Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 24 Nov 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-THdA026f06.5                          3 END     1           1       33                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012074782 Xt7.1-TTbA008f18.3 - 60 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                    2     3     4     5     7     8     8     9     8     9     9    10     9    10    13    13    13    13    14    15    15    16    16    16    16    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    18    18    18    18    18    19    18    19    18    20    18    20    19    21    19    21    19    21    19    21    19    21    19    22    20    22    20    22    20    22    20    22    20    22    21    22    21    22    21    22    21    22    21    22    21    22    22    23    22    23    23    24    23    24    23    24    23    25    22    24    22    24    23    24    23    24    23    24    22    23    21    21    21    21    20    20    20    20    20    20    20    20    21    21    21    21    20    20    20    20    18    20    19    20    18    19    17    18    15    16    14    15    13    14    14    15    13    14    12    14    12    14    12    13    12    14    11    14    11    13    11    12    11    12    11    12    11    12    11    12    11    12    11    12    12    13    12    13    12    13    11    12    11    12    11    12    11    12    11    12    11    12    11    11    10    12    10    11     8     9     9    10     9    10     9    10    10    11    10    11    10    11    10    11    10    11    10    11    13    14    16    17    18    19    19    20    19    21    19    21    19    21    20    21    19    21    19    21    19    22    19    22    20    23    20    23    22    24    22    24    23    24    23    24    23    24    23    24    23    24    24    27    26    28    27    29    24    28    27    28    26    28    25    27    24    27    23    27    23    26    25    26    25    26    24    26    23    26    25    26    24    26    25    26    22    26    22    25    23    25    24    25    24    25    24    25    23    25    23    25    24    25    23    25    23    25    22    25    23    26    24    25    23    25    23    26    24    26    25    25    24    25    23    25    23    25    22    24    17    22    19    22    16    20    16    19    15    18    11    17     6     8     3     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------C-C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----------C
                                               BLH ATG     198    1378                                                                                                                                                                                                                                                                               
                                               BLH MIN     189     152                                                                                                                                                                                                                                                                               
                                               BLH OVR     198    1539                                                                                                                                                                                                                                                                               
                                               ORF LNG     198      61                                                                                                                                                                                                                                                                               
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Br ==== 4e-019     ABD62780.1 Rx homeobox protein [Branchiostoma lanceolatum] ===================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Bb ---- 6e-021     ABK54280.1 Pax3/7 [Branchiostoma belcheri] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                          PROTEIN --- Ce ---- 9e-026     NP_001024213.1 abnormal ThermoTaXis family member (ttx-1) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dm ---- 4e-031     NP_511091.3 CG12154-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Cs ==== 4e-045     BAB68341.1 Cs-OTX [Ciona savignyi] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Ci ==== 2e-046     AAG59802.1 Otx [Ciona intestinalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Bf ==== 2e-056     AAC00193.1 amphioxus Otx transcription factor [Branchiostoma floridae] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Sp ---- 6e-059     XP_001177749.1 PREDICTED: orthodenticle-related protein isoform 1 [Strongylocentrotus purpuratus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Dr ==== 7e-157     NP_571326.1 orthodenticle homolog 2 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Gg ==== 6e-161     NP_989851.2 homeobox protein OTX2 [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Hs ==== 5e-161     NP_758840.1 orthodenticle 2 isoform b; homeobox protein OTX2 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Mm ==== 3e-161     NP_659090.1 orthodenticle homolog 2 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xl ==== 5e-163     AAB63527.1 orthodenticle 2 [Xenopus laevis]  =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = ?? ==== 5e-163     NP_001084955.1 hypothetical protein LOC432013 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xt ==== 8e-168     CAJ82551.1 orthodenticle homolog 2 (Drosophila) [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTbA008f18.3                                                                                                                                                                                                                                                                                                                      TAG------------------------------------------------------------------------------------------------------------------TGA------------------------TGATAA---------ATGATG---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------ATG------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------TGA------------------------------------TAG------------------------------------------------------------------------------------ATG---------------------------------TGA------------TGA---------------------TAG------------------------------------TGA---------------------------------------------------------------------------ATG---------------------------------------TGA---------------------------------------------------TAATAATAA------TAA---------ATGTAG---------------------------------------------------------------TAG------------TGA---------------------------------------------------------TAATAA------------TAG------------------------------ATG---------------------------ATG---------------------TAA---------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------ATG---------------TAA---------------------------TAA------------------------------TAA---------TAAATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       bld Eye       in                         CCAX5024.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAAGTGAGACCCTCTAAGAAGAAGCCCTCCCCGGCCAGGGAAGTGAGCTCTGAGAGCGGCACCAGCGGCCAGTTCAGCCCCCCCTGCAGCACCTCAGTTCCAGTCATATCGAGCAGCACAGCCCCTGTGTCCATCTGGAGCCCGGCCTCCATCTCTCCCCTCTCAGACCCACTCTCCACATCATCCTCATGCATGCAGAGGTCTTACCCCATGACCTACACACAGGCATCAGGCTACAGCCAGGGATATGCAGGCTCTACATCCTACTTTGGGGGCATGGACTGTGGATCTTACTTGACCCCAATGCACCATCAACTCTCTGGAGCTGGGGCTACTCTCAGCCCAATGGGCACCAACGCAGTGACAAGCCACCTTAACCAGTCCCCAGCTGCCCTCTCTTCCCAGGCCTATGGGGCCTCTAGCTTGGGTTTTAACTCCACCGCTGACTGCCTGGATTACAAAGACCAAACGGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAACCTCTTCATGGAAGTTCCAGGTTTTGTGAAGAACTTTCCCCTCTCCCTCTCTATCTGCGTCAGGTGGAAAACTTTGCTGAGACATTCCCAGCTCTGGCCCAGTCTGGTTGAACAAGTAGGAAGCAAAACACACAAAGACCATTTATTTCATCCACATAGAACCCTGGGCTGACTGGCTCTGGACTGGATCTGGAGACATCTCCATGCAATGGGAAAACA
  5   1   2       bld Gas7      in                         XZG62808.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCCAGGGAAGTGAGCTCTGAGAGCGGCACCAGCGGCCAGTTCAGCCCCCCCTGCAGCACCTCAGTTCCAGTCATATCGAGCAGCACAGCCCCTGTGTCCATCTGGAGCCCGGCCTCCATCTCTCCCCTCTCAGACCCACTCTCCACATCATCCTCATGCATGCAGAGGTCTTACCCCATGACCTACACACAGGCATCAGGCTACAGCCAGGGATATGCAGGCTCTACATCCTACTTTGGGGGCATGGACTGTGGATCTTACTTGACCCCAATGCACCATCAACTCTCTGGAGCTGGGGCTACTCTCAGCCCAATGGGCACCAACGCAGTGACAAGTCACCTTAACCAGTCCCCAGCTGCCCTCTCTTCCCAGGCCTATGGGGCCTCTAGCTTGGGTTTTAACTCCACCGCTGACTGCCTGGATTACAAAGACCAAACGGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAACCTCTTCATGGAAGTTCCAGGTTTTGTGAAGAACTTTCCCCTCTCCCTCTCTATCTGCGTCAGGTGGAAAACTTTGCTGAGACATTCCCAGCTCTGGCCCAGTCTGGTTGAACAAGTAGGAAGCAAAACACACAAAGACCATTTATTTCATCCACATAGAACCCTGGGCTGACTGGCTCTGGACTGGATCTGGAGACATCTCCATGCAATGNGAAAACAAAGGACACATCTCTATCCAGTGACCAGGAACCACATGAAGTCTTTATCTTGTTAGATTTTAGCAGGTGGATGAAAGATGGA
  5   1   2       bld Neu       in                   TNeu125b19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACCAGCGGCCAGTTTAGCCCCCCCTGCAGCACCTAAGAATCCCGTCATATCGAGCAGCACAGCCCCTGTGTCCATCTGGAGCCCGGCCTCCATCTCTCCCCTCTCAGACCCACTCTCCACATCATCCTCATGCATGCAGAGGTCTTACCCCATGACCTACACACAGGCATCAGGCTACAGCCAGGGATATGCAGGCGCTACATCCTACTTTGGGGGAATGGACTGTGGATCTTACTTGACCCCAATGCACCATCAACTCTCTGGAGCTGGGGCTACTCTCAGCCCAATGGGCACCAACGCAGTGACAAGTCACCTTAACCAGTCCCCAGCTGCCCTCTCTTCCCAGGCCTATGGGGCCTCTAACTTGGGTTTTAACTCCACCGCTGACTGCCTGGATTACAAAGACCAAACGGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCGTGGATTATAAAGACCAAACCTCTTCATGGAAGTTCCAGGTTTTGTGAAGAACTTTCCCCTCTCTATCTGC
  5   1   2       bld Eye                                  CCAX1754.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACCTACACACAGGCATCAGGCTACAGCCAGGGATATGCAGGCTCTACATCCTACTTTGGGGGCATGGACTGTGGATCTTACTTGACCCCAATGCACCATCAACTCTCTGGAGCTGGGGCTACTCTCAGCCCAATGGGCACCAACGCAGTGACAAGCCACCTTAACCAGTCCCCAGCTGCCCTCTCTTCCCAGGGCCTATGGGGCCCTCTAGCTTGGGGTTTAACCTCCCACCC
  5   1   2       bld Gas7      in                          XZG7117.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGCAGGCTCTACATCCTACTTTGGGGGAATGGACTGTGGATCTTACTTGACCCCAATGCACCATCAACTCTCTGGAGCTGGGGCTACTCTCAGCCCAATGGGCACCAACGCAGTGACAAGTCACCTTAACCAGTCCCCAGCTGCCCTCTCTTCCCAGGCCTATGGGGCCTCTAGCTTGGGTTTTAACTCCACCGCTGACTGCCTGGATTACAAAGACCAAACGGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAACCTCTTCATGGAAGTTCCAGGTTTTGTGAAGAACTTTCCCCTCTCTATCTGCGTCAGGTGGAAAACTTTGCTGAGACATTCCCAGCTCTGGCCCAGTCTGGTTGAACAAGTAGGAAGCAAAACACACAAAGACCATTTATTTCATCCACATAGAACCCTGGGCTGACTGGCTCTGGACTGGATCTGGAGACATCTCCATGCAATGGGAAAACAAAGGACACATCTCTATCCAGTGACCAGGAACCACATCAAGTCTTTATCTTGTTAGATTTTAGCAGGTGGATGAAAGATGGAGAAGAACTAAGTGCAGCTGAGCAGCACAGGAGCCAGGCTGCAGAGCAATTTGGGGCTGTGTGTGTATTGGCTGCAGACTCAAGCTCTGCTCTTTCATGGCTGCCTTCTGGCTTAGAAAGAACATTTCAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTNTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACAT
  5   1   2       bld Gas                            TGas080d21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCACCAACGCAGTGACAAGCCACCTTAACCAGTCCCCAGCTGCCCTCTCTTCCCAGGCCTATGGGGCCTCTAGCTTGGGTTTTAACTCCACCGCTGACTGCCTGGATTACAAAGACCAAACGGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAACCTCTTCATGGAAGTTCCAGGTTTTGTGAAGAACTTTCCCCTCTCCCTCTCTATCTGCGTCAGGTGGAAAACTTTGCTGAGACATTCCCAGCTCTGGCCCAGTCTGGTTGAACAAGTAGGAAGCAAAACACACAAAGACCATTTATTTCATCCACATAGAACCCTGGGCTGACTGGCTCTGGACTGGATCTGGAGACATCTCCATGCAATGGGAAAACAAAGGACACATCTCTATCCAGTGACCAGGAACCACATGAAGTCTTTATCTTGTTAGATTTTAGCAGGTGGATGAAAGATGGAGAAGAACTAAGTGCAGCTGAGCAGCACAGGAGCCAGGCTGCAGAGTAATTTGGGGCTGTGTGTGTATTGGCTGCAGACTCAAGCTCTGCTCTTTCATGGCTGCCTTCTGGCTTAGAAGAACATTTCAGGATTTGAGTGAA
  5   1   2       bld Eye       in                         CCAX8267.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAACGCAGTGACAAGCCACCTTAACCAGTCCCCAGCTGCCCTCTCTTCCCAGGCCTATGGGGCCTCTAGCTTGGGTTTTAACTCCACCGCTGACTGCCTGGATTACAAAGACCAAACGGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAACCTCTTCATGGAAGTTCCAGGTTTTGTGAAGAACTTTCCCCTCTCCCTCTCTATCTGCGTCAGGTGGAAAACTTTGCTGAGACATTCCCAGCTCTGGCCCAGTCTGGTTGAACAAGTAGGAAGCAAAACACACAAAGACCATTTATTTCATCCACATAGAACCCTGGGCTGACTGGCTCTGGACTGGATCTGGAGACATCTCCATGCAATGGGAAAACAAAGGACACATCTCTATCCAGTGACCAGGAACCACATGAAGTCTTTATCTTGTTAGATTTTAGCAGGTGGATGAAAGATGGAGAAGAACTAAGTGCAGCTGAGCAGCACAGGAGCCAGGCTGCAGAGTAATTTGGGGCTGTGTGTGTATTGGCTGCAGACTCAAGCTCTGCTCTTTCATGGCTGCCTTCTGGCTTAGAAAGAACATTTCAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAT
  3   1   2       bld Gas7 5g3  in                         XZG31299.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCCAGGCCTATGGGGCCTCTAGCTTGGGTTTTAACTCCACCGCTGACTGCCTGGATTACAAAGACCAAACGGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAACCTCTTCATGGAAGTTCCAGGTTTTGTGAAGAACTTTCCCCTCTCCCTCTCTATCTGCGTCAGGTGGAAAACTTTGCTGAGACATTCCCAGCTCTGGCCCAGTCTGGTTGAACAAGTAGGAAGCAAAACACACAAAGACCATTTATTTCATCCACATAGAACCCTGGGCTGACTGGCTCTGGACTGGATCTGGAGACATCTCCATGCAATGGGAAAACAAAGGACACATCTCTATCCAGTGACCAGGAACCACATGAAGTCTTTATCTTGTTAGATTTTAGCAGGTGGATGAAAGATGGAGAAGAACTAAGTGCAGCTGAGCAGCACAGGAGCCAGGCTGCAGAGTAATTTGGGGCTGTGTGTGTATTGGCTGCAGACTCAAGCTCTGCTCTTTCATGGCTGCCTTCTGGCTTAGAAAGAACATTTCAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGT
  5   1   2       bld Gas       in                   TGas081e10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCATGGAAGTTCCAGGTTTTGTGAAGAACTTTCCCCTCTCCCTCTCTATCTGCGTCAGGTGGAAAACTTTGCTGAGACATTCCCAGCTCTGGCCCAGTCTGGTTGAACAAGTAGGAAGCAAAACACACAAAGACCATTTATTTCATCCACATAGAACCCTGGGCTGACTGGCTCTGGACTGGATCTGGAGACATCTCCATGCAATGGGAAAACAAAGGACACATCTCTATCCAGTGACCAGGAACCACATGAAGTCTTTATCTTGTTAGATTTTAGCAGGTGGATGAAAGATGGAGAAGAACTAAGTGCAGCTGAGCAGCACAGGAGCCAGGCTGCAGAGTAATTTGGGGCTGTGTGTGTATTGGCTGCAGACTCAAGCTCTGCTCTTTCATGGCTGCCTTCTGGCTTAGAAAGAACATTTCAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCAC
  5   1   2       bld Neu       in                   TNeu102l05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGAAGCAAAACACACAAAGACCATTTATTTCATCCACATAGAACCCTGGGCTGACTGGCTCTGGACTGGATCTGGAGACATCTCCATGCAATGGGAAAACAAAGGACACATCTCTATCCAGTGACCAGGAACCACATGAAGTCTTTATCTTGTTAGATTTTAGCAGGTGGATGAAAGATGGAGAAGAACTAAGTGCAGCTGAGCAGCACAGGAGCCAGGCTGCAGAGTAATTTGGGGCTGTGTGTGTATTGGCTGCAGACTCAAGCTCTGCTCTTTCATGGCTGCCTTCTGGCTTAAAAGAACATTTCAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAACCGATGCCCCTTAATATTATTCAAAGCGAGCGAATG
  3   1   2       bld Gas       in                    TGas081e10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCACATAGAACCCTGGGCTGACTGGCTCTGGACTGGATCTGGAGACATCTCCATGCAATGGGAAAACAAAGGACACATCTCTATCCAGTGACCAGGAACCACATGAAGTCTTTATCTTGTTAGATTTTAGCAGGTGGATGAAAGATGGAGAAGAACTAAGTGCAGCTGAGCAGCACAGGAGCCAGGCTGCAGAGTAATTTGGGGCTGTGTGTGTATTGGCTGCAGACTCAAGCTCTGCTCTTTCATGGCTGCCTTCTGGCTTAGAAAGAACATTTCAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTATTCAAAGCGAGCGAATGGGGCCTCTAAGGAACTGCGGTTAAACCTTTCTTTTCCTCCACCAACTCCTCCTGAGTTTATTTTATATTCGACCCCGCAACGAACGCAGGGACCGGAATCCGCAATATAGAAAGGAACAGGACAGAGGATTATTTAATAACTAAAGGACTTGTCTGTTGTCACTGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATATACACACCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7                                 XZG57528.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAGACATCTCCATGCAATGGGAAAACAAAGGACACATCTCTATCCAGTGACCAGGAACCACATGAAGTCTTTATCTTGTTAGATTTTAGCAGGTGGATGAAAGATGGAGAAGAACTAAGTGCAGCTGAGCAGCACAGGAGCCAGGCTGCAGAGTAATTTGGGGCTGTGTGTGTATTGGCTGCAGACTCAAGCTCTGCTCTTTCATGGCTGCCTTCTGGCTTAGAAAGAACATTTCAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTATTCAAAGCGAGCGAATGGGGCCTCTAAGGAACTGCGGTTAAACCTTTCTTTTCCTCCACCAACTCCTCCTGAGTTTATTTTATATTCGACCCCGCAACGAACGCAGGGACCGGAATCCGCAATATAGAAAGGAACAGGACAGAGGATTATTTAATAACTAAAGGACTTGTCTGTTGTCACTGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATATA
  3   1   2      seed TbA       in                   TTbA008f18.q1kbT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCAATGGGAAAACAAAGGACACATCTCTATCCAGTGACCAGGAACCACATGAAGTCTTTATCTTGTTAGATTTTAGCAGGTGGATGAAAGATGGAGAAGAACTAAGTGCAGCTGAGCAGCACAGGAGCCAGGCTGCAGAGTAATTTGGGGCTGTGTGTGTATTGGCTGCAGACTCAAGCTCTGCTCTTTCATGGCTGCCTTCTGGCTTAGAAAGAACATTTCAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTATTCAAAGCGAGCGAATGGGGCCTCTAAGGAACTGCGGTTAAACCTTTCTTTTCCTCCACCAACTCCTCCTGAGTTTATTTTATATTCGACCCCGCAACGAACGCAGGGACCGGAATCCGCAATATAGAAAGGAACAGGACAGAGGATTATTTAATAACTAAAGGACTTGTCTGTTGTCACTGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATATACACACCATAAACCTTTTCCCCTGGATCTGGCAAATATGTATAAAAAATTTATTAAATGACTCTAGCACAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu125b19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTTAGATTTTAGCAGGTGGATGAAAGATGGAGAAGAACTAAGTGCAGCTGAGCAGCACAGGAGCCAGGCTGCAGAGCAATTTGGGGCTGTGTGTGTATTGGCTGCAGACTCAAGCTCTGCTCTTTCATGGCTGCCTTCTGGCTTAGAAAGAACATTTCAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTATTCAAAGCGAGCGAATGGGGCCTCTAAGGAACTGCGGTTAAACCTTTCTTTTCCTCCACCAACTCCTCCTGAGTTTATTTTATATTCGACCCCGCAACGAACGCAGGGACCGGAATCCGCAATATAGAAAGGAACAGGACAGAGGATTATTTAATAACTAAAGGACTTGTCTGTTGTCACTGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATATACACACCATAAACCTTTTCCCCTGGATCTGGCAAATATGTATAAAAAATTTATTAAATGACTCTAGCACAAAAAAATAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  5g3  in                    TGas119l09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTAGATTTTAGCAGGTGGATGAAAGATGGAGAAGAACTAAGTGCAGCTGAGCAGCACAGGAGCCAGGCTGCAGAGTAATTTGGGGCTGTGTGTGTATTGGCTGCAGACTCAAGCTCTGCTCTTTCATGGCTGCCTTCTGGCTTAGAAAGAACATTTCAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTATTCAAAGCGAGCGAATGGGGCCTCTAAGGAACTGCGGTTAAACCTTTCTTTTCCTCCACCAACTCCTCCTGAGTTTATTTTATATTCGACCCCGCAACGAACGCAGGGACCGGAATCCGCAATATAGAAAGGAACAGGACAGAGGATTATTTAATAACTAAAGGACTTGTCTGTTGTCACTGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATATACACCCCATAAACCTTTTCCCCTGGATCTGGCAAATATGTATAAAAAA
  3   1   2       bld HdA       out                  THdA026f06.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTAGATTTTAGCAGGTGGATGAAAGATGGAGAAGAACTAAGTGCAGCTGAGCAGCACAGGAGCCAGGCTGCAGAGTAATTTGGGGCTGTGTGTGTATTGGCTGCAGACTCAAGCTCTGCTCTTTCATGGCTGCCTTCTGGCTTAGAAAGAACATTTCAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTATTCAAAGCGAGCGAATGGGGCCTCTAAGGAACTGCGGTTAAACCTTTCTTTTCCTCCACCAACTCCTCCTGAGTTTATTTTATATTCGACCCCGCAACGAACGCAGGGACCGGAATCCGCAATATAGAAAGGAACAGGACAGAGGATTATTTAATAACTAAAGGACTTGTCTGTTGTCACTGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATATACACACCATAAACCTTTTCCCCTGGATCTGGCAAATATGTATAAAAAATTTATTAAATGACTCTAGCACAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Neu       in                    TNeu102l05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGATTTTAGCAGGTGGATGAAAGATGGAGAAGAACTAAGTGCAGCTGAGCAGCACAGGAGCCAGGCTGCAGAGTAATTTGGGGCTGTGTGTGTATTGGCTGCAGACTCAAGCTCTGCTCTTTCATGGCTGCCTTCTGGCTTAGAAAGAACATTTCAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTATTCAAAGCGAGCGAATGGGGCCTCTAAGGAACTGCGGTTAAACCTTTCTTTTCCTCCACCAACTCCTCCTGAGTTTATTTTATATTCGACCCCGCAACGAACGCAGGGACCGGAATCCGCAATATAGAAAGGAACAGGACAGAGGATTATTTAATAACTAAAGGACTTGTCTGTTGTCACTGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATATACACACCATAAACCTTTTCNCCCTGGATCTGGCAAATATGTATAAAAAATTTATTAAATGACTCTAGCACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG27238.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCACGCGTCCGGTGGATGAAAGATGGAGAAGAACTAAGTGCAGCTGAGCAGCACAGGAGCCAGGCTGCAGAGTAATTTGGGGCTGTGTGTGTATTGGCTGCAGACTCAAGCTCTGCTCTTTCATGGCTGCCTTCTGGCTTAGAAAGAACATTTCAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTATTCAAAGCGAGCGAATGGGGCCTCTAAGGAACTGCGGTTAAACCTTTCTTTTCCTCCACCAACTCCTCCTGAGTTTATTTTATATTCGACCCCGCAACGAACGCAGGGACCGGAATCCGCAATATAGAAAGGAACAGGACAGAGGATTATTTAATAACTAAAGGACTTGTCTGTTGTCACTGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATATACACACCATAAACCTTTTCCCCTGGATCTGGCAAATATGTATAAAAAATTTATTAAATGACTCTGGCCC
  3   1   2       bld Gas  FL   in                    TGas114a06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAGGTGGATGAAAGATGGAGAAGAACTAAGTGCAGCTGAGCAGCACAGGAGCCAGGCTGCAGAGTAATTTGGGGCTGTGTGTGTATTGGCTGCAGACTCAAGCTCTGCTCTTTCATGGCTGCCTTCTGGCTTAGAAAGAACATTTCAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTATTCAAAGCGAGCGAATGGGGCCTCTAAGGAACTGCGGTTAAACCTTTCTTTTCCTCCACCAACTCCTCCTGAGTTTATTTTATATTCGACCCCGCAACGAACGCAGGGACCGGAATCCGCAATATAGAAAGGAACAGGACAGAGGATTATTTAATAACTAAAGGACTTGTCTGTTGTCACTGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATATACACACCATAAACCTTTTCCCCCTGGATCTGGCAAATATGTATAAAAAATTTATTAAATGACTCTAGCACAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7      in                         XZG27238.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGGATGAAAGATGGAGAAGAACTAAGTGCAGCTGAGCAGCACAGGAGCCAGGCTGCAGAGTAATTTGGGGCTGTGTGTGTATTGGCTGCAGACTCAAGCTCTGCTCTTTCATGGCTGCCTTCTGGCTTAGAAAGAACATTTCAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTATTCAAAGCGAGCGAATGGGGCCTCTAAGGAACTGCGGTTAAACCTTTCTTTTCCTCCACCAACTCCTCCTGAGTTTATTTTATATTCGACCCCGCAACGAACGCAGGGACCGGAATCCGCAATATAGAAAGGAACAGGACAGAGGATTATTTAATAACTAAAGGACTTGTCTGTTGTCACTGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATATACACACCATAAACCTTTTCCCCTGGATCTGGCAAATATGTATAAAAAATTTATTAAATGACTCTAGCACAAAAAAAAAAAAAAAANAAAAAGG
  3   1   2       bld Gas8 5g3  in                          st38c21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGATGAAAGATGGAGNAGAACTAAGTGCAGCTGAGCAGCACAGGAGCCAGGCTGCAGAGTAATTTGGGGCTGTGTGTGTATTGGCTGCAGACTCAAGCTCTGCTCTTTCATGGCTGCCTTCTGGCTTAGAAAGAACATTTCAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTATTCAAAGCGAGCGAATGGGGCCTCTAAGGAACTGCGGTTAAACCTTTCTTTTCCTCCACCAACTCCTCCTGAGTTTATTTTATATTCGACCCCGCAACGAACGCAGGGACCGGAATCCGCAATATAGAAAGGAACAGGACAGAGGATTATTTAATAACTAAAGGACTTGTCTGTTGTCACTGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTNTGTGAATTAAGATATAA
  3   1   2       bld Gas8 5g3  in                          st38n12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGATGNAAGATGGAGAAGAACTTAGTGCAGCTGAGCAGCACAGGAGCCAGGCTGCAGAGTAATTTGGGGCTGTGTGTGTATTGGCTGCAGACTCAAGCTCTGCTCTTTCATGGCTGCCTTCTGGCTTAGAAAGAACATTTCAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTATTCAAAGCGAGCGAATGGGGCCTCTAAGGAACTGCGGTTAAACCTTTCTTTTCCTCCACCAACTCCTCCTGAGTTTATTTTATATTCGACCCCGCAACGAACGCAGGGACCGGAATCCGCAATATAGAAAGGAACAGGACAGAGGATTATTTAATAACTAAAGGACTTGTCTGTTGTCACTGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTNGCCTTTGTGAATTAAGATATAAATATATATATATACACACCATAAACCTTTCCCCTGGAT
  3   1   2       bld Gas8 5g3  in                          st52g13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTAAGTGCAGCTGAGCAGCACAGGAGCCAGGCTGCAGAGCAATTTGGGGCTGTGTGTGTATTGGCTGCAGACTCAAGCTCTGCTCTTTCATGGCTGCCTTCTGGCTTAGAAAGAACATTTCAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTATTCAAAGCGAGCGAATGGGGCCTCTAAGGAACTGCGGTTAAACCTTTCTTTTCCTCCACCAACTCCTCCTGAGTTTNTTTTATATTCGACCCCGCAACGAACGCAGGGACCGGAATCCGCAATATAGAAAGGAACAGGACAGAGGATTATTTAATAACTAAAGGACTTGTCTGTTGTCACTGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATATACACACCATAAACCTTTTCCCCTGGATCTGGCAAAT
  5   1   2       bld Gas                            TGas035b22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGCTGAGCAGCACAGGAGCCAGGCTGCAGAGTAATTTGGGGCTGTGTGTGTATTGGCTGCAGACTCAAGCTCTGCTCTTTCATGGCTGCCTTCTGGCTTAGAAAGAACATTTCAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTATTCAAAGCGAGCGAATGGGGCCTCTAAGGAACTGCGGTTAAACCTTTCTTTTCCTCCACCAACTCCTCCTGAGTTTATTTTATATTCGACCCCGCAACGAACGCAGGGACCGGAATCCGCAATATAGAAAGGAACAGGACAGAGGATTATTTAATAACTAAAGGACTTGTCTGTTGTCACTGACCCTGATATATTCATTGCA
  3   1   2       bld Eye       in                         CCAX5024.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCTGCTCTTTCATGGCTGCCTTCTGGCTTAGAAAAGAACATTTCAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTATTCAAAGCGAGCGAATGGGGCCTCTAAGGAACTGCGGTTAAACCTTTCTTTTCCTCCACCAACTCCTCCTGAGTTTATTTTATATTCGACCCCGCAACGAACGCAGGGACCGGAATCCGCAATATAGAAAGGAACAGGACAGAGGATTATTTAATAACTAAAGGACTTGTCTGTTGTCACTGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATATACACCCCATAAACCTTTTCCCCTGGATCTGGCAAATATGTATAAAAAATTTATTAAATGACTCTAGCAC
  3   1   2       bld Tad5 5g3  in                         XZT20758.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCATGGCTGCCTTCTGGCTTAGAAAGAACATTTCAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTAGGCAACTGTGAACTCCACACCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTATTCAAAGCGAGCGAATGGGGCCTCTAAGGAACTGCGGTTAAACCTTTTTTTTCCTCCACCAACTCCTCCTGAGTTTATTTTATATTCGACCCCGCAACGAACGCAGGGACCGGAATCCGCAATATAGAAAGGAACAGGACAGAGGATTATTTAATAACTAAAGGACTTGTCTGTTGTCACTGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATATACACCCCATAAACCTTTTCCCCTGGATCTGGCAAATATGTATAAAAAATTTATTAAATGACTCTAGCCC
  3   1   2       add Gas7 5g3  in                         XZG41536.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTAGAAAGAACATTTCAGGATTTGAGGGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAAGGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCCCCCCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATTTTTTTCAAAGCGAGCGAATGGGGCCTTTAAGGAACTGCGGTTAAACCTTTCTTTTCCTCCACCAACTCCTCCTGAGTTTATTTTATATTCGACCCCGCAACGAACGCAGGGCCCGGATTCCCCAATATAGAAAGGACCAGGCCAGAGGTTTTTTTAATAACTAAAGGACTTGTCTGTTGTCACTGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTTTGGGAATTAAGATATAAATATATATATATCCCCCCCATAAACCTTTTCCCCGGGATCTGGCAAATATGTATAAAAAATTTTTTAAATGCCTCTGGCCCAAAAAAAAAAAAAAAAAAAAAAAAAACC
  3   1   2       bld TbA  5g3  in                    TTbA017o03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTATTCAAAGCGAGCGAATGGGGCCTCTAAGGAACTGCGGTTAAACCTTTCTTTTCCTCCACCAACTCCTCCTGAGTTTATTTTATATTCGACCCCGCAACGAACGCAGGGACCGGAATCCGCAATATAGAAAGGAACAGGACAGAGGATTATTTAATAACTAAAGGACTTGTCTGTTGTCACTGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATATACACACCATAAACCTTTTCCCCTGGATCTGGCAAATATGTATAAAAAATTTATTAAATGACTCTA
  3   1   2       bld Eye  5g3  in                         CCAX8169.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGATTTGAGTGAATTGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATAATGTTTATAAGAAGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCCCCCCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTATTCAAAGCGAGCGAATGGGGCCTCTAAGGAACTGCGGTTAAACCTTTTTTTTCCTCCCCCAACTCCTCCTGAGTTTATTTTATATTCGACCCCGCAACGAACGCAGGGACCGGAATCCGCAATATAGAAAGGAACAGGACAGAGGATTATTTAATAACTAAAGGACTTGTCTGTTGTCACTGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATATACCCCCCATAAACCTTTTCCCCTGGATTTGGCAAATATGTATAAAAAATTTATTAAATGACTCTAGCCC
  3   1   2       bld Eye       in                         CCAX8267.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCCCCCCCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTTTTTTTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTTTTCAAAGCGAGGGAATGGGGCCTTTAAGGAACTGCGGTTAAACCTTTCTTTTCCTCCCCCAACTCCTCCTGAGTTTATTTTATTTTCGACCCCGCAACGAACCCAGGGACCGGAATCCCCAATATAGAAAGGAACAGGACAGAGGATTTTTTAATAACTAAAGGACTTGTCTGTTGTCACTGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATATACACCCCATAAACCTTTTCCCCTGGATTTGGCAAATATGTATAAAAAATTTATTAAATGACTCTAGCCC
  5   1   2       bld Neu                            TNeu012n07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCATTATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATAAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTATTCAAAGCGAGCGAATGGGGCCTCTAAGGAACTGCGGTTAAACCTTTCTTTTCCTCCACCAACTCCTCCTGAGTTTATTTTATATTCGACCCCGCAACGAACGCAGGGACCGGAATCCGCAATATAGAAAGGAACAGGACAGAGGATTATTTAATAACTAAAGGACTTGTCTGTTGTCACTGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATATACACACCATAAACCTTTTCCCCTGGATCTGGCAAATATGTATAAAAAATTTATTAAATGACTCTAGCAC
  3   1   1       add Gas7      in                         XZG62808.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTAGGGGGTTTTTAAAAGCCAATCGGGGGGGGTTTTAAAAAAAGGGGAAATTGGGGGTTTTTAATTGGGGCAGGACATCAAAACTGGGTTTTTTTGTTTTGTTGGCAACTGGGAACTCCCCCCCCGGGGGGGGTGGTACTGGGTTTTAATACCGGGTTTTTTTTTGGCGGGAAGTTTCGGGTTTTGGGGCAAGCCCGGTGCCCCTTTATTTTTTTCAAAGGGGGGGAAGGGGGCCTTTAAGGAACTGGGGTTAAACCTTTTTTTTTCTCCCCCAACTCCTCCGGGGTTTTTTTTTTTTTTGCCCCCGCAAGGAACGCGGGGGCCGGATTCCCCAATTTAGAAAGGACCGGGCCAGGGGTTTTTTTAATAACTAAAGGGTTTTTTTGTTGTCCCTGCCCCTGATTTTTTCTTTGCAAGAGGGAATCCCTTTGGGGTTTTTGCTTGCCTTTGGGAATTAAGATAAAAATTTTTTTTTTTCCCCCCCATAACCCTTTTCCCCGGGTTTGGGCAAATTTGTTTAAAAAATTTTTTAAAGGGCTTTGGCCCAAAAAAAAAAAACC
  3   1   2       add Gas7      in                          XZG7117.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAGACAACCAGTGTGTGTCTTATATAAAAGGAAAATCTGTGGTTTTTAATTTGGGCTAGACATCAAAACTGTGATCTCTTGTTTTGTAGGCAACTGTGAACTCCCCCCCAGCGGGGGGTGGTACTGTGATTTAATAACAGGTTTATTATTCGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTTTTCAAAGCGAGGGAATGGGCCCTCTAAGGACCGGGGGTTAAACCTTTTTTTTCCTCCCCCAACCCCCCCGGAGTTTATTTTATTTTCGACCCCGCAACGAACGCAGGGACCGGAATCCGCAATATAGAAAGGACCGGGGCAGGGGTTTTTTTAATAATTAAAGGACTTGTCTGTTGTCACGGACCCTGATATTTTCTTTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTTTGGGAATTCGGATATAAATTTTTATATATCCCCCCCAAAAACCTTTTCCCCGGGTTCTG
  3   1   2       add Tad5      in                          XZT9319.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGTGTGTCTTATATAAAGGGTAAATCGGGGGTTTTTAATTTGGGCTAGACATCAAAACGGGGATTTCTTGTATTGTAGGCAAGTGGGAACTCCACACCAGCGGGGGGTGGTAGGGGGATTTAATACCGGGTTTATTATTAGCGGGAAGATTCGGGATTTAGGGCAAAACGGATGCCCCTTAATTTTTTTCAAAGGGAGGGAAGGGGGCCTTTAGGGAACTGGGGTTAAACCTTTTTTTTCCTCCACCAACTCCTCCGGAGTTTATTTTATTTTGGACCCCGCAACGAACGCAGGGCCGGGAATCCGCAATTTAGAAAGGAACGGGACGGGGGATTTTTTAATAATT
  3   1   2       bld Eye  5g3  in                         CCAX5921.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGTGCTAGACATCAAAACTGTGATCTCTTGTATTGTATCCAACTGTGAACTCCACCCCAGCGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCCTTAATATTATTCAAAGCGAGCGAATGGGGCCTTTAAGGAACTGCGGTTAAACCTTTTTTTTCCTCCACCAACTCCTCCGGAGTTTATTTTATATTCGACCCCGCAACGAACGCAGGGACCGGAATCCGCAATATAGAAAGGAACAGGACAGAGGATTATTTAATAACTAAAGGACTTGTTTGTTGTCACTGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATATACCCCCCATAAACCTTTTCCCCTGGATTTGGCAAATATGTATAAAAAATTTATTAAATGACTCTAGCCC
  3   1   2       bld HdA       ?                     THdA034f09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAGGATTATTTAATATTTAAAGGATTTGTGGGTGGTCATTGACCGGGATATATTCATCGCAAGAAGGAATCCCTTATGAGTTTATGCTTGCCTTTGTGAATTAGGATTTAAATATATATATATACACACCATAAACCTTTTCCCCTGGATCTGGCAAATCATGTAAAAGGAATTTATTAAATGACTTTGGCCCAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu                            TNeu056j13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTGTCACTGGACCCTGATATATTCATTGCAAGAAGGAATCCCTTATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATATACACACCATAAACCTTTTCCCCTGGATCTGGCAAATATGTATAAAAAATTTATTAAATGACTCTAGCACaaaaaaaaaaaaaaaaaaagaaaaaaagaacaaaaaagcaaaaaaaaaaaaaaaa

In case of problems mail me! (