Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 76%

 1012074715 Xt7.1-CBSS2143.3 - 37 ESTs
                                                                       .....-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CBSS2143.3                TGTAGTTGTGTTCAGTGTCACGGACGCACCTGAGAGAAGGAAGGTACCACTGGCAGAAATAAAAATCAGCATGTCTTCAGATGATTTTGAACCTGAGAAGGGGGACACTGTATCCTCAAAACTGCTTAAGAAGACTAAGGAATCTCCCTTTGTCCCAATAGGAATGGCTGGGTTTCTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCGCCGCTCAGGGATTCGTGGTTGGCGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAATTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCCTTAGATTGTAAGCTCTTGGGAGACGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTAAATTGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGTGCACTATATAAATAAATGATGATGATGACTCTGAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008227208                      TGTGTTCAGTGTCACGGACGCACCTGAGAGAAGGAAGGTACCACTGGCAGAAATAAAAATCAGCATGTCTTCAGATGATTTTGAACCTGAGAAGGGGGACACTGTATCCTCAAAACTGCTTAAGAAGACTAAGGAATCTCCCTTTGTCCCAATAGGAATGGCTGGGTTTCTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCGCCGCTCAGGGATTCGTGGTTGGCGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAATTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCCTTAGATTGTAAGCTCTTGGGAGACGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTAAATTGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGTGCACTATATAAATAAATGATGATGATGACTCTGAAAAAA
                                                      consensus depths                     3     3     7     7     8    10     9    12    12    14    13    14    13    14    13    14    13    15    13    15    13    15    13    15    13    15    15    16    16    16    18    18    18    18    18    18    18    18    18    18    18    18    19    19    19    19    19    19    23    23    25    25    25    25    24    24    24    24    27    27    27    27    29    29    27    28    29    29    29    31    30    31    30    32    30    32    30    32    30    32    30    32    30    32    30    32    31    32    30    31    29    31    28    31    29    31    29    31    29    31    28    31    25    28    28    29    28    29    26    29    24    29    26    28    25    27    25    27    25    27    24    26    24    26    24    27    24    27    23    27    24    27    24    27    24    27    24    26    22    24    21    24    21    23    21    23    21    23    21    23    21    23    20    23    19    22    19    22    19    22    19    21    16    19    17    18    16    18    17    18    16    18    15    16    13    14     2     4
                                                                   SNP                                                    -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                    ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                        -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------T---
                                               BLH ATG      70     176                
                                               BLH MIN      70      30                
                                               BLH MPR      52      30                
                                               BLH OVR      70      25                
                                               CDS MIN      70      16                
                                               EST CLI      10      16                
                                                                                                                                                               PREDICTED - Sp ---- 8e-010     XP_786453.1 PREDICTED: similar to CG17734-PA, isoform A [Strongylocentrotus purpuratus] ===============================================================================================================================
                                                                                                                                                            PROTEIN === Dm ==== 2e-015     NP_610583.1 CG11825-PA [Drosophila melanogaster] ==================================================================================================================================================================================
                                                                                                                                          PREDICTED - Gg ---- 4e-024     NP_001026128.1 hypothetical protein LOC420392 [Gallus gallus] ================================================================================================================================================================================================
                                                                                                                                          PROTEIN --- Hs ---= 4e-024     NP_054775.1 DKFZP564K247 protein [Homo sapiens] ==================================================================================================================================================================================================
                                                                                                                                                                           PROTEIN --- Dr ---- 3e-024     NP_956394.1 Unknown (protein for MGC:77692) [Danio rerio] ==========================================================================================================================================================
                                                                                                                                                            PROTEIN === Mm ==== 6e-028     NP_001002900.1 HIG1-4 protein [Mus musculus] ==================================================================================================================================================================================================
                                                                                                                                                            PROTEIN === Xl ==== 2e-043     AAH70655.1 MGC82223 protein [Xenopus laevis] ===========================================================================================================================================================================================================
                                                                                                                                                            PREDICTED = ?? ==== 2e-043     NP_001084777.1 hypothetical protein LOC431813 [Xenopus laevis] =========================================================================================================================================================================================
                                                                                                                                                            PREDICTED = Xt ==== 2e-047     AAH88085.1 Hypothetical LOC496791 [Xenopus tropicalis] =================================================================================================================================================================================================
                                                      Xt7.1-CBSS2143.3                                                                                      ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------ATG---------------------ATG------------------------------------TAA------TGA---------------------------------------------------------------------------------------TGA---------TAA---------ATG------------------------------TGA------------TAG------------------------TGA------------TGATGA---------ATG---TGA------------------TGA---------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------ATGATGATGTAA---------ATG------------------------------------ATG------TAG---------------------------------------------------------TAA---------------------TGA------------------------------TAA---------TGA---------------------------------------------TGATGATGATGA---TGA
                                                                   ORF                                                                                      ... open reading frame                                                                                                                                                                                                                                                                ]
  5   1   1           AbdN FL                     IMAGE:7025527.FL-MGC                              GTGTCACGGACGCACCTGAGAGAGGGAAGGTACCACTGGCAGAAATAAAAATCAGCATGTCTTCAGATGATTTTGAACCTGAGAAGGGGGACACTGTATCCTCAAAACTGCTTAAGAAGACTAAGGAATCTCCCTTTGTCCCAATAGGAATGGCTGGGTTTCTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCGCCGCTCAGGGATTCGTGGTTGGTGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAGTTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCCTTAGATTGTAAGCTCTTGGGAGACGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTAAATTGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGTGCACTATATAAATAAATGATGATGATGACTCTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FL                     TEgg077e15.FL-Sanger                                                AGAGAGGGAAGGTACCACTGGCAGAAATAAAAATCAGCATGTCTTCAGATGATTTTGAACCTGAGAAGGGGGACACTGTATCCTCAAAACTGCTTAAGAAGACTAAGGAATCTCCCTTTGTCCCAATAGGAATGGCTGGGTTTCTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCGCCGCTCAGGGATTCGTGGTTGGCGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAATTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCCTTAGATTGTAAGCTCTTGGGAGACGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTAAATTGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGTGCACTATATAAATAAATGATGATGATGACTCTGAAAAAAAAAAAAAAAAAA
  5   1   2       bld BrSp 5g3  in                      EC2BBA7CG01.g1 GGGGAGGGCCTGGTTTGTAGTTGTGTTCAGTGTCACGGACGCACCTGAGAGAAGGAAGGTACCACTGGCAGAAATAAAAATCAGCATGTCTTCAGATGATTTTGAACCTGAGAAGGGGGACACTGTATCCTCAAAACTGCTTAAGAAGACTAAGGAATCTCCCTTTGTCCCAATAGGAATGGCTGGGTTTCTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCGCCGCTCAGGGATTCGTGGTTGGCGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTT
  5   1   2       bld BrSp 5g3  in                     EC2BBA32CE04.g1    GGGGCCCTGGTATGTAGTTGTGTTCAGTGTCACGGACGCACCTGAGAGAAGGAAGGTACCACTGGCAGAAATAAAAATCAGCATGTCTTCAGATGATTTTGAACCTGAGAAGGGGGACACTGTATCCTCAAAACTGCTTAAGAAGACTAAGGAATCTCCCTTTGTCCCAATAGGAATGGCTGGGTTTCTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCGCCGCTCAGGGATTCGTGGTTGGCGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTGGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCCAAGTGAGCATTTAACAACTGATGACGTTTGTTCATGGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTA
  5   1   2       bld BrSp 5g3  in                     EC2BBA28CD08.g1                GGGAGTTGTGTTCAGTGTCACGGACGCACCTGAGAGAAGGAAGGTACCACTGGCAGAAATAAAAATCAGCATGTCTTCAGATGATTTTGAACCTGAGAAGGGGGACACTGTATCCTCAAAACTGCTTAAGAAGACTAAGGAATCTCCCTTTGTCCCAATAGGAATGGCTGGGTTTCTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCGCCGCTCAGGGATTCGTGGTTGGCGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTGGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTACAATTTAGCTGAACCCCAACCC
  5   1   2       bld BrSp 5g3  in                     EC2BBA26AG07.g1                      GGGGTTCAGTGTCACGGACGCACCTGAGAGAAGGAAGGTACCACTGGCAGAAATAAAAATCAGCATGTCTTCAGATGATTTTGAACCTGAGAAGGGGGACACTGTATCCTCAAAACTGCTTAAGAAGACTAAGGAATCTCCCTTTGTCCCAATAGGAATGGCTGGGTTTCTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCGCCGCTCAGGGATTCGTGGTTGGCGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTGGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCCAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCCAAGTGAGCATTTAACAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGTATTCAGCAAACACAAACCCTTTTGG
  5   1   2       bld BrSp 5g                         EC0CBA004AH02.g1                          GGGAGTGTCACGGACGCACCTGAGAGAAGGAAGGTACCACTGGCAGAAATAAAAATCAGCATGTCTTCAGATGATTTTGAACCTGAGAAGGGGGACACTGTATCCTCAAAACTGCTTAAGAAGACTAAGGAATCTCCCTTTGTCCCAATAGGAATGGCTGGGTTTCTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCGCCGCTCAGGGATTCGTGGTTGGCGCTATGACCTTTGGTGTAGTATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTGGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCCAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCCAAGTGAGCATTTTACAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAAT
  5   1   2       bld BrSp 5g                          EC2BBA28AA01.g1                          GGGAGTGTCACGGACGCACCTGAGAGAAGGAAGGTACCACTGGCAGAAATAAAAATCAGCATGTCTTCAGATGATTTTGAACCTGAGAAGGGGGACACTGTATCCTCAAAACTGCTTAAGAAGACTAAGGAATCTCCCTTTGTCCCAATAGGAATGGCTGGGTTTCTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCGCCGCTCAGGGATTCGTGGTTGGCGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTGGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCCAAGTGAGCATTTAACAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTT
  5   1   2   10  bld Spl2 5g3  in                        CBSS2143.fwd ..........................TCAGTGTCACGGACGCACCTGAGAGAGGGAAGGTACCACTGGCAGAAATAAAAATCAGCATGTCTTCAGATGATTTTGAACCTGAGAAGGGGGACACTGTATCCTCAAAACTGCTTAAGAAGACTAAGGAATCTCCCTTTGTCCCAATAGGAATGGCTGGGTTTCTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCGCCGCTCAGGGATTCGTGGTTGGCGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAATTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGNTAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTA
  5   1   2       chi AbdN FL                            IMAGE:7025527                             GTGTCACGGACTCACCTGAGAGAGGGAAGGTACCACTCGGCAGAAATAAAAATCAGCATGTCTTCAGATGATTTTGAACCTGAGAAGGGGGACACTGTATCCTCAAAACTGCTTAAGAAGACTAAGGAATCTCCCTTTGTCCCAATAGGAATGGCTGGGTTTCTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCGCCGCTCAAGGATTCGTGGTTGGTGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAAGTGTTCCCAAGATCAGACGTCTTCAGGTTGGCGCTGCCTGCCACTAGTGCCACATATCATCATTGTGTCTCCCTGCGTCTACGTACGTGTGCACCCGGCCCAACACTCTGATTGAAATACGGCTTAATCCCAGATAATTTAGTCCTATCCCCCGGCCCCCTTGGACCTTAAACAACGCTCATGCTTCCCGACCTCCATACTGCCCCTCGAGGACCACGACAGCTTTCACCCCAGGCGGTCGTCGCCTACCACATTGCCCTAAACCCCCGCACACTTAGTTAATACCCCCTACCTTTTGTCTTCCCTGCCACTCCCTGCAAACCCCGAGACCCCACCGCGCAACTTCTTGGGTGTTCGTGGGCGCTTAGGTATCTTGTGGCTCCTAACGCCTTAAGGTCTTTGCTGCCCCCGAATGGTATCGGCGTTACGAAGACATCGTCCGCTAGGTGCCGAAGACTGAACCCCATATGGCGTGGCTGGGCCCCAGGAGCCGCTAATTGGCCTGAAAACAGTCCACATCATTATACTAACGAGCGATGCACACACTCCGCAGCGATAGATTGGACTATGCATCTTCTTATGGGCTCTCCAACATCAAGGAC
  5   1   2   14  bld Brn4 5g3  in                        CAAL22894.5p ...................................CGGACGCACCTGAGAGAGGGAAGGTACCACTGGCAGAAATAAAAATCAGCATGTCTTCAGATGATTTTGAACCTGAGAAGGGGGACACTGTATCCTCAAAACTGCTTAAGAAGACTAAGGAATCTCCCTTTGTCCCAATAGGAATGGCTGGGTTTCTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCGCCGCTCAGGGATTCGTGGTTGGCGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAATTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTAGTAAGACTAATGTCACACT
  5   1   2       chi Egg                            TEgg006e03.p1kSP6                                      TCTTCCCATGATTTTGAACCTGCACAAGGGGGACACTGTATCCTCAAAACTGCTTAAGAAGACTAAGGATCTCCCTTTGTCCCAATAGTTCCAGAAGCCCCTGGAGATCTAGGTCCAAAATCCCTTGCCAGGCTGCCCTGAATGGCTGGGTTTCTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCCCCGCTCAGGGATTCGTGGTTGGTGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATAC
  5   1   2       bld Egg  FL   in                   TEgg077e15.p1kSP6                                                  AGAGGGAAGGTACCACTGGCAGAAATAAAAATCAGCATGTCTTCAGATGATTTTGAACCTGAGAAGGGGGACACTGTATCCTCAAAACTGCTTAAGAAGACTAAGGAATCTCCCTTTGTCCCAATAGGAATGGCTGGGTTTCTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCGCCGCTCAGGGATTCGTGGTTGGCGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAACATTCAGCATTCAGCAAACAC
  5   1   2       chi AbdN 5x                            IMAGE:7023169                                                    GGGAAGGTACCACTGCGCAGAAATAAAAATCAGCATGTCTTCAGATGATTTTGAACCTGAGAAGGGGGACACTGTATCCTCAAAACTGCTTAAGAAGACTAAGGAATCTCCCTTTGTCCCAATAGGAATGGCTGGGTTTCTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCGCCGCTCAGGGATTCGTGGTTGGTGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTACCAACTGATGACTTTTGTTCATGGGATGATGCCATTTTGCTCAAACGTGAGTGCAATTTAAGGTTTACATTCAATATGTGGCCAGATCTTTTCTTAAACATTTCACCATTCAACCAAAAAAAAACCCTTTTGGGAATTCTGGCATTTCCCTACTAAGGTAATAAATGTTTGTGCCTTTTTAAAAAAAAATTTCCCCCCAAGGTTTTTTAGAAAAAAAAATAAATTTTCCTTTGGTTTATAAAGGTGAACTTTCAACTGGCCGTCCCCTTCCCCCCATATTGATTGGTCGGTAAAAAGCCCTGCCCCTTTAATTGGGCTGGTGGTAAAAAGCCAATACCAGATTTTTTTATTTTTTTTAAGTTAAAGAACTAAGTTTGTTCACACTTTATATGGAAAAATTTTTGCCTCACCCACCCTTTTTTGTTATACTCCACCAATACTTTTTTTATATTTTTGCAAAAAAAATTTGGTCCCCCTTAAAAAAATATATGAAAAGCCTCTCTCTTTGGGAGAAGAAAAAGCGAGCCCCCCCCCCGAGAAAAACCCAAATTTTTTGTTATTCCCCCGGGANAACACCCCCACCCCCATATTAGATATAAAAAAAAGTGGTTGGGGGTATAGGGACACCCCCCCTTTGGTTTTTTTGTCTCTATAACAATGTGGATAAAACTGATGTGAA
  5   1   2   14  bld Te5  5g3  in                          CAAO422.5p ............................................................ACCACTGGCAGAAATAAAAATCAGCATGTCTTCAGATGATTTTGAACCTGAGAAGGGGGACACTGTATCCTCAAAACTGCTTAAGAAGACTAAGGAATCTCCCTTTGTCCTAATAGGAATGGCTGGGTTTCTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCGCCGCTCAGGGATTCGTGGTTGGCGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAACAA
  5   1   2   10  bld Thy1 5g3  in                        CBST7895.fwd .............................................................ACACTGGCAGAAATAAAAATCAGCATGTCTTCAGATGATTTTGAACCTGAGAAGGGGGACACTGTATCCTCAAAACTGCTTAAGAAGACTAAGGAATCTCCCTTTGTCCCAATAGGAATGGCTGGGTTTCTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCGCCGCTCAGGGATTCGTGGTTGGCGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAATTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCCTATGTGTGGNAAAGCGATCAGTTTTA
  5   1   2       bld Gas7                                  XZG8156.5p                                                                                                     TTTTGACCTGAGAGGGGGACACTGTATCCTCAAAACTGCTTAAGAAGACTAAGGAATCTCCCCTTTGTCCCAATAGGAATGGCTGGGTTTCTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCGCCGCTCAGGGATTCGTGGTTGGCGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCANACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGNTATGACCACAAGGTG
  5   1   2       bld Gas7      in                         XZG48306.5p                                                                                                                                                                  CCTTTGTCCCAATAGGAATGGCTGGGTTTCTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCGCCGCTCAGGGATTCGTGGTTGGTGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAGTTTTTAGAACAAATATTTCCTTGTTTAAAGAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGT
  5   1   2       bld Fat1      in                         CABC4522.5p                                                                                                                                                                                              TCTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCGCCGCTCAGGGATTCGTGGTTGGCGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAATTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCCTTAGATTGTAAGCTCTTGGGAGACGGGCCCTCTGATCCTATTTTTATCCTGTAACCCTTCGTTTGTAAATTGTTGTATGACCCCTGGTTTGTATAAAATGATGTAAAGTGCACTATATAAATAAATGATGATGATGACTCTGAAAAAAAAAA
  5   1   2       bld Gas7      in                         XZG25054.5p                                                                                                                                                                                               CTGGCTACAGTGGCCTATGGCGTGTACAGGATTCGCAGCAGAGGCCAGCAGAAGATGTCCGTGCATATTATTCACACAAGAGTCGCCGCTCAGGGATTCGTGGTTGGTGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAGTTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCCCTTAGAATGTA
  3   1   2      seed Spl2 5g3  in                        CBSS2143.rev                                                                                                                                                                                                                                                                    ATTCACACAAGAGTCGCCGCTCAGGGATTCGTGGTTGGCGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAATTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCCTTAGATTGTAAGCTCTTGGGAGACGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTAAATTGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGTGCACTATATAAATAAATGATGATGATGACTCTG
  3   1   2       bld BrSp 5g3  in                     EC2BBA26AG07.b1                                                                                                                                                                                                                                                                                                     GTTGGCGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTGGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCCAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCCAAGTGAGCATTTAACAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGTATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAGTTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCTTTAGATTGTAAGCTCTTTGGAGAAGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGT
  3   1   2       bld BrSp 5g3  in                      EC2BBA7CG01.b1                                                                                                                                                                                                                                                                                                     GTTGGCGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAGTTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCCTTAGATTGTAAGCTCTTGGGAGACGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGT
  3   1   2       bld Fat1      in                         CABC4522.3p                                                                                                                                                                                                                                                                                                          CGCTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAATTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCCTTAGATTGTAAGCTCTTGGGAGACGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTAAATTGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGTGCACTATATAAATAAATGATGATGATGACTCTG
  3   1   2       bld Thy1 5g3  in                        CBST7895.rev                                                                                                                                                                                                                                                                                                           GTTATGACCTTTGGTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCNCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAATTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCCTTAGATTGTAAGCTCTTGGGAGACGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTAAATTGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGTGCACTATATAAATAAATGATGATGACG
  3   1   2       bld BrSp 5g3  in                     EC2BBA28CD08.b1                                                                                                                                                                                                                                                                                                                        GTGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTGGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCCAAGTGAGCATTTAACAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAATATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAGTTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCTTTAGATTGTAAGCTCTTTGGAGAAGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTTAATTGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGTGCACTATATAAATA
  3   1   2       bld BrSp 5g3  in                     EC2BBA32CE04.b1                                                                                                                                                                                                                                                                                                                         TGTAATATATTCCATGTATAAAGAATACATCAAACCGCGTTTCAGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTGGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCCAAGTGAGCATTTAACAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGTATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAGTTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCTTTAGATTGTAAGCACTTTGGAGAAAGGGCCCATCTGATCCTATTTTTATTCCTGTA
  3  -1   2       bld Ova1      in                         CABE2648.3p                                                                                                                                                                                                                                                                                                                                                                    AGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAATTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCCTTAGATTGTAAGCTCTTGGGAGACGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTAAATTGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGTGCACTATATAAATAAATGATGATGATGACTCTGAAAAAAAAAAAAAAAAA
  5  -1   2       bld Ova1      in                         CABE2648.5p                                                                                                                                                                                                                                                                                                                                                                    AGCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAATTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCCTTAGATTGTAAGCTCTTGGGAGACGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTAAATTGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGTGCACTATATAAATAAATGATGATGATGACTCTG
  3   1   2       bld Egg  FL   in                    TEgg077e15.q1kT7                                                                                                                                                                                                                                                                                                                                                                     GCGATGAGTAAGAGAAGTGACTTCTCCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAATTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCCTTAGATTGTAAGCTCTTGGGAGACGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTAAATTGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGGCGGCTATATAAATAAATGATGATGATGACTCGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Brn4 5g3  in                        CAAL22894.3p                                                                                                                                                                                                                                                                                                                                                                                              CCAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAATTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCCTTAGATTGTAAGCTCTTGGGAGACGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTAAATTGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGTGCACTATATAAATAAATGATGATGATGACTCTG
  3   1   2       bld Gas7      in                         XZG25054.3p                                                                                                                                                                                                                                                                                                                                                                                               CAGTGTAATGACCACAAGGTGTTCCCAAGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAGTTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCCTTAGATTGTAAGCTCTTGGGAGACGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTAAATTGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGTGCCCTATATAAATAAATGATGATGATGACTCTG
  3   1   2       bld Te5  5g3  in                          CAAO422.3p                                                                                                                                                                                                                                                                                                                                                                                                                          AGATCAGACGTCTTCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAATTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCCTTAGATTGTAAGCTCTTGGGAGACGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTAAATTGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGTGCACTATATAAATAAATGATGATGATGACTCTG
  3   1   2       bld Gas7      in                         XZG48306.3p                                                                                                                                                                                                                                                                                                                                                                                                                                      TCAGTTTGGCGCTGCCTGCCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAGTTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCCTTAGATTGTAAGCTCTTGGGAGACGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTAAATTGTTGTATGACCCCCGTTTGTTATAAATGAATGTAAAGTGCCCTATATAAATAAATGATGATGATGACTCTGG
  5   1   2       bld TpA                            TTpA024e03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                       TCAGTTTGGCGCTGCCTGCCACTAGTGCCAGACAGCAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTATTCCACACTTGGGTTGGATCTGTCTGAATCCTTACAATTTAGCTGAACCCCAACCCTTTGCCTAACTGAGCATTTAGCAACTGATGACGTTAGTTCATGGGATGATGCCATTTTGCACAATCGCGAGTGCAATCTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATGCAGCATACAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGAAGTAATGTTGTGCTTTTAAACAAATTCCCCAAATTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCGGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCCTTAGATTGTAAGCTCTTGGGAGACGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTAAATAGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGTGCACTATATAAATAAATGATGATGATGACTCTG
  5  -1   2       bld Egg                            TEgg134e14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACTAGTGCCACAGAACAAAATTGAATCGCACTGTAACTAGTAGGGATGCACCTAATCCACACTTGGGTTGGATCTGTCTGAATCCTTAGAATTTAGCTGAACCCCAACCCTTTGCCTAAGTGAGCATTTAGCAACTGATGACGTTTGTTCATGGGATGATGCCATTTTGCTCAATCGTGAGTGCAATTTAGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGCATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAATTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCCTTAGATTGTAAGCTCTTGGGAGACGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTAAATTGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGTGCACTATATAAATAAATGATGATGATGA
  3   1   2       bld BrSp      in                     EC2BBA12CG12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGTATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAGTTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCTTTAGATTGTAAGCTCTTTGGAGAAGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTTAATTGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGTGCACTATATAAATA
  5   1   2       bld BrSp      in                     EC2BBA12CG12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGTATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAGTTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCTTTAGATTGTAAGCTCTTTGGAGAAGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTTAATTGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGTGCACTATATAAATAAATGATGATGATGACTCTGCAAAAAAAAAAAAAAAAAAAA
  5   1   2       chi In54                            IMAGE:8943208.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCCATGATACCCACGAGCCTCGCCTCTATTCGTCCCCTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCCTTAGATTGTAAGCTCTTGGGAGACGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTAAATTGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGTGCACTATATAAATAAATGATGATGATGACTCTGAATAATAATAGAGTGTATGGCCGTGGCCAATCAGTGCAATGCATCACACCTTGGAAGCAATTGGTGGCAGTTGCAGCTACAAAAAAAAAAAACTGTGTGCCATAAAGCTTAGGTTTCTTGTATCACATTTAGTAAGTACAACATATTAAAGCAACCACTGTAGCACTAGGCTTGGGCGGGTCTGCTAATGCTGGTATAGCTTTGTTTCTCATACCCCTATCCCTACCCCATGCAGTTTCAGTTGGATTTGTTACCCATTACTACTAACGGTCTCGTCAAAGAGGTCTTTCCATAAGCATCATCTCCTGTAGCAACCAAAGCTCG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)