTCTCAAGCAATTTCTTCTGAAACTGACTGAACTCATTCTGGGACGTATTGTAGTACATCAGGAAGCTATGACCTGAAGGCGAATTTTATAAAATTTTACTGCTGTATATATCTATTTTTTTATAAACTAATAAAAATAAAAATCAAATTGAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)