Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA031b10.3                         65 END     1           1        1                novel protein similar to actin-related protein 6 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012074553 Xt7.1-TTpA031b10.5 - 70 ESTs
                                                                       ...-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTpA031b10.5                                  TATAGATCAGGCTCGGGGGGAGAGTGAGGAGCAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGTCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCACTGGGGTTGACGATAGAGAGAACTGGCCAACAGTATTTTACAACAGGACGTGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAGAGCAAATTCGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTACGGATGAGCTTCTGGGAGGGGTCCATCCCACCACCACCAACCTATTAAGCCCGGCATCCTTCTTCGCTTCATGGCAGATAGTATGCAGCCGCCCTGAGGAATACAATGCTCAGAGGATCCTATGCAATGGTACCGGGGAAGGGCCCCTGTTCAGAAATCCTGGTGGCCACGATCGGAGCAGAACCCCCCGATTGCCTACAACAGCTGAAGTTGAGCTGTGTCTGTCATTAACAAATTATGAAACGGAGCCCATGGATCGGTCGGCCAACTTTAGCTTCAGGAACACCCTGGAAGGATTTGCAGATCCACGAACTGGGATAGCCAACCGCTCTCAAAGCAACATGCATAACTCGCTGCATGTGTTCCTCAACGGCTCCATGTCTTCCGTCCAAGGATCGGCCAATGACCCAGTTTTTGTCTTGCACCATGCTTTTGTCGACAGCATCTTTGAGCAATGGCTCAGAAGACACGGAGCTTCAGTAGACATTTACCCAGAAGCCAATGCACCAATTGGCCACAATCGTGGCTACTACATGGTTCCATTTATTCCTCTATACACAAATGGAGAATTCTTTGCCGCTTCTAGAGATCTTGGATATGATTACGATTATCTAGCAGAATCAGGTTCCATTGAAGACTTCCTTTTGCCCTACCTGGAGCAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTTCCATTTCTCCTCTTTGTTCTCTTATAGAGATGGAGAATGACCATGGTCTCGGCATAACAGGCAAATGGTTGGGTGAGCAGGGGGTCCCACCTATACCTCGGCCCACTGGGACTTTCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATTTGGGAGAAATTTGTCCGATTTATTTTGCATTGTGGTGCATTTAACGTGATTTGTTATATCAGGTATCATTTACTGATTGATCAAAATTGGCTAAAGGCTTATACAAGCAGGAAAGGGCAATGCCCACTACTTCTATGTTGCTGGACTTCAACTCCTGGTATGCCCAGTAGAGATGAGCGAATCTGTCCTGTTTTGCTTCGCCATAAAATTCACGAAACAGCGAAAAAT
                                                  Xt7.1-CHK-1008224389                                        TCAGGCTCGGGGGGAGAGTGAGGAGCAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGTCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCACTGGGGTTGACGATAGAGAGAACTGGCCAACAGTATTTTACAACAGGACGTGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAGAGCAAATTCGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTACGGATGAGCTTCTGGGAGGGGTCCATCCCACCACCACCAACCTATTAAGCCCGGCATCCTTCTTCGCTTCATGGCAGATAGTATGCAGCCGCCCTGAGGAATACAATGCTCAGAGGATCCTATGCAATGGTACCGGGGAAGGGCCCCTGTTCAGAAATCCTGGTGGCCACGATCGGAGCAGAACCCCCCGATTGCCTACAACAGCTGAAGTTGAGCTGTGTCTGTCATTAACAAATTATGAAACGGAGCCCATGGATCGGTCGGCCAACTTTAGCTTCAGGAACACCCTGGAAGGATTTGCAGATCCACGAACTGGGATAGCCAACCGCTCTCAAAGCAACATGCATAACTCGCTGCATGTGTTCCTCAACGGCTCCATGTCTTCCGTCCAAGGATCGGCCAATGACCCAGTTTTTGTCTTGCACCATGCTTTTGTCGACAGCATCTTTGAGCAATGGCTCAGAAGACACGGAGCTTCAGTAGACATTTACCCAGAAGCCAATGCACCAATTGGCCACAATCGTGGCTACTACATGGTTCCATTTATTCCTCTATACACAAATGGAGAATTCTTTGCCGCTTCTAGAGATCTTGGATATGATTACGATTATCTAGCAGAATCAGGTTCCATTGAAGACTTCCTTTTGCCCTACCTGGAGCAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTTCCATTTCTCCTCTTTGTTCTCTTATAGAGATGGAGAATGACCATGGTCTCGGCATAACAGGCAAATGGTTGGGTGAGCAGGGGGTCCCACCTATACCTCGGCCCACTGGGACTTTCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATTTGGGAGAAATTTGTCCGATTTATTTTGCATTGTGGTGCATTTAACGTGATTTGTTATATCAGGTATCATTTACTGATTGATCAAAATTGGCTAAAGGCTTATACAAGCAGGAAAGGGCAATGCCCACTACTTCTATGTTGCTGGACTTCAACTCCTGGTATGCCCAGTAGAGATGAGCGAATCTGTCCTGTTTTGCTTCGCCATAAAATTCACGAAACAGCG
                                                      consensus depths                                       2     2    11    12    18    19    19    20    21    21    22    22    22    22    24    24    23    24    26    26    25    26    26    26    26    26    25    26    26    26    26    26    26    26    26    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    28    28    28    28    28    28    28    28    28    28    27    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    29    29    28    28    28    28    28    28    28    28    28    28    29    29    27    28    27    28    27    28    27    28    27    28    27    28    25    26    25    25    24    24    22    22    21    21    21    21    19    19    19    19    17    17    14    14    10    14    11    13    11    13    11    13    11    13    11    13     9    10     7    10     9     9     7     7     5     5     4     4     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     8     9     9     9     9    11    10    12    11    12    12    12    13    13    13    13    13    13    12    12    12    12    12    12    12    13    12    13    13    13    13    13    14    14    15    15    16    17    15    17    16    17    17    18    18    19    18    19    19    20    19    21    19    22    19    22    19    22    20    23    22    24    22    24    23    25    25    27    26    27    26    27    27    28    27    29    27    29    26    29    27    30    28    31    26    30    26    30    26    30    26    30    27    30    28    30    25    30    25    30    25    30    23    29    23    29    23    28    23    28    24    28    22    27    23    27    23    27    22    27    23    26    22    26    22    27    23    27    25    30    25    29    27    31    29    30    29    30    29    30    28    30    28    30    27    29    27    29    25    29    27    29    27    29    27    28    25    27    24    27    23    27    23    27    20    23    20    23    19    23    18    23    17    22     5     5     3     5     3     5     3     5     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2
                                                                   SNP                                                                                                                                                                                              --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                              --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                  ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                              ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------C-
                                               BLH ATG      35    1636                                  
                                               BLH MIN      35     193                                  
                                               BLH MPR      35     193                                  
                                               BLH OVR      35      66                                  
                                               EST CLI       0      42                                  
                                               ORF LNG      35      11                                  
                                                                                                                                                                                                             PROTEIN --- Ce ---- 4e-014     NP_500987.3 Y73B6BL.1 [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN -== Br ==== 5e-017     AAO13798.1 TYROSINASE-RELATED PROTEIN 1 [Branchiostoma belcheri tsingtaunese] ==========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                            PROTEIN --- Bf ---- 1e-072     AAM18867.1 unknown [Branchiostoma floridae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                           PROTEIN --- ?? ---- 3e-104     NP_001080492.1 tyrosinase-related protein 1 [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                          PROTEIN === Xl ==== 7e-147     AAR01921.1 tyrosinase [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                             PROTEIN --- Dr ---= 0          NP_571088.1 tyrosinase [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                       PROTEIN === Gg ==== 0          NP_989491.1 tyrosinase (oculocutaneous albinism IA) [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                       PROTEIN --- Mm ---- 0          NP_035791.1 tyrosinase [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                       PROTEIN --- Hs ---- 0          NP_000363.1 tyrosinase (oculocutaneous albinism IA); Tyrosinase [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                           PROTEIN === Xt ==== 0          AAI35592.1 Unknown (protein for MGC:122006) [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTpA031b10.5                                    TAG------------------------------ATG---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------TAG---------------TAA---TAA------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------TGA------------------------ATG------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------ATG---------------ATG------------------------------------------------------TAA---------------------------------------------TAA---------------------------------TGA---------------------------------------ATG------------ATG------------------------------TAG---TGA---------------------------TAA
                                                                   ORF                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  0   1   1           Tad5 FL                          XZT29556.FL-MGC                                      GATCAGGCTCGGGGGGAGAGTGAGGAGCAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGTCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCACTGGGGTTGACGATAGAGAGAACTGGCCAACAGTATTTTACAACAGGACGTGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAGAGCAAATTCGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTACGGATGAGCTTCTGGGAGGGGTCCATCCCACCACCACCAGCCTATTAAGCCCGGCATCCTTCTTCGCTTCATGGCAGATAGTATGCAGCCGCCCTGAGGAATACAATGCTCAGAGGATCCTATGCAATGGTACCGGGGAAGGGCCCCTGTTCAGAAATCCTGGTGGCCACGATCGGAGCAGAACCCCCCGATTGCCTACAACAGCTGAAGTTGAGCTGTGTCTGTCATTAACAAATTACGAAACGGAGCCCATGGATCGGTCGGCCAACTTTAGCTTCAGGAACACCCTAGAAGGATTTGCAGATCCACGAACTGGGATAGCCAACCGCTCTCAAAGCAACATGCATAACTCGCTGCATGTGTTCCTCAACGGCTCCATGTCTTCCGTCCAAGGATCGGCCAATGACCCAGTTTTTGTCTTGCACCATGCTTTTGTCGACAGCATCTTTGAGCAATGGCTCAGAAGACACGGAGCTTCAGTAGACATTTACCCAGAAGCCAATGCACCAATTGGCCACAATCGTGGCTACTACATGGTTCCATTTATTCCTCTATACACAAATGGAGAATTCTTTGCCGCTTCTAGAGATCTTGGATATGATTACGATTATCTAGCAGAATCAGGTTCCATTGAAGACTTCCTTTTGCCCTACCTGGAGCAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTTCCATTTCTCCTCTTTGTTCTCTTATAGAGATGGAGAATGACCATGGTCTCGGCATAACAGGCAAATGGTTGGGTGAGCAGGGGGTCCCACCTATACCTCGGCCCACTGGGACTTTCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATTTGGGAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           TpA  FL                     TTpA001h12.FL-Sanger                                       ATCAGGCTCGGGGGGAGAGTGAGGAGCAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGCCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCACTGGGGTTGACGATAGAGAGAACTGGCCAACGGTATTTTACAACAGGACATGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAAAGCAAATTTGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTACGGATGAGCTTCTGGGAGGGGTCCATCCCACCACCACCAACCTATTAAGCCCGGCATCCTTCTTCGCTTCATGGCAGATAGTATGCAGCCGCCCTGAGGAATACAATGCTCAGAGGATCCTATGCAATGGTACCGGGGAAGGGCCCCTGTTCAGAAATCCTGGTGGCCACGATCGGAGCAGAACCCCCCGATTGCCTACAACAGCTGAAGTTGAGCTGTGTCTGTCATTAACAAATTACGAAACGGAGCCCATGGATCGGTCGGCCAACTTTAGCTTCAGGAACACCCTGGAAGGATTTGCAGATCCACGAACTGGGATAGCCAACCGCTCTCAAAGCAACATGCATAACTCGCTGCATGTGTTCCTCAACGGCTCCATGTCTTCCGTCCAAGGATCGGCCAATGACCCAGTTTTTGTCTTGCACCATGCTTTTGTCGACAGCATCTTTGAGCAATGGCTCAGAAGACACGGAGCTTCAGTAGACATTTACCCAGAAGCCAATGCACCAATTGGCCACAATCGTGGCTACTACATGGTTCCATTTATTCCTCTATACACAAATGGAGAATTCTTTGCCGCTTCTAGAGATCTTGGATATGATTACGATTATCTAGCAGAATCAGGTTCCATTGAAGACTTCCTTTTGCCCTACCTGGAGCAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTTCCATTTCTCCTCTTTGTTCTCTTATAGAGATGGAGAATGACCATGGTCTCGGCATAACAGGCAAATGGTTGGGTGAGCAGGGGGTCCCACCTATACCTCGGCCCACTGGGACTTTCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATTTGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld TbA  5g                        TTbA018f12.p1kSP6 GTAGGGAAGAAAAGTGGCCTATACCCCCAGTCCTATAGATCAGGCTCGGGGGGAGAGTGAGGAGCAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGTCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCACTGGGGTTGACGATAGAGAGAACTGGCCAACAGTATTTTACAACAGGACGTGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAGAGCAAATTCGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCAT
  5   1   2       bld TbA  5g                       TTbA012n13.p1kbSP6                                  TATAGATCAGGCTCGGGGGGAGAGTGAGGAGCAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGTCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCACTGGGGTTGACGATAGAGAGAACTGGCCAACAGTATTTTACAACAGGACGTGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAGAGCAAATTCGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTACGGATG
  5   1   2       bld TbA  5g                       TTbA012n11.p1kbSP6                                   TATGGATCAGGCTCGGGGGGAGAGTGAGGAGCAGCATGGAAAGGACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGTCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCACTGGGGTTGACGATAGAGAGAACTGGCCAACAGTATTTTACAACAGGACGTGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAGAGCAAATTCGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTA
  5   1   2       bld HdA  5g                       THdA017j05.p1kaSP6                                    TAGATCAAGCTCGGGGGGAGAGTGAGGAGCAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGCCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAAGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCACTGGGGTTGACGATAGAGAGAACTGGCCAACGGTATTTTACAACAGGACATGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAAAGCAAATTTGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTACGGATGAGCTTCTGGGTAGGGTCCATCCCACCACCACCAACCTATTAAGCCCGGCATCCTTCTTCGCTTCATGGCAGATAGTATGCAGCCGCCCTGAAGAAATACATGCTCAGAGGATCCTATGCAAT
  5   1   2       bld Tad5 FL                              XZT29556.5p                                      GATCAGGCTCGGGGGGAGAGTGAGGAGCAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGTCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCACTGGGGTTGACGATAGAGAGAACTGGCCAACAGTATTTTACAACAGGACGTGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAGAGCAAATTCGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGAT
  5   1   2       bld TpA  FL                        TTpA001h12.p1kSP6                                       ATCAGGCTCGGGGGGAGAGTGAGGAGCAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGCCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCACTGGGGTTGACGATAGAGAGAACTGGCCAACGGTATTTTACAACAGGACATGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAAAGCAAATTTGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATG
  5   1   2       bld HdA  5g                        THdA053f23.p1kSP6                                       ATCAGGCTCGGGGGGAGAGTGAGGAGCAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGCCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCACTGGGGTTGACGATAGAGAGAACTGGCCAACGGTATTTTACAACAGGACATGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAAAGCAAATTTGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTACGGATGAGCTTNCTGGGAGGGGTCCATCCCACCACCACCAACCTATTAAGCCCGGCATCCTTCTTCGCTTCATGGCAGATAGTATGCAGCCGCCCTGAGGAATACATGCTCAGAGGATCCTATGCAA
  5   1   2   10  bld Eye  5g3  in                         CCAX7093.b1 ......................................ATCAGGCTCGGGGGGAGAGTGAGGAGCAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGCCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCACTGGGGTTGACGATAGAGAGAACTGGCCAACGGTATTTTACAACAGGACATGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAAAGCAAATTTGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGC
  5   1   2       bld TpA  5x3  out                  TTpA031b10.p1kSP6                                        ATAGGCTCGGGGGGAGAGTGAGGAGCAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGTCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCTCTGGGGTTGACGATAGAGAGAACTGGCCAACAGTATTTTACAACAGGACGTGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAGAGCAAATTCGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTACGGATGAGCTTCTGGGAGGGGTCCATCCCACCACCACCAGCCTATTAAGCCCGGCATCCTTCTTCGCTTCATGGCAGATAGTATGCAGCCGCCCTGAGGAAATACATGCTC
  5   1   2       bld TpA  5g                        TTpA064h09.p1kSP6                                         CAGGCTCGGGGGGAGAGTGAGGAGCACCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGCCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCACTGGGGTTGACGATAGAGAGAACTGGCCAACGGTATTTTACAACAGGACATGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAAGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAAAGCAAATTTGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTACGGATGAGCTTCTGGGAAGGGTCCATCCCACCACCA
  5   1   2   10  bld Tbd1 5g3  in                         CBXT7476.b1 ..........................................GGCTCGGGGGGAGAGTGAGGAGCAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGTCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCTCTGGGGTTGACGATAGAGAGAACTGGCCAACAGTATTTTACAACAGGACGTGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAGAGCAAATTCGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAAC
  5   1   2   10  bld Eye  5g3  in                         CCAX5063.b1 .............................................CTCGGGGGAGAGTGAGGAGCAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGCCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCACTGGGGTTGACGATAGAGAGAACTGGCCAACGGTATTTTACAACAGGACATGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAAAGCAAATTTGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATT
  5   1   2   20  bld Tbd1 5g                             CBXT12842.b1 ..................................................GGGAGAGTGAGGAGCAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGCTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGCCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCTCTGGGGTTGACGATAGAGAGAACTGGCCAACAGTATTTTACAACAGGACGTGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAGAGCAAATTCGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCTTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAG
  5   1   2   10  bld Eye  5g3  in                         CCAX1356.b1 ..................................................GGGAGAGTGAGGAGCAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGCCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCACTGGGGTTGACGATAGAGAGAACTGGCCAACGGTATTTTACAACAGGACATGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAAAGCAAATTTGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCTCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACA
  5   1   2       bld TbA  5g3  in                   TTbA004k19.p1kSP6                                                    GGAGAGTGAGGAGCAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGTCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCTCTGGGGTTGACGATAGAGAGAACTGGCCAACAGTATTTTACAACAGGACGTGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAGAGCAAATTCGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCCTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGT
  5   1   2   12  bld Tad5 5g3  in                         XZT53210.5p ...................................................GGAGAGTGAGGAGCAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGTCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCACTGGGGTTGACGATAGAGAGAACTGGCCAACAGTATTTTACAACAGGACGTGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAGAGCAAATTCGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTACGGATGAGCTTCTGGGAGGNGTCCATCCCACCACCACCAGCCTATTAAGCCCGGCATCCTTCTTCGCTTCATGGCAGATAGTATGCA
  5   1   2      seed TpA  5g                        TTpA042l21.p1kSP6                                                     GAGAGTGAGGAGCAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGTCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCTCTGGGGTTGACGATAGAGAGAACTGGCCAACAGTATTTTACAACAGGACGTGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAGAGCAAATTCGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTACGGATGAGCTTCTGGGAGGGGTCCATCCCACCACCACCAGCCTATTAAGCCCGGCATCCTTCTTCGCTTCATGGCAGATAGTATGCAGCCGCCCTG
  5   1   2       bld TpA  5g                        TTpA058g20.p1kSP6                                                        AGTGAGGAGCAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGTCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCTCTGGGGTTGACGATAGAGAGAACTGGCCAACAGTATTTTACAACAGGACGTGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAGAGCAAATTCGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTACGGATGAGCTTNCTGGGAGGGGTCCATCCCACCACCACCAGCCTATTAAGCCCGGCATCCTTCTTCGCTTCATGGCAGATAGTATGCAGC
  5   1   2   22  bld Tad5 5g                              XZT30816.5p ........................................................GTGAGGAGCAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCACTCCTGAGCAAGGAGTGTTGCCCTGTGTGGTCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCACTGGGGTTGACGATAGAGAGAACTGGCCAACAGTATTTTACAACAGGACGTGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATTTTCCGAATGAGCAGTGCTGAGAAGAGCAAATTCGTTGCCTACTTGAACTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTACGGATGAGCTTCT
  5   1   2       bld HdA  5g3  in                  THdA017n21.p1kaSP6                                                                 CAGCATGGAAAGGAACATGGTCCCTCTGGCATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGTCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCTCTGGGGTTGACGATAGAGAGAACTGGCCAACAGTATTTTACAACAGGACGTGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAGAGCAAATTCGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTACGGATGAGCTTCTGGGAGGGGTCCATCCCACCACCACCAGCCTATTAAGCCCGGCATCCTTCTTCGCTTCATGGCAGATAGTATGCAGCCGCCCTGAGGAATACAATGCTCAGAGGATCCTATGCAAT
  5   1   2       bld Eye       in                         CCAX1922.b1                                                                             GAACATGGTCCCTCTGACATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCAGGAACCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGCCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCACTGGGGTTGACGATAGAGAGAACTGGCCAACGGTATTTTACAACAGGACATGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAAAGCAAATTTGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTACGGATGA
  5   1   2       bld TpA       out                  TTpA015k19.p1kSP6                                                                                              CATTCTGCTGCCTGTTCTTCTTCCTCCATGTTTGCACGGGCCAGTTCCCAAGGGCATGTAGCACCGCACAGTCACTCCTGAGCAAGGAGTGTTGCCCTGTGAGGTCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAAGAAGGGGTGTCTGCCAAGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCTCTGGGGTTGACGATAGAGAGAACTGGCCAACAGTATTTTACAACAGGACGTGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCGAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAGAGCAAATTCGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGA
  5   1   2       bld Tad5                                 XZT53308.5p                                                                                                           GTTCTTCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGCCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCACTGGGGTTGACGATAGAGAGAACTGGCCAACGGTATTTTACAACAGGACATGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAAAGCAAATTTGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTACGGATGAGCTTCTGGGAGGGGTCCATCCCACCACCACCAACCTATTAAGCCCGGCATCCTTCTTCGCTTCATGGCAGATAGTATGCAGCCGCCCTGAGGAATACAATGCTCAGAGGATCCTATGNCATGGTACCGGGG
  5   1   2       bld Lun1                                 CABD4938.5p                                                                                                                TCTTCCTCCATGTTTGCAGGGGCCAGTTCCCAAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGCCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCACTGGGGTTGACGATAGAGAGAACTGGCCAACGGTATTTTACAACAGGACATGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAAAGCAAATTTGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTACGGATGAGCTTCTGGGAGGGGTCCATCCCACCACCACCAACCTATTAAGCCCGGCATCCTTCTTCGCTTCATGGCAGATAGTATGCAGCCGCCCTGAGGAATACAATGCTCAGAGGATCCTATGCAATGGTACCGGGGAGGGCCCCTGT
  5   1   2       bld TpA       in                  TTpA047g04.p1kaSP6                                                                                                                                    GGGCCAGTTCCAAGGGCATGTAGCACCCCATAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGTCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCTCTGGGGTTGACGATAGAGAGAACTGGCCAACAGTATTTTACAACAGGACGTGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAGAGCAAATTCGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTACGGATGAGCTTCTGGGAGGGGTCCATCCCACCACCACCAGCCTATTAAGCCCGGCATCCTTCTTCGCTTCATGGCAGATAGTATGCAGCCGCCCTGAGGAATACAATGCTCAGAGGATCCTATGCAATGGTACCGG
  5   1   2       bld TpA                            TTpA047g03.p1kSP6                                                                                                                                      GCCAGTTCCCAGGGCATGTAGCACCGCAGAGTCGCTCCTGAGCAAGGAGTGTTGCCCTGTGTGGTCTGGAGATGGGTCCTCTTGTGGCCAGCTATCAGGAAGGGGTGTCTGCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCAGTTTCCATTCTCTGGGGTTGACGATAGAGAGAACTGGCCAACAGTATTTTACAACAGGACGTGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAGAGCAAATTCGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTGTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTG
  5   1   2       bld TbA       in                   TTbA067m04.p1kSP6                                                                                                                                                                                                                                             TGTCCTGCCCAGGATGTTGTCCTGACCAGCTCTGCTACTGGCCCTCCGTTTCCATTCACTGGGGTTGACGATAGACAGAACTGGCCAACAGTATTTTACAACAGGACGTGCCAATGCCTTGGCAACTTCATGGGCTATAACTGTGCAGACTGCAAATTTGGCTTCAGAAGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAACAGCAAATTCGTTGCCTACTTGAATTTGGCTAAGCACACCACCAACCGTGACTATGTCATAGTCACTGGCACCTACACCCAGATGAATAATGGCTCCAACCCTATGTTTG
  5   1   2       bld Lun1      in                         CABD6751.5p                                                                                                                                                                                                                                                                                                                                                                                                              CTTCAGAGGGCCAAACTGCACAGAGAGAAGAACAATGATAAGAAAGGAGATATTCCGAATGAGCAGTGCTGAGAAAAGCAAATTTGTTGCCTACTTGAATTTGGCTAAGCACACCACCAGCCGTGACTATGTCATAGTCACTGGCACCTACGCCCAGATGAATAATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTACGGATGAGCTTCTGGGAGGGGTCCATCCCACCACCACCAACCTATTAAGCCCGGCATCCTTCTTCGCTTCATGGCAGATAGTATGCAGCCGCCCTGAGGAATACAATGCTCAGAGGATCCTATGCAATGGTACCGGGGAAGGGCCCCTGTTCAGAAATCCTGGTGGCCACGATCGGAGCAGAACCCCCCGATTGCCTACAACAGCTGAAGTTGAGCTGTGTCTGTCATTAACAAATTATGAAACGGAGCCCATGGATCGGTCGGCCAACTTTAGCTTCAGGAACACCCTGGAAGGATTTGCAGATCCACGAACTGGGATAGC
  5   1   2       bld Eye       in                         CCAX8996.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGGCTCCAACCCTATGTTTGCGGATATCAACGTGTATGACCTCTTTGTCTGGATGCATTACTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTACGGATGAGCTTCTGGGAGGGGTCCATCCCACCACCACCAACCTATTAAGCCCGGCATCCTTCTTCGCTTCATGGCAGATAGTATGCAGCCGCCCTGAGGAATACAATGCTCAGAGGATCCTATGCAATGGTACCGGGGAAGGGCCCCTGTTCAGAAATCCTGGTGGCCACGATCGGAGCAGAACCCCCCGATTGCCTACAACAGCTGAAGTTGAGCTGTGTCTGTCATTAACAAATTATGAAACGGAGCCCATGGATCGGTCGGCCAACTTTAGCTTCAGGAACACCCTGGAAGGATTTGCAGATCCACGAACTGGGATAGCCAACCGCTCTCAAAGCAACATGCATAACTCGCTGCATGTGTTCCTCAACGGCTCCATGTCTTCCGTCCAAGGATCGGCCAATGACCCAGTTTTTGTCTTGCACCATGCTTTTGTCGACAGCATCTTTGAGCAATGGCTCAGAAGACACGGAGCTTCAGTAGACATTTACCCAGAAGCCAATGCACCAATTGGG
  5   1   2       bld Tad5                                 XZT31923.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTATGCCTCCCGTGATGTCTTCATAGGAGAAGATGCTCTCTGGAGAGACATTGACTTTGCCCATGAAGCTCCGGCTTTTGTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGAAACTCACAGGAGATGAGAATTTTACCATCCCTTTCTGGGATTGGAGAGATGCCCAAGGTTGTGACATATGTACGGATGAGCTTCTGGGAGGGGTCCATCCCACCACCACCAACCTATTAAGCCCGGCATCCTTCTTCGCTTCATGGCAGATAGTATGCAGCCGCCCTGAGGAATACAATGCTCAGAGGATCCTATGCAATGGTACCGGGGAAGGGCCCCTGTTCAGAAATCCTGGTGGCCACGATCGGAGCAGAACCCCCCGATTGCCTACAACAGCTGAAGTTGAGCTGTGTCTGTCATTAACAAATTACGAAACGGAGCCCATGGATCGGTCGGCCAACTTTAGCTTCAGGAACACCCTAGAAGGATTTGCAGATCCACGAACTGGGATAGCCAACCGCTCTCAAAGCAACATGCATAACTCGCTGCATGTGTTCCTCAACGGCTCCATGTCTTCCGTCCAAGGATCGGCCAATGACCCAGTTTTTGTCTTGCACCATGCTTTTGTCGACAGCATCTTTGAGCAATGGCTCAGAAGACACGGAGCTTCAGTAGACATTTACCCAGAAGCCAATGCACCAATTGGCCACAATCGTGGCTACTACATGGTTCCATTTATTCCTCTATACACAAATGGAGAATTCTTTGCCGCTTCTAGAGATCTTGGATATGATTACGATTATCTAGCAGAATCAGGTTCCATTGAAGAC
  5   1   2       bld Eye       in                         CCAX1181.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCAATGGTACCGGGGAAGGGCCCCTGTTCAGAAATCCTGGTGGCCACGATCGGAGCAGAACCCCCCGATTGCCTACAACAGCTGAAGTTGAGCTGTGTCTGTCATTAACAAATTATGAAACGGAGCCCATGGATCGGTCGGCCAACTTTAGCTTCAGGAACACCCTGGAAGGATTTGCAGATCCACGAACTGGGATAGCCAACCGCTCTCAAAGCAACATGCATAACTCGCTGCATGTGTTCCTCAACGGCTCCATGTCTTCCGTCCAAGGATCGGCCAATGACCCAGTTTTTGTCTTGCACCATGCTTTTGTCGACAGCATCTTTGAGCAATGGCTCAGAAGACACGGAGCTTCAGTAGACATTTACCCAGAAGCCAATGCACCAATTGGCCACAATCGTGGCTACTACATGGTTCCATTTATTCCTCTATACACAAATGGA
  5   1   2       bld Ova1      in                         CABE6494.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGAAATCCTGGTGGCCACGATCGGAGCAGAACCCCCCGATTGCCTACAACAGCTGAAGTTGAGCTGTGTCTGTCATTAACAAATTATGAAACGGAGCCCATGGATCGGTCGGCCAACTTTAGCTTCAGGAACACCCTGGAAGGATTTGCAGATCCACGAACTGGGATAGCCAACCGCTCTCAAAGCAACATGCATAACTCGCTGCATGTGTTCCTCAACGGCTCCATGTCTTCCGTCCAAGGATCGGCCAATGACCCAGTTTTTGTCTTGCACCATGCTTTTGTCGACAGCATCTTTGAGCAATGGCTCAGAAGACACGGAGCTTCAGTAGACATTTACCCAGAAGCCAATGCACCAATTGGCCACAATCGTGGCTACTACATGGTTCCATTTATTCCTCTATACACAAATGGAGAATTCTTTGCCGCTTCTAGAGATCTTGGATATGATTACGATTATCTAGCAGAATCAGGTTCCATTGAAGACTTCCTTTTGCCCTACCTGGAGCAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTT
  5   1   2       bld Eye                                  CCAX3090.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGTCATTAACAAATTATGAAACGGAGCCCATGGATCGGTCGGCCAACTTTAGCTTCAGGAACACCCTGGAAGGATTTGCAGATCCACGAACTGGGATAGCCAACCGCTCTCAAAGCAACATGCATAACTCGCTGCATGTGTTCCTCAACGGCTCCATGTCTTCCGTCCAAGGATCGGCCAATGACCCAGTTTTTGTCTTGCACCATGCTTTTGTCGACAGCATCTTTGAGCAATGGCTCAGAAGACACGGAGCTTCAGTAGACATTTACCCAGAAGCCAATGCACCAATTGGCCACAATCGTGGCTACTACATGGTTCCATTTATTCCTCTATACACAAATGGAGAATTCTTTGCCGCTTCTAGAGATCTTGGATATGATTACGATTATCTAGCAGAATCAGGTTCCATTGAAGACTTCCTTTTGCCCTACCTGGAGCAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTAT
  5   1   2       bld Eye       in                         CCAX9636.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGTCGGCCAACTTTAGCTTCAGGAACACCCTGGAAGGATTTGCAGATCCACGAACTGGGATAGCCAACCGCTCTCAAAGCAACATGCATAACTCGCTGCATGTGTTCCTCAACGGCTCCATGTCTTCCGTCCAAGGATCGGCCAATGACCCAGTTTTTGTCTTGCACCATGCTTTTGTCGACAGCATCTTTGAGCAATGGCTCAGAAGACACGGAGCTTCAGTAGACATTTACCCAGAAGCCAATGCACCAATTGGCCACAATCGTGGCTACTACATGGTTCCATTTATTCCTCTATACACAAATGGAGAATTCTTTGCCGCTTCTAGAGATCTTGGATATGATTACGATTATCTAGCAGAATCAGGTTCCATTGAAGACTTCCTTTTGCCCTACCTGGAGCAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACT
  5   1   2       bld TpA                            TTpA025i02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCCGGGCCCTGGGGAAGGATTTGCAGATCCACGAACTGGGATAGCCAACCGCTCTCAAAGCAACATGCATAACTCGCTGCATGTGTTCCTCAACGGCTCCATGTCTTCCGTCCAAGGATCGGCCAATGACCCAGTTTTTGTCTTGCACCATGCTTTTGTCGACAGCATCTTTGAGCAATGGCTCAGAAGACACGGAGCTTCAGTAGACATTTACCCAGAAGCCAATGCACCAATTGGCCACAATCGTGGCTACTACATGGTTCCATTTATTCCTCTATACACAAATGGAGAATTCTTTGCCGCTTCTAGAGATCTTGGATATGATTACGATTATCTAGCAGAATCAGGTTCCATTGAAGACTTCCTTTTGCCCTACCTGGAGCAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACAT
  5   1   2       bld Eye       in                         CCAX4286.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGGGATAGCCAACCGCTCTCAAAGCAACATGCATAACTCGCTGCATGTGTTCCTCAACGGCTCCATGTCTTCCGTCCAAGGATCGGCCAATGACCCAGTTTTTGTCTTGCACCATGCTTTTGTCGACAGCATCTTTGAGCAATGGCTCAGAAGACACGGAGCTTCAGTAGACATTTACCCAGAAGCCAATGCACCAATTGGCCACAATCGTGGCTACTACATGGTTCCATTTATTCCTCTATACACAAATGGAGAATTCTTTGCCGCTTCTAGAGATCTTGGATATGATTACGATTATCTAGCAGAATCAGGTTCCATTGAAGACTTCCTTTTGCCCTACCTGGAGCAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTC
  5   1   2       bld Tad0                               IMAGE:6984543                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTAACAGCTGGACGGNCCGGAATTCCCGGGATGTTTTTGTCTTGCACCATGCTTTTGTCGACAGCATCTTTGAGCAATGGCTCAGAAGACACGGAGCTTCAGTAGACATTTACCCAGAAGCCAATGCACCAATTGGCCACAATCGTGGCTACTACATGGTTCCATTTATTCCTCTATACACAAATGGAGAATTCTTTGCCGCTTCTAGAGATCTTGGATATGATTACGATTATCTAGCAGAATCAGGTTCCATTGAAGACTTCCTTTTGCCCTACCTGGAGCAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAAATGTGGAAGTAACTAGTTTTAACCCATTTTATTTGCTAGGACTTGGGTTCCAGGGACCACAGACAGCTTCAACTAAGGCCCACTCTCCGTCTTCCCCACTTTATTCCCTAAGACTTCCCTAAATTAAACTTTTCTTCCATTTCCCTTTGTCCCTAAAAAAGGAAAAACCTGGTCCGCAAAAGGAAAGTTGGGGAACGGGCCCCCATACCGGCCGGG
  5   1   2       chi Tad0      in                       IMAGE:6981904                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACGGCTGNACGGGTCGGATTCCGGGATCTTTGAGCAATGGCTCGAAGACACGGAGCTTCAGTAGACATTTACCCAGAAGCCAATGCACCAATTGGCCACAATCGTGGCTACTACATGGTTCCATTTATTCCTCTATACACAAATGGAGAATTCTTTGCCGCTTCTAGAGATCTTGGATATGATTACGATTATCTAGCAGAATCAGGTTCCATTGAAGACTTCCTTTTGCCCTACCTGGAGCAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTTCGTGAACAAGATTGTATACTAATTTTTATATTCGGTGGGCGCCAACTGTGTGCTCCTTGTCTGATGGGGGTAAGAACGAGCTTCAACCCTTTCTATCGTCTAGTATATGGTTCCAAGGACTCACCGAATGTCACTGTATACCGTGCCCTTCTACTCCGTCTACCCGTTATGCTCCTACAGAGTTCCCCTACCTCATCTTTATCCTCAAATCCCCCCTCGCACTCTATCTATTCAAGACGTGATTCTCCTCCTGAACCTCCTGTTAAATTCTCTAACTACTTCAGTCTAGTCACTTGCTCGTATTCCCACTTC
  5   1   2       bld Ova1      in                         CABE4920.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTGCACCATGCTTTTGTCCCAGCATCTTTGAGCAATGGCTCAGAAGACACGGAGCTTCAGTAGACATTTACCCAGAAGCCAATGCACCAATTGGCCACAATCGTGGCTACTACATGGTTCCATTTATTCCTCTATACACAAATGGAGAATTCTTTGCCGCTTCTAGAGATCTTGGATATGATTACGATTATCTAGCAGAATCAGGTTCCATTGAAGACTTCCTTTTGCCCTACCTGGAGCAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTtccatttctcctctttgttctcttatagagatggagaatgaccatggtctcggcataacaggcaaatggttgggtgagcagggggtcccacctatacctcggcccactgggactttCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGA
  5   1   2       bld HdA                           THdA031p15.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATTGTTGACAGCATCTTTGAGCAATGGCTCAGAAGACACGGAGCTTCAGTAGACATTTACCCAGAAGCCAATGCACCAATTGGCCACAATCGTGGCTACTACATGGTTCCATTTATTCCTCTATACACAAATGGAGAATTCTTTGCCGCTTCTAGAGATCTTGGATATGATTACGATTATCTAGCAGAATCAGGTTCCATTGAAGACTTCCTTTTGCCCTACCTGGAGCAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTTCCATTTCTCCTCTTTGTTCTCTTATAGAGATGGAGAATGACCATGGTCTCGGCATACAGGCAAATGGTTGGGTGAAGCAGGGGGTCCCACCTATACCTCGGCCCACTGGGACTTTCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGNAGAGGAAAGTCATATTGCCCAGTCAAGTGGGATAGAGGGTTAATCAAGTTGTGTAACACANCATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCT
  5   1   2       bld TpA                            TTpA052m11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGCTTCAGTAGACATTTACCCAGAAGCCAATGCACCAATTGGCCACAATCGTGGCTACTACATGGTTCCATTTATTCCTCTATACACAAATGGAGAATTCTTTGCCGCTTCTAGAGATCTTGGATATGATTACGATTATCTAGCAGAATCAGGTTCCATTGAAGACTTCCTTTTGCCCTACCTGGAGCAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTTCCATTTCTCCTCTTTGTTCTCTTATAGAGATGGAGAATGACCATGGTCTCGGCATAACAGCAAATGGTTGGGTGAGCAGGNNGTCCCACCTATACCTCGGCCCACTGGGACTTTCCCATAT
  5   1   2       bld Tad5                                  XZT8444.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCGCGTCGCATTTTTCCTCTATCACAAATGGAGAATTCTTTGCCGCTTCTAGAGATCTTGGATATGATTACGATTATCTAGCAGAATCAGGTTCCATTGAAGACTTCCTTTTGCCCTACCTGGAGCAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTtccatttctcctctttgttctcttatagagatggagaatgaccatggtctcggcataacaggcaaatggttgggtgagcagggggtcccacctatacctcggcccactgggactttCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTG
  5   1   2       bld Ova1      in                        CABE12476.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGAGGCACAAATGGAGAATTCTTTGCCGCTTCTAGAGATCTTGGATATGATTACGATTATCTAGCAGAATCAGGTTCCATTGAAGACTTCCTTTTGCCCTACCTGGAGCAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTtccatttctcctctttgttctcttatagagatggagaatgaccatggtctcggcataacaggcaaatggttgggtgagcagggggtcccacctatacctcggcccactgggactttCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCT
  5   1   2       bld Tbd1      in                         CBXT1248.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAGATCTTGGATATGATTACGATTATCTAGCAGAATCAGGTTCCATTGAAGACTTCCTTTTGCCCTACCTGGAGCAAGCGCGACAGATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACAGTGTCGGACTTGGGTGCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTTCCATTTCTCCTCTTTGTTCTCTTATAGAGATGGAGAATGACCATGGTCTCGGCATAACAGGCAAATGGTTGGGTGAGCAGGGGGTCCCACCTATACCTCAGCCCACTGGGACTTTCCCAATATCCCGGGGACCCAGTCGGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATAT
  3   1   2       bld Ova1      in                        CABE12476.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATATGATTACGATTATCTAGCAGAATCAGGTTCCATGAAAGACTTCCTTTTGCCCTACCTGGAGCAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTtccatttctcctctttgttctcttatagagatggagaatgaccatggtctcggcataacaggcaaatggttgggtgagcagggggtcccacctatacctcggcccactgggactttCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATTGGGAGAAAAAA
  3   1   2       bld Ova1      in                         CABE4920.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCAGAATCAGGTTCCATTGAAGACTTCCTTTTGCCCTACCTGGAGCAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTtccatttctcctctttgttctcttatagagatggagaatgaccatggtctcggcataacaggcaaatggttgggtgagcagggggtcccacctatacctcggcccactgggactttCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATGTTGGGAG
  3   1   2       bld Lun1      in                         CABD6751.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCAGAATCAGGTTCATTGAAGATTTCCTTTGCCCTACCTGGAGCAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTtccatttctcctctttgttctcttatagagatggagaatgaccatggtctcggcataacaggcaaatggttgggtgagcagggggtcccacctatacctcggcccactgggactttCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATAAGATAAAAAAAAC
  3   1   2       bld Eye       in                         CCAX8996.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATCAGGTTCCATTGAAGACTTCCTTTTGCCCTACCTGGAGCAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTTCCATTTCTCCTCTTTGTTCTCTTATAGAGATGGAGAATGACCATGGTCTCGGCATAACAGGCAAATGGTTGGGTGAGCAGGGGGTCCCACCTATACCTCGGCCCACTGGGACTTTCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATA
  3   1   2       bld Ova1      in                         CABE6494.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTACCGGGAGCAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTtccatttctcctctttgttctcttatagagatggagaatgaccatggtctcggcataacaggcaaatggttgggtgagcagggggtcccacctatacctcggcccactgggactttCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATTTGGGAG
  3   1   2       bld Tad5 5g3  in                         XZT53210.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAGCGCGACAAATCTGGCAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATTGACTACAGGCCCACTTTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTTTTCCTtccatttttcctctttgttctcttatagagatggagaatgaccatggtctcggcataacaggcaaatggttgggtgagcagggggtcccacctatacctcggcccactgggactttCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATTTGGGGG
  3   1   2       bld TbA  5g3  in                    TTbA004k19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGTGGCTGGTAGGCGCGGCTGTAGTTGGGGGACTCATTACTGCTGTGATTGCCACTATTGTCGGCTTGGCGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTtccatttctcctctttgttctcttatagagatggagaatgaccatggtctcggcataacaggcaaatggttgggtgagcagggggtcccacctatacctcggcccactgggactttCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCACATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATT
  3   1   2       chi Tad0      in                       IMAGE:6981904                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGAATTTAGGTGGAGGGAAGTAGATGTTACAATAGGGGAGGGAGGATACGGGAGAAGTTAAGTGAAGTTGGGAGTGAGTAGTGAATGAAAATGAATAATTTTTGAGAGAATAAAGTGTGATGGTGGAAATAATAATGGATAAGAATGAGGAGGGTAAGAAGTAGCGGGCATATGAGTTGAGATTAGTATTGATGAATAATGAGAGACAGTATATGAGTGGGTGGAACGAAAAGTATGATCTTAGTGCAAAGGGGGTGTAGCAAGATTTAACTGGTGGTAAAGGGTGAGACTTTGGATAATGGGACGCACAGAAAGCGATCGAATACAGGCCCACTCTCGGTCCTTGTCTCACTTTATTGTAGTAATGACTTCTCCTTACATTCAACCTTCTTCCTtccatttctcctctttgttctcttatagagatggagaatgaccatggtctcggcataacaggcaaatggttgggtgagcagggggtcccacctatacctcggcccactgggactttCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTAAATTCCATTGTAAGGGCTCAAGTAATTA
  3   1   2       bld Eye       in                         CCAX1922.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACTGCTGTGATTGCCCACTATTTGTCGGCTTGGCGGTGCCGACGGAAAAGAAAATTCCCATCGGAGGAAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTTCCATTTCTCCTCTTTGTTCTCTTATAGAGATGGAGAATGACCATGGTCTCGGCATAACAGGCAAATGGTTGGGTGAGCAGGGGGTCCCACCTATACCTCGGCCCACTGGGACTTTCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATTTGGGAG
  3   1   2       bld TbA       in                    TTbA067m04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCTTGGCGTGCCGACGGAAAAGAAAATTTCCATTGGAGGAAAAGCAGCCGCTGTTTATGGAAGCCGAAGATTATTAACCCACCTATCAGTTTCACCTATAGAACCCAAACACTAGGTAACTGTAACTAGGTATTTGTGAACAAATTTGTATACTAATTTTTATATTCGGGGGGAGCCAACAGGGTGGTCCTTGTTTAATGTGGGAAGTAAATAGTTTTAACCCATTTTATTGCCTAAGAATTGGGTTTCAGGGACCCCCAGAACAGCATTGATTACAGGGCCACTTTCCGTCCTTTTTTCACTTTATTTTTTTAAAGAATTTTCCTTACATTCAACCTTTTTCCTTCCATTTTTCCTTTTTGTTTTTTTATAGAGAAGGGGAATGACCATGGTTTTGGCATAACaggcaaatggttgggtgagcagggggttccacctataccttggcccactgggagttttccAATATTCCGGGGACCCAGTTCGACACTGGCCTTGAGAGGAAAGTCATTTTGCCCCGTCAAGTGGGTAGAGGGTTAATCAAGTTGTGTAACCCCCAAAGTACTTTTTTTAAATATATATATAAAAAAAATATTTAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTTCAAAGGTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGGTACAAGTAAATAATTTTTGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1 5g3  in                         CBXT7476.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAAGAAAATTCCCATCGGAGGAAACGCAGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTTCCATTTCTCCTCTTTGTTCTCTTATAGAGATGGAGAATGACCATGGTCTCGGCATAACAGGCAAATGGTTGGGTGAGCAGGGGGTCCCACCTATACCTCGGCCCACTGGGACTTTCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATTTGGGAGAAAAAAAAAAAAAAA
  3   1   2       bld Eye  5g3  in                         CCAX5063.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAACGCAGCCGCTGCTCATAGAAGCCGAAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTTCCATTTCTCCTCTTTGTTCTCTTATAGAGATGGAGAATGACCATGGTCTCGGCATAACAGGCAAATGGTTGGGTGAGCAGGGGGTCCCACCTATACCTCGGCCCACTGGGACTTTCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATTTGGGAG
  3   1   2       bld Eye       in                         CCAX4286.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCCGCTGCTCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTTCCATTTCTCCTCTTTGTTCTCTTATAGAGATGGAGAATGACCATGGTCTCGGCATAACAGGCAAATGGTTGGGTGAGCAGGGGGTCCCACCTATACCTCGGCCCACTGGGACTTTCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATTTGGGAG
  3   1   2       bld Tbd1      in                         CBXT1248.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCATGGAAGCCGAAGATTATCAACCCACCTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTTTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACAGTGTCGGACTTGGGTGCCAGGGACCCACAGAACAGCATTGATTACAGGCCCACTTTCCGTCCTTTTTTCACTTTATTTTTTTAATGAATTTTCCTTACATTCAACCTTTTTCCTTCCATTTTTCCTTTTTGTTTTTTTATAGA
  3   1   2       bld Tad5                                 XZT72084.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTATCAGTCTCACCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTtccatttctcctctttgttctcttatagagatggagaatgaccatggtctcggcataacaggcaaatggttgggtgagcagggggtcccacctatacctcggcccactgggactttCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATTTGGGAGAAATTTGTCCGATTTATTTTGCATTGTGGTGCATTTAACGTGATTTGTTATATCAGGTATCATTTACTGATTGATCAAAATTGGCTAAAGGCTTATACAAGCAGGAAAGGGCAATGCCCACTACTTCTATGTTGCTGGACTTCAACTCCTGGTATGCCCAGTAGAGATGAGCGAATCTGTCCTGTTTTGCTTCGCCATAAAATTCACGAAACAGCGAAAAATTAGCG
  3   1   2       bld HdA  5g3  in                   THdA017n21.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTATAGAACCCAAACACTAGCTAACTGTAACTAGCTACTCGTGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGCTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTtccatttctcctctttgttctcttatagagatggagaatgaccatggtctcggcataacaggcaaatggttgggtgagcagggggtcccacctatacctcggcccactgggactttCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATTTGGGAGAAATTTGTCCGATTTATTTTGCATTGTGGTGCATTTAACGTGATTTGTTATATCAGGTATCATTTACTGATTGATCAAAATTGGCTAAAGGCTTATACAAGCAGGAAAGGGCAATGCCCACTACTTCTATGTTGCTGGACTTCAACTCCTGGTATGCCCAGTAGAGATGAGCGAATCTGTCCTGTTTTGCTTCGCCATAAAATTCACGAAACAGCGAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Eye  5g3  in                         CCAX1356.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTACTCGTGGAACAAATTTGTATACTAATTTTTATATTCGGTGGGAGCCAACTGTGTGCTCCTTGTCTAATGTGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATCGACTACAGGCCCACTCTCCGTCCTTCTCTCACTTTATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTTCCATTTCTCCTCTTTGTTCTCTTATAGAGATGGAGAATGACCATGGTCTCGGCATAACAGGCAAATGGTTGGGTGAGCAGGGGGTCCCACCTATACCTCGGCCCACTGGGACTTTCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACCCAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATTTGGGAG
  3   1   2       bld TpA       in                   TTpA047g04.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATTTGTATACTAATTTTTATATTGGGTGGGAGCCAACGGTGTGCTCCTTGTTTAATGGGGGAAGTAACTAGTTTTAACCCATTTTATTGCCTAAGACTTGGGTTCCAGGGACCCACAGAACAGCATTGATTACAGGCCCACTTTCGGTCCTTTTTTCACTTTATTTTTTTAAAGAATTTTCCTTACATTAAACCTTTTTCCTTCCATTTTTCCTTTTTGTTTTTTTAAAGAGAGGGAGAATGACCATGGTTTTTGCATAACAGGCAAATGGTTGGGTGAGCAGGGGGTCCCACCTATACTTTGGCCCACTGGGATTTTCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACCCCCAATGTACTTTTTTTAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTTCCATGTGATAAGGGCTACAAGTAAATAATATTGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Eye  5g3  in                         CCAX7093.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTCTCTTAATGACTTCTCCTTACATTCAACCTTCTTCCTTCCATTTCTCCTCTTTGTTCTCTTATAGAGATGGAGAATGACCATGGTCTCGGCATAACAGGCAAATGGTTGGGTGAGCAGGGGGTCCCACCTATACCTCGGCCCACTGGGACTTTCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATTTGGGAGAAATTTGTCCGATTTATTTTGCATTGTGGTGCATTTAACGTGATTTGTTATATCAGGTATCATTTACTGATTGATCAAAATTGGCTAAAGGCTTATACAAGCAGGAAAGGGCAATGCCCACTACTTCTATGTTGCTGGACTTCAACTCCTGGTATGCCCAGTAGAGATGAGCGAATCTGTCCTGTTTTGCTTCGCCATAAAATTCACGAAACAGCGAAAAATTAGCG
  3   1   2       bld Eye       in                         CCAX1181.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGCATAACAGGCAAATGGTTGGGTGAGCAGGGGGTCCCACCTATACCTCGGCCCACTGGGACTTTCCCAATATCCCGGGGACCCAGTCCGACCCTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACCCAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATTTGGGGG
  3   1   2       bld HdA                             THdA046i08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAATGGTTGGGTGAGCAGGGGGTCCCACCAAAACCTCGGCCCAATGGGACTTTCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTTCCATGTGATAAGGGGCTAACAAGTAAATAATATTGGGAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Eye       in                         CCAX9636.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCAGGGGGTCCCCCCTATACCTCGGCCCACTGGGACTTTCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACCCAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATTTGGG
  5   1   2       bld Tbd1      in                        CBXT12902.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGGTCCCACCTATACCTCGGCCCACTGGGACTTTCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATTTGGGAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                        CBXT12902.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGGTCCCACCTATACCTCGGCCCACTGGGACTTTCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATTTGGGAAAAAAAAAAAAAAA
  5   1   2       bld Tbd1      in                         CBXT1584.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCCCACTGGGACTTTCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATTTGGGAGAAAAAAAAAAAAAAAAAAAAAAAAAAATAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                         CBXT1584.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCCCACTGGGACTTTCCCAATATCCCGGGGACCCAGTCCGACACTGGCCTTGAGAGGAAAGTCATATTGCCCAGTCAAGTGGATAGAGGGTTAATCAAGTTGTGTAACACACAATGTACTTTTTATAAATATATATATAAAAAATATATATAATATGTATACTTCCCAATTGATATGCCCAGCCATCCCTATATGTACAAAGCTGAAAGATTAAGGTTTAAATTCCATGTGATAAGGGCTACAAGTAAATAATATTTGGGAGAAAAAAAAAAAAAAAAAAAAAAAAAAATAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)