Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

 This cluster: approximate FL confidence score = 76%

 1012074715 Xt7.1-CBSS2143.3 - 37 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                     3     3     7     7     8    10     9    12    12    14    13    14    13    14    13    14    13    15    13    15    13    15    13    15    13    15    15    16    16    16    18    18    18    18    18    18    18    18    18    18    18    18    19    19    19    19    19    19    23    23    25    25    25    25    24    24    24    24    27    27    27    27    29    29    27    28    29    29    29    31    30    31    30    32    30    32    30    32    30    32    30    32    30    32    30    32    31    32    30    31    29    31    28    31    29    31    29    31    29    31    28    31    25    28    28    29    28    29    26    29    24    29    26    28    25    27    25    27    25    27    24    26    24    26    24    27    24    27    23    27    24    27    24    27    24    27    24    26    22    24    21    24    21    23    21    23    21    23    21    23    21    23    20    23    19    22    19    22    19    22    19    21    16    19    17    18    16    18    17    18    16    18    15    16    13    14     2     4
                                                                   SNP                                                    -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                    ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                        -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------T---
                                               BLH ATG      70     176                
                                               BLH MIN      70      30                
                                               BLH MPR      52      30                
                                               BLH OVR      70      25                
                                               CDS MIN      70      16                
                                               EST CLI      10      16                
                                                                                                                                                               PREDICTED - Sp ---- 8e-010     XP_786453.1 PREDICTED: similar to CG17734-PA, isoform A [Strongylocentrotus purpuratus] ===============================================================================================================================
                                                                                                                                                            PROTEIN === Dm ==== 2e-015     NP_610583.1 CG11825-PA [Drosophila melanogaster] ==================================================================================================================================================================================
                                                                                                                                          PREDICTED - Gg ---- 4e-024     NP_001026128.1 hypothetical protein LOC420392 [Gallus gallus] ================================================================================================================================================================================================
                                                                                                                                          PROTEIN --- Hs ---= 4e-024     NP_054775.1 DKFZP564K247 protein [Homo sapiens] ==================================================================================================================================================================================================
                                                                                                                                                                           PROTEIN --- Dr ---- 3e-024     NP_956394.1 Unknown (protein for MGC:77692) [Danio rerio] ==========================================================================================================================================================
                                                                                                                                                            PROTEIN === Mm ==== 6e-028     NP_001002900.1 HIG1-4 protein [Mus musculus] ==================================================================================================================================================================================================
                                                                                                                                                            PROTEIN === Xl ==== 2e-043     AAH70655.1 MGC82223 protein [Xenopus laevis] ===========================================================================================================================================================================================================
                                                                                                                                                            PREDICTED = ?? ==== 2e-043     NP_001084777.1 hypothetical protein LOC431813 [Xenopus laevis] =========================================================================================================================================================================================
                                                                                                                                                            PREDICTED = Xt ==== 2e-047     AAH88085.1 Hypothetical LOC496791 [Xenopus tropicalis] =================================================================================================================================================================================================
                                                      Xt7.1-CBSS2143.3                                                                                      ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------ATG---------------------ATG------------------------------------TAA------TGA---------------------------------------------------------------------------------------TGA---------TAA---------ATG------------------------------TGA------------TAG------------------------TGA------------TGATGA---------ATG---TGA------------------TGA---------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------ATGATGATGTAA---------ATG------------------------------------ATG------TAG---------------------------------------------------------TAA---------------------TGA------------------------------TAA---------TGA---------------------------------------------TGATGATGATGA---TGA
                                                                   ORF                                                                                      ... open reading frame                                                                                                                                                                                                                                                                ]
  3   1   2       bld BrSp      in                     EC2BBA12CG12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGTATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAGTTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCTTTAGATTGTAAGCTCTTTGGAGAAGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTTAATTGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGTGCACTATATAAATA
  5   1   2       bld BrSp      in                     EC2BBA12CG12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGGTTTAGATTCAGTATGTGGTCAGATCTTTCGTTAAACATTCAGTATTCAGCAAACACAAACCTTTTGGATTCTGTGCATTCCTACTAGGTAGTAATGTTGTGCTTTTAAACAAATTCCCCAAGTTTTTAGAACAAATATTTCCTTGTTTAAAGTAACTCACTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCTTTAGATTGTAAGCTCTTTGGAGAAGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTTAATTGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGTGCACTATATAAATAAATGATGATGATGACTCTGCAAAAAAAAAAAAAAAAAAAA
  5   1   2       chi In54                            IMAGE:8943208.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCCATGATACCCACGAGCCTCGCCTCTATTCGTCCCCTGCTCCATCCCAAATGATGATGTAAAGCTGCCTTATGTGTGGGAAAGCGATCAGTTTTATTTTAGTAAGACTAATGTCACACTAGGAGATTTGCCAGCACTTTGTAGCTGCAACTTTTATTTTGAAAATTGCCCTTAGATTGTAAGCTCTTGGGAGACGGGCCCTCTGATCCTATTTTTATCCTGTAACCTTCGTTTGTTAAATTGTTGTATGACCCCTGTTTGTTATAAATGAATGTAAAGTGCACTATATAAATAAATGATGATGATGACTCTGAATAATAATAGAGTGTATGGCCGTGGCCAATCAGTGCAATGCATCACACCTTGGAAGCAATTGGTGGCAGTTGCAGCTACAAAAAAAAAAAACTGTGTGCCATAAAGCTTAGGTTTCTTGTATCACATTTAGTAAGTACAACATATTAAAGCAACCACTGTAGCACTAGGCTTGGGCGGGTCTGCTAATGCTGGTATAGCTTTGTTTCTCATACCCCTATCCCTACCCCATGCAGTTTCAGTTGGATTTGTTACCCATTACTACTAACGGTCTCGTCAAAGAGGTCTTTCCATAAGCATCATCTCCTGTAGCAACCAAAGCTCG

In case of problems mail me! (