Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 229.0    0Xt7.1-CABI10468.5                          65 PI      81        377      652                novel fork head domain containing protein [Xenopus tropicalis]
     2 233.0    0Xt7.1-CABJ9155.3                           27 PI      79        354      667                Unknown (protein for MGC:75815) [Silurana tropicalis]

 This cluster: approximate FL confidence score = 94%

 1012074834 Xt7.1-XZG33529.5 - 62 ESTs
                                                                       ........-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG33529.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTATCGCAGGATGAACCCAGTCCAGCAACCTGCCCAGCAGCGCTCCCCTGCCTCCAGCCTGCCTCACCCCAAACGGGCCCAGGAGGCCCCGGACATGGCACTTTATTGTGACAACTTCATGTACCCCCAGCAGAGCCTGCACCCCAGCCAGAGGGGGCCCAACTTCGCCATCGGGGAATACACCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACCGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCTGGCAGAACTCCATCCGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGGTGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACCCCAACTGCGAGAAGATGTTCGACAATGGCAATTTCCGTCGGAAGAGAAAGCCCAAGTCTGACGCCAACAGCGCTAAAATCGCCAAGATCGGAGAGGATCACTTGAACCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCTTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTCCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTACAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATATTTTTATTTAATAAAAAAGAGAAAAACATGAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008224884                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGGATGAACCCAGTCCAGCAACCTGCCCAGCAGCGCTCCCCTGCCTCCAGCCTGCCTCACCCCAAACGGGCCCAGGAGGCCCCGGACATGGCACTTTATTGTGACAACTTCATGTACCCCCAGCAGAGCCTGCACCCCAGCCAGAGGGGGCCCAACTTCGCCATCGGGGAATACACCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACCGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCTGGCAGAACTCCATCCGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGGTGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACCCCAACTGCGAGAAGATGTTCGACAATGGCAATTTCCGTCGGAAGAGAAAGCCCAAGTCTGACGCCAACAGCGCTAAAATCGCCAAGATCGGAGAGGATCACTTGAACCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCTTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTCCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTACAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATATTTTTATTTAATAAAAAAGAxAAAxACATGAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    8     9    13    13    15    16    15    16    16    16    16    17    16    17    17    18    17    18    17    18    17    18    17    18    17    18    18    18    19    19    20    20    20    20    20    20    20    20    20    20    20    20    20    20    21    21    22    22    23    23    23    23    23    23    23    23    24    24    24    24    24    24    24    24    24    24    24    25    24    25    24    25    24    25    24    25    24    25    23    25    24    25    24    24    24    24    23    23    23    23    23    23    22    22    21    22    21    21    19    22    21    23    20    22    19    21    20    22    18    20    17    19    17    19    18    20    17    19    17    19    19    22    19    23    20    24    19    23    18    23    21    26    27    33    27    33    30    34    29    34    32    34    30    32    31    32    29    31    30    31    28    29    28    29    28    29    28    29    27    29    30    31    31    32    30    32    27    32    32    33    30    33    29    34    31    34    25    34    31    33    27    34    32    33    34    35    32    36    34    36    36    36    34    36    32    36    33    36    36    36    33    36    36    36    34    36    30    36    35    36    35    36    15    36    16    36    15    35    14    34    15    34    14    34    14    34    13    33    15    33    15    33    15    33    13    33    15    33    13    31    12    28    11    27    12    23     3     7     7     7
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----AC-----
                                               BLH ATG      10    1046                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               BLH OVR      10      39                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               EST CLI     -10      13                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               ORF LNG      10       2                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Br ---- 3e-019     CAA72307.1 whn transcription factor [Branchiostoma lanceolatum] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================
                                                                       PROTEIN --- Sc ---- 4e-021     NP_014331.1 Fork Head homolog two; Fkh2p [Saccharomyces cerevisiae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Bb ==== 3e-032     BAD97363.1 forkhead protein FoxE4 [Branchiostoma belcheri] =========================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Cs ---- 5e-033     BAB68347.1 forkhead protein FoxD [Ciona savignyi] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 1e-032     NP_496411.1 UNCoordinated locomotion UNC-130, forkhead box D1 (37.3 kD) (unc-130)[Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dm ---- 3e-036     NP_524202.1 crocodile CG5069-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Bf ---- 3e-038     CAH69694.1 forkhead transcription factor [Branchiostoma floridae] --------------------------------------===================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 2e-052     XP_787062.1 PREDICTED: similar to forkhead box I2 [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ci ---- 2e-061     BAE06443.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Mm ---- 9e-079     NP_076396.2 forkhead box I1; forkhead homolog 10 (Drosophila) [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Hs ---- 1e-081     NP_036320.2 forkhead box I1 isoform a; forkhead (Drosophila)-like 10; Forkhead, drosophila,homolog-like 10; forkhead-related activator 6; hepatocyte nuclear factor 3forkhead homolog 3; HNF-3/fork-head homolog-3 [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Gg ==== 4e-086     XP_425185.1 PREDICTED: similar to Hypothetical protein MGC75815 [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dr ---- 6e-101     NP_944598.2 forkhead box I2 [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xl ==== 0          CAA52364.1 fork head protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === ?? ==== 0          NP_001081617.1 fork head protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xt ==== 0          CAJ81516.1 forkhead box I1 [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG33529.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG---------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------TGA------------------------TAA---------------------------------ATG------------------------------TAA---------------------------------TAA------------------------------ATG------------------------------------------------------TGA------------------TAA---------------------------------------------------------TAATAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   1           Tbd0 FL                     IMAGE:5336445.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTTGGACAAGTATCGCAGGATGAACCCAGTCCAGCAACCTGCCCAGCAGCGCTCCCCTGCCTCCAGCCTGCCTCACCCCAAACGGGCCCAGGAGGCCCCGGACATGGCACTTTATTGTGACAACTTCATGTACCCCCAGCAGAGCCTGCACCCCAGCCAGAGGGGGCCCAACTTCGCCATCGGGGAATACACCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACTGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCTGGCAGAACTCCATCCGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGGTGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACCCCAACTGCGAGAAGATGTTCGACAATGGCAATTTCCGTCGGAAGAGAAAGCCCAAGTCTGACGCCAACAGCGCTAAAATCGCCAAGATCGGAGAGGATCACTTGAACCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCCTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTCCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTACAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATATTTTTATTTAATAAAAAAGAAAAACATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Te5       in                         CAAO3023.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATGAAGCCGGCTGTGTGCGCACCGTTACCCTCCCAGAGAGGGACACACCCATTACCTGCCGGGGGGCGGGGCGGCCTGGGATATAAGGGTCGGGGCTGGGGGCGCTTGGCATATGGATCAGTTGGACAAGTATCGCAGGATGAACCCAGTCCAGCAACCTGCCCAGCAGCGCTCCCCTGCCTCCAGCCTGCCTCACCCCAAACGGGCCCAGGAGGCCCCGGACATGGCACTTTATTGTGACAACTTCATGTACCCCCAGCAGAGCCTGCACCCCAGCCAGAGGGGGCCCAACTTCGCCATCGGGGAATACACCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACTGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCTGGCAGAACTCCATCCGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGGTGCCAAGGGATGAGAATGAT
  5   1   2   12  bld Gas7 5g3  in                         XZG19485.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATTCGAATTCTCGACCCACGCGTCCGGTTGGACAAGTATCGCAGGATGAACCCAGTCCAGCAACCTGCCCAGCAGCGCTCCCCTGCCTCCAGCCTGCCTCACCCCAAACGGGCCCAGGAGGCCCCGGACATGGCACTTTATTGTGACAACTTCATGTACCCCCAGCAGAGCCTGCACCCCAGCCAGAGGGGGCCCAACTTCGCCATCGGGGAATACACCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACTGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCtggcagaactccatccggcacaacctgtccctcaatgactgcttcaagaaggtgccaagggatgagaatgatccaggaaaaggaaactactggactctggacccCAACTGCGAGAAGATGTTCGACAATGGCAATTT
  5   1   2   12  bld Gas7 5g3  in                         XZG27458.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGTTGGACAAGTATCGCAGGATGAACCCAGTCCAGCAACCTGCCCAGCAGCGCTCCCCTGCCTCCAGCCTGCCTCACCCCAAACGGGCCCAGGAGGCCCCGGACATGGCACTTTATTGTGACAACTTCATGTACCCCCAGCAGAGCCTGCACCCCAGCCAGAGGGGGCCCAACTTCGCCATCGGGGAATACACCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACCGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCtggcagaactccatccggcacaacctgtccctcaatgactgcttcaagaaggtgccaagggatgagaatgatccaggaaaaggaaactactggactctggaccccaactgcgagaagatgttcgacaatggcaatttccgtcggaagagaaagCCCAAGTCTGACGCCAACAGCGCTAAAATCGCCAAGATCGGAGAGGATCACTTG
  5   1   2   12  bld Gas7 5g3  in                         XZG62024.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTTGGACAAGTATCGCAGGATGAACCCAGTCCAGCAACCTGCCCAGCAGCGCTCCCCTGCCTCCAGCCTGCCTCACCCCAAACGGGCCCAGGAGGCCCCGGACATGGCACTTTATTGTGACAACTTCATGTACCCCCAGCAGAGCCTGCACCCCAGCCAGAGGGGGCCCAACTTCGCCATCGGGGAATACACCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACCGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCtggcagaactccatccggcacaacctgtccctcaatgactgcttcaagaaggtgccaagggatgagaatgatccaggaaaaggaaactactggactctggaccccaactgcgagaagatgttcgacaatggcaatttccgtcggaagagaaagCCCAAGTCTGACGCCAACAGCGCTAAAATCGCCAAGATCGGAGAGGATCACTTGAACCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCCTCCCCCGAGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGAC
  5   1   2       bld Gas  5g3  in                   TGas114g01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGGACAAGTATCGCAGGATGAACCCAGTCCAGCAACCTGCCCAGCAGCGCTCCCCTGCCTCCAGCCTGCCTCACCCCAAACGGGCCCAGGAGGCCCCGGACATGGCACTTTATTGTGACAACTTCATGTACCCCCAGCAGAGCCTGCACCCCAGCCAGAGGGGGCCCAACTTCGCCATCGGGGAATACACCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACCGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCTGGCAGAACTCCATCCGGCACAACCTGTCCCCTCATGACTGCTTCAAGAAAGGTGCCAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCT
  5   1   2       bld Gas  5g                        TGas002h16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGGACAAGTATCGCAGGATGAACCCAGTCCAGCAACCTGCCCAGCAGCGCTCCCCTGCCTCCAGCCTGCCTCACCCCAAACGGGCCCAGGAGGCCCCGGACATGGCACTTTATTGTGACAACTTCATGTACCCCCAGCAGAGCCTGCACCCCAGCCAGAGGGGGCCCAACTTCGCCATCGGGGAATACACCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACCGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCATAGCAGGCtggcagaactccatccggcacaacctgtccctcaatgactgcttc
  5   1   2       bld Tbd0 FL   in                    IMAGE:5336445.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACAAGTATCGCAGGATGAACCCAGTCCAGCAACCTGCCCAGCAGCGCTCCCCTGCCTCCAGCCTGCCTCACCCCAAACGGGCCCAGGAGGCCCCGGACATGGCACTTTATTGTGACAACTTCATGTACCCCCAGCAGAGCCTGCACCCCAGCCAGAGGGGGCCCAACTTCGCCATCGGGGAATACACCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACTGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCtggcagaactccatccggcacaacctgtccctcaatgactgcttcaagaaggtgccaagggatgagaatgatccaggaaaaggaaactactggactctggacccCAACTGCGAG
  5   1   2       bld Neu  5g3  in                   TNeu088o05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGTATCGCAGGATGAACCCAGTCCAGCAACCTGCCCAGCAGCGCTCCCCTGCCTCCAGCCTGCCTCACCCCAAACGGGCCCAGGAGGCCCCGGACATGGCACTTTATTGTGACAACTTCATGTACCCCCAGCAGAGCCTGCACCCCAGCCAGAGGGGGCCCAACTTCGCCATCGGGGAATACACCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACTGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCTGGCAGAACTCCATCCGGCACAACCTGTCCCTCAATGACTGC
  5   1   2       bld Gas8 5g3  in                          st84i07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATCGCAGGAATGAACCCAGTCCAGCAACCTGCCCAGCAGCGCTCCCCTGCCTCCAGCCTGCCTCACCCCAAACGGGCCCAGGAGGCCCCGGACATGGCACTTTATTGTGACAACTTCATGTACCCCCAGCAGAGCCTGCACCCCAGCCAGAGGGGGCCCAACTTCGCCATCGGGGAATACACCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACCGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCTGGCAGAACTCCATCCGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGGTGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACCCCAACTGCGAGAAGATGTTCGACAATGGCAATTTCCGTCGGAAG
  5   1   2       bld Gas1 5g                            IMAGE:6988674                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGCAGGATGAACCCAGTCCAGCAACCTGCCCAGCAGCGCTCCCCTGCCTCCAGCCTGCCTCACCCCAAACGGGCCCAGGAGGCCCCGGACATGGCACTTTATTGTGACAACTTCATGTACCCCCAGCAGAGCCTGCACCCCAGCCAGAGGGGGCCCAACTTCGCCATCGGGGAATACACCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACCGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCtggcagaactccatccggcacaacctgtccctcaatgactgcttcaagaaggtgccaagggatgagaatgatccagganaaggaaactactggactctggaccccaactgcgagaagatgttcgacaatggcaatttccgtcggaagagaaagCCCAAGTCTGACGCCAACAGCGCTAAAATCGCCAAGATCGGAGAGGATCACTTGAACCCAAAAGGCAAGAGAGCCACCCATGATTACTCCCCTCTCCCCGAGGAGCCGTCTCCACAGGCCATAGCAGA
  5   1   2       bld Gas  5g                        TGas085c11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGGATGAACCCAGTCCAGCAACCTGCCCAGCAGCGCTCCCCTGCCTCCAGCCTGCCTCACCCCAAACGGGCCCAGGAGGCCCCGGACATGGCACTTTATTGTGACAACTTCATGTACCCCCAGCAGAGCCTGCACCCCAGCCAGAGGGGGCCCAACTTCGCCATCGGGGAATACACCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACTGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCTGGGAGAACTCCA
  5   1   2       bld Neu  5g                        TNeu028g06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGGATGAACCCAGTCCAGCAACCTGCCCAGCAGCGCTCCCCTGCCTCCAGCCTGCCTCACCCCAAACGGGCCCAGGAGGCCCCGGACATGGCACTTTATTGTGACAACTTCATGTACCCCCAGCAGAGCCTGCACCCCAGCCAGAGGGGGCCCAACTTCGCCATCGGGGAATACTCCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACCGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCtggcagaactccatccggcacaacctgtccctcaatgactgcttcaagaaggtgccaagggatgagaatgatccangaaaaggaaactactggactctggacccCAACTGCGAGAAGATGTTCGACAATGGCAATTTCCG
  5   1   2       bld Gas  FL   in                   TGas064e18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGAACCCAGTCCAGCAACCTGCCCAGCAGCGCTCCCCTGCCTCCAGCCTGCCTCACCCCAAACGGGCCCAGGAGGCCCCGGACATGGCACTTTATTGTGACAACTTCATGTACCCCCAGCAGAGCCTGCACCCCAGCCAGAGGGGGCCCAACTTCGCCATCGGGGAATACACCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACTGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCtggcagaactccatccggcacaacctgtccctcaatgactgcttcaagaaggtgccaagggatgagaatgatccaggaaaaggaaactactggactctggac
  5   1   2       bld Gas                            TGas085d22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCAGTCCAGCAACCTGCCCAGCAGCGCTCCCCTGCCTCCAGCCTGCCTCACCCCAAACGGGCCCAGGAGGCCCCGGACATGGCACTTTATTGTGACAACTTCATGTACCCCCAGCAGAGCCTGCACCCCAGCCAGAGGGGGCCCAACTTCGCCATCGGGGAATACACCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACCGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTAGGCAAAAACTTCCCCTTTCTACAAAAA
  5   1   2       bld Gas7                                  XZG9194.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAGCAACCTGCCCAGCAGCGCTCCCCTGCCTCCAGCCTGCCTCACCCCAAACGGGCCCAGGAGGCCCCGGACATGGCACTTTATTGTGACAACTTCATGTACCCCCAGCAGAGCCTGCACCCCAGCCAGAGGGGGCCCAACTTCGCCATCGGGGAATACACCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACCGAGCTGAGCTGGATGTCTGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCtggcagaactccatccggcacaacctgtccctcaatgactgcttcaagaaggtgccaagggatgagaatgatccaggaaaaggaaactactggactctggaccccaactgcgagaagatgttcgacaatggcaatttccgtcggaagagaaagCCCAAGTCTGACGCCAACAGCGCTAAAATCGCCAAGATCGGAGAGGATCACTTGAACCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCTATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCCACAGACAGGGCCCCTTGGGGC
  5   1   2       bld Gas8      in                           st3n05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACCTGGCCCAGCAGCGCTTCCCCTGCCTCCAGCCTGCCTCACCCCAAACGGGCCCAGGAGGCCCCGGACATGGCACTTTATTGTGACAACTTCATGTACCCCCAGCAGAGCCTGCACCCCAGCCAGAGGGGGCCCAACTTCGCCATCGGGGAATACTCCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACCGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCTGGCAGAACTCCATCCGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGGTGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACCCCAACTGCGAGAAGATGTTCGACAATGGCAATTTCCGTCGGAAGAGAAAGCCCAAGTCTGACGCCAACAGCGCTAA
  5   1   2       chi Gas7      in                         XZG49023.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAGGATGAACCCAGTCCAGCAACCTGCCCAGCAGCGCTCCCCTGCCTCCAGCCTGCCTCACCCCAAACGGGCCCAGGAGGCCCCGGACATGGCACTTTATTGTGACAACTTCGCCATCGGGGAATACACCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACCGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCtggcagaactccatccggcacaacctgtccctcaatgactgcttcaagaaggtgccaagggatgagaatgatccaggaaaaggaaactactggactctggaccccaactgcgagaagatgttcgacaatggcaatttccgtcggaagagaaagCCCAAGTCTGACGCCAACAGCGCTAAAATCGCCAAGATCGGAGAGGATCACTTGAACCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGAACAACTTCATCGGCAGCATGACCG
  5   1   2       bld Gas7      in                         XZG40544.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAGGCCCCGGACATGGCACTTTATTGTGACAACTTCATGTACCCCCAGCAGAGCCTGCACCCCAGCCAGAGGGGGCCCAACTTCGCCATCGGGGAATACACCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACCGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCtggcagaactccatccggcacaacctgtccctcaatgactgcttcaagaaggtgccaagggatgagaatgatccaggaaaaggaaactactggactctggaccccaactgcgagaagatgttcgacaatggcaatttccgtcggaagagaaagCCCAAGTCTGACGCCAACAGCGCTAAAATCGCCAAGATCGGAGAGGATCACTTGAACCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCTCCCCCGAGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCCACTTCATCGGCAGCATGAC
  5   1   2       bld Gas                            TGas026a14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCCGGGATCGGGGAATACTCCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACCGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCtggcagaactccatccggcacaacctgtccctcaatgactgcttcaagaaggtgccaagggatgagaatgatccaggaaaaggaaactactggactctggaccccaactgcgagaagatgttcgacaatggcaatttccgtcggaagagaaagCCCAAGTCTGACGCCAACAGCGCTAAAATCGCCAAGATCGGAGAGGATCACTTGAACCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGA
  5   1   2       bld Neu                            TNeu012h23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACCTCTCCGGCTAATCCTTACTTATGGCTGGGGGGCCATGGGGTGAACAATGCACCCAATTACAGCCCTTCCCCGGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACCGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCtggcagaactccatccggcacaacctgtccctcaatgactgcttcaagaaggtgccaagggatgagaatgatccaggaaaaggaaactactggactctggaccccaactgcgagaagatgttcgacaatggcaatttccgtcggaagagaaagCCCAAGTCTGACGCCAACAGCGCTAAAATCGCCAAGATCGGAGAGGATCACTTGAACCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCCTCCC
  5   1   2       bld Gas8      in                         st101h02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGCGCCTTACATGCCCCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACCGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCTGGCAGAACTCCATCCGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGGTGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACCCCAACTGCGAGAAGATGTTCGACAATGGCAATTTCCGTCGGAAGAGAAAGCCCAAGTCTGACGCCAACAGCGCTAAAATCGCCAAGATCGGAGAGGATCACTTGAACCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAAC
  5   1   2       bld Gas                            TGas099g01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCGTCCTTTGGCGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACTGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCTGGCAGAACTCCATCCGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGGTGCCAAGGGATGAGAATGATCCAGGTAAGCGTCTGTAATGCCCCTTTGCACTATGTCCCCTGTATGGGGGCAGTTTCTATTCTTGCACCCCCCACCCCTTGATAAATAAGCCTAGCCTTTCCCTCCCTCCAAGGTTAATTTTTGTCTATTTCTGGACCAACTTTCTCTACATCTGTGTATTGGCTGGGTTCCCTCTCACACACACATTAAATATATTATTACACATTACACTTTTTATTTTAGGTAAACTTCCCCTTGCCAAAAATTGCTCCTACTTCCCCAT
  5   1   2       bld Gas       in                   TGas079b08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCCCCCCAGCGGCAGTTCCTGCCCAACTCCCCCGCCTTTGGCGGCACCGAGCTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCtggcagaactccatccggcacaacctgtccctcaatgactgcttcaagaaggtgccaagggatgagaatgatccaggaaaaggaaactactggactctggaccccaactgcgagaagatgttcgacaatggcaatttccgtcggaagagaaagCCCAAGTCTGACGCCAACAGCGCTAAAATCGCCAAGATCGGAGAGGATCACTTGAACCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCTTGGGGCT
  5   1   2       bld Gas1                               IMAGE:6989233                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGAGCTGGATGTCGGCGGCTTCCCAGGAGGAACTTCTGAAAATGGTGAGACCCCCGTACTCCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCAGATCTACCAGTATGTGGCAGAAAACTTCCCTTTCTACAAAAAGAGCAAAGCAGGCtggcagaactccatccggcacaacctgtccctcaatgactgcttcaagaaggtgccaagggatgagaatgatccaggaaaaggaaactactggactctggaccccaactgcgagaagatgttcgacaatggcaatttccgtcggaagagaaagCCCAAGTCTGACGCCAACAGCGCTAAAATCGCCAAGATCGGAGAGGATCACTTGAACCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCTTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTTCTT
  5   1   2       bld Gas7      in                          XZG7150.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTACTCTGCCCTCATCGCCATGGCCATCCAGCATGCCAGCGATAGGAGGCTGACCCTGAGCCATATCTACCAGTATGTGGCAGAAAACTTCCNCTTTCTACAAAAAGAGCAAAGCAGGCTGGCAGAACTCCATCCGGCACAACCTGTCCCTCAATGACTGCTTCAAGAAGGTGCCAAGGGATGAGAATGATCCAGGTAAGCGTCTGTAATGCCCCTTTGCACTATGTCCCTTGTATGGGGGCAGTTTCTATTCTTGCACCCCCCCCCCCCCTTGATAAATAAGCCTACCCTTTCCCTCCCTCCATGGGTAATTTTTGTCTATTTCTGGACCACCTTTCTCTACATCTGCATCTAAACTGCTTATTAAATGCATCATTACACGTTACATTTTTTATTTTAGGTAAACTTCCCCTTGCCAACAATGGCTCCTAGTTCCCCATAGCAACCAGTCAGCAGTTAGATTTTAGTTACATAGCGGTGTTTGCAACTAACTGCTGGGTAACAGATGTTTGGCCCATATTGCCACATTGCTTGCCAATGACTACCCAATGCCGTGCCTAATTATGAATTGGTAGGACATTTCCTTGCAATAAGTTATGTATTTGGACCCTTGGGGGTTAATGAAAGCAATGGCTTATGAATAGACTATTAATACTTATTTTTTCCCCTTAGGAAAAGGAAACTACTGGACTCTGGACCCCAACTGCG
  5   1   2       bld Gas8      in                           st3m05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCAATGACTGCTTCAAGAAGGTGCCAAGGGATGAGAATGATCCAGGAAAAGGAAACTACTGGACTCTGGACCCCAACTGCGAGAAGATGTTCGACAATGGCAATTTCCGTCGGAAGAGAAAGCCCAAGTCTGACGCCAACAGCGCTAAAAT
  5   1   2       bld Gas7                                 XZG10216.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGATCCAGGAAAAGGAAACTACTGGACTCTGGACCCCAACTGCGAGAAGATGTTCGACAATGGCAATTTCCGTCGGAAGAGAAAGCCCAAGTCTGACGCCAACAGCGCTAAAATCGCCAAGATCGGAGAGGATCACTTGAACCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCTTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTTCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCT
  5   1   2      seed Gas7      in                         XZG33529.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAAACTACTGGACTCTGGACCCCAACTGCGAGAAGATGTTCGACAATGGCAATTTCCGTCGGAAGAGAAAGCCCAAGTCTGACGCCAACAGCGCTAAAATCGCCAAGATCGGAGAGGATCACTTGAACCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCCTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTCCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTACAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATATTTTTATTTAANAAA
  5   1   2       bld Gas7      in                         XZG36872.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTGGACTCTGGACCCCAACTGCGAGAAGATGTTCGACAATGGCAATTTCCGTCGGAAGAGAAAGCCCAAGTCTGACGCCAACAGCGCTAAAATCGCCAAGATCGGAGAGGATCACTTGAACCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCCTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTCCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCT
  5   1   2       bld Gas7      in                         XZG22682.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTCGACAATGGCAATTTCCGTCGGAAGAGAAAGCCCAAGTCTGACGCCAACAGCGCTAAAATCGCCAAGATCGGAGAGGATCACTTGAACCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCTTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCTCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTCCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGA
  5   1   2       bld Gas7                                 XZG62828.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCCAACAGCGCTAAAATCGCCAAGATCGGAGAGGATCACTTGAACCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCACCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCCTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTCCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTACAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGGTC
  5   1   2       bld Tbd1      in                        CBXT18683.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACCGCTAAAATCGCCAAGATCGGAGAGGATCACTTGAACCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCTTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTCCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACATGGGTGTCACATGGTTCTTTATTTATAACTTTATTTAATAAAAAAGAAAAACATGA
  3   1   2       bld Te5       in                         CAAO3023.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGGATCACTTGAACCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCCTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTCCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTACAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATCTATATTTTTATTTAATAAAAAAGAAAAACATG
  3   1   2       bld Gas7 5g3  in                         XZG62024.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGGATCACTTGAACCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCTTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTTCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATAACTTTATTT
  3   1   2       bld Tbd1      in                        CBXT18683.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAACCCAAAAGGCAAAGAGAGCCCCCCCCATGATTACTCCCTCCTCCCCCCGAGGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCTTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTTTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTCCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATTTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTTTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTTTTTTTATTTTTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACATGGGTGTCACATGGTTTTTTATTTATAACTTTATTTAATAAAAAAGAAAAACATGAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG22682.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTGACCCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCTTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCTCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTCCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATAACTTTATTTAATAAAAAAGAAAAAC
  5   1   2       bld Gas7      in                         XZG62047.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCAAAAGGCAAAGAGAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCTTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTTCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGNGTGTCACATGGTTCTTTATTTATAACTTTATTTTATANAAA
  3   1   2       bld Gas7      in                         XZG33529.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAGAGCCCACCCATGATTACTCCCTCCTCCCCCGAGGAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCCTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTCCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTACAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATATTTTTATTTAATAAAAAAGAAAAAACATG
  3   1   2       bld Gas7 5g3  in                         XZG27458.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCTTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTTCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATAACTTTATTTAATAAAAAAGAAAAACATGAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7      in                         XZG62047.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCCGTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCTTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTTCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATAACTTTATTTAATAAAAAAGAAAAACATG
  3   1   2       bld Gas7      in                          XZG7150.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCTCCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCCTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTCCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTACAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATATTTTTATTTAATAAAAAAGAAA
  3   1   2       bld Gas                             TGas073i24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACAGGCCATAGCAAGAGCCCATCTCCCCNCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCTTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTTTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTTTTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATAACTTTATTTAATAAAAAAGNAAAAACATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas8 5g3  in                          st84i07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTNTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCTTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATNTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACNCCTCCCTGTTNTATAACAGAAGCCCCTATTACAGTTCCTTCCCCNCCNCTGCCCAGAAGCAGCCGCAGTTTNTTCAGCAGCCCCCTTTGTACCNGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCNGGACTGAAATNTCCCGCGCAAGGGNCTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCNCAAGTTTAGGGAATAAGGAGTTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACA
  3   1   2       bld Gas  5g3  in                    TGas114g01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCTTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTTTTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATAACTTTATTTAATAAAAAAGAAAAACATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas079b08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCTTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGTTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTTCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATAACTTTATTTAATAAAAAAGAAAAACATGAAAAAAAAAAAAA
  3   1   2       bld Neu  5g3  in                    TNeu088o05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCCTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTCCTTCAGCAGCCTCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTACAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATATTTTTATTTAATAAAAAAGAAAAACATGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  FL   in                    TGas064e18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGCCATAGCAAGAGCCCATCTCCCCCCAGCGGTCACCTATACCCCCTGTTTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCTTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTTTTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATAACTTTATTTAATAAAAAAGAGAAACCA
  3   1   2       bld Gas7      in                         XZG40544.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCTTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTTCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATAACTTTATTTAATAAAAAAGAAAACCATG
  3   1   2       bld Gas7      in                         XZG49023.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGCCATAGCAAGAGCCCATCTCCCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCTTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTTCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATAACTTTATTTAATAAAAAAGAAAAACCTG
  3   1   2       bld Gas7      in                         XZG36872.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCCAGCGGTCACCTATACCCCCTGTCTGACCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCCTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTCCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTACAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATATTTTTATTTAATAAAAAAGAAAAACATG
  3   1   2       bld Gas                             TGas066g07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCCCTGTCTGACCAACTTCATTGGCAGCATGCCCACCGTGGATGCAGCTACAGCCAACTGACAGGGCCCCCTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTCCTTCAGCAGCCCCCTTTGTCCCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTACAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTACCCTGTATATATATGTTGTGACCCGAAAGGGCGCATGGTTCTTTATTTATATTTTTATTAATAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 5g3  in                         XZG19485.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAACTTCATCGGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCCTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATCTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTCCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTACAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATATTTTTATTTAATAAAAAAGAAAAACATG
  3   1   2       bld Gas7 PIPE out                        XZG34444.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCAGCATGACCGCCGTGGATGCAGCTACAGCCAACAGACAGGGCCCCTTGGGGCTCCTCAATGAACTGTCTCAGAGGAACATCAGCAGCTTGAGCAGCTTCATTTCGGGCTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTTTATAACAGAAGCCCCTTTTACAGTTCCTTTCCCACCACTGCCCAGAAGCAGCCGCAGTTTTTTCAGCAGCCCCCTTTGTTCCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATTTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTTTCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCCCAAGTTTAGGGAATAAGGAGTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTTTTATCTTTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCCGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATAACTTTATTTAATAAAAAAGAAAAACCTG
  5   1   2       bld Gas                            TGas040a18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACACCTCCCTGTTCTATAACAGAAGCCCCTATTACAGTTCCTTCCCCACCACTGCCCAGAAGCAGCCGCAGTTTCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATAACTTTATTTAATAAAAAAGAAAAACATG
  3   1   2       bld Gas8      in                         st101h02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCCGCAGTGGATCAGAGTGCAGAGCATCCGGACNCCTCCCTGTTNTATAACAGAAGCCCCTATTACAGTTCCTTNCCCNCCNCTGCCCAGAAGCAGCCGCAGTTTTTTCAGCAGCCCCCTTTGTNCCNGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATNTCCCGCGCAAGGGNCTACCCTAAACTGCAAATACTNTCATCCATAGCTGGCTGAGGATGCTGGGAAANGTAGTTCNCAAGTTTAGGGAATAAGGAGTTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACT
  3   1   2       bld Gas8      in                           st3n05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TNCGCAGTGGATCAGAGTGCAGAGCNTCCGGACNCCTCCCTGTTTTATAACNGAAGCCCCTNTTACAGTTCCTTNCCCNCCNCTGCCCNGAAGCAGCCGCAGTTTTTTCAGCAGCCCCCTTTGTNCCNGGGAAGGTNCTGAAGCGGAGTTGGAAGTGACNTTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCNGGNCTGAAATNTCCCGCGCAAGGGNCTNCCCTAAACTGCAAATACTNTCNTCCNTAGCTGGCTGAGGATGCTGGGAAANGTAGTTCNCAAGTTTAGGGAATAAGGNGTTTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCCTGTATATATATGTTGTGACTTGGGTGTCACA
  3   1   2       bld Gas8      in                           st3m05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTNTTTTATAACNGAAGCCCCTNTTACNGTTCCTTNCCCNCCNCTGCCCNGAAGCNGCCGCAGTTTTTTCAGCNGCCCCCTTTGTNCCCGGGAAGGTNCTGAAGCGGAGTTGGAAGNGACNTTTNTAGGAAAAGACTGGGGGATACGNGGGGGGTCCNGGNCTGAAATTTCCCGCGCAAGGGNCTNCCCTAAACTGCAAATNCTNTCNTCCNTAGCTGGCTGAGGNTGCTGGGAAANGTAGTTCCCAAGTTTAGGGAATAAGGNGTTTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACCATGGTTCTTATTATA
  5   1   2       bld Gas                            TGas045a18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTCCTTCCCCACCACTGCCCANAAGCAGCCGCAGTTTCTTCAGCAGCCCCCTTTGTACCAGGGAAGGTACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATAACTTTATTTAAT
  3   1   2       bld Tbd0 FL   in                    IMAGE:5336445.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCCCCTTTTTTCCAGGGAAGGTTTTGAAACGGAGTTGGAAGTGACATTTTTAGGAAAAAACTGGGGGATACGTGGGGGGTCCAGGACTGAAATTTTCCCCGCAAGGGACTTCCCTAAACTGCAAATACTTTCATCCATAACTGGCTGAGGATTCTGGGAAAATTAGTTTCCAAGTTTTGGGAATAAGGAGTTTTTTTTTTTTTGAAAATTTATTTTGTATAATGGGGGCTGCTAAAACAATCTGGGAGTTTTATTCCACCAAATGGTTCAAAACCAGACTTTTTTTTTTTTTGTTTTAAGACAAAGGAAAGAGCAATTTTTTGCCTTGGGTAACCCGTAAAAAAATGTTGTGACTTGGGGGTCCCAAGGTTTTTTATTTATATTTTTTTTTAATAAAAAAGAAAAACCTGGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG
  3   1   2       bld Gas       in                    TGas139n23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACTGAAGCGGAGTTGGAAGTGACATTTGTAGGAAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATAACTTTATTTAATANAAAAAGAAAAACATGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas       in                   TGas139n23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAGCGGATTGGAATGACATTTGTAGAAAGACTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGATGCTGGGAAATGTAGTTCACAAGTTTAGGAATAAGAGTTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAAAGCATGCTG
  5   1   2       bld Neu                            TNeu012k17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGAAGTGACATTTGTAGGAAAACCTGGGGGATACGTGGGGGGTCCAGGACTGAAATCTCCCGCGCAAGGGACTACCCTAAACTGCAAATACTATCATCCATAGCTGGCTGAGGATGCTGGGAAATGTAGTTCACAAGTTTAGGGAATAAGGAGTTTTTTTTTTTCTTGAAAGTTTATTTTGTATAATGGTGGCTGCTAGAGCATGCTGGGAGTTGTATGCCAGCAAATGGTATAAAGCCAGACTCTTCTTATCTCTGTTATAAGACAAAGGAATGAGCAATATTTTGCATTGTGTAACCTGTATATATATGTTGTGACTTGGGTGTCACATGGTTCTTTATTTATAACTTTATTTAATAAAAAAGAAAAACATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)