Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 05 Jun 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-IMAGE:6991347.5                       8 END     6          14       85                Unknown (protein for MGC:121328) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012074847 Xt7.1-IMAGE:6991347.3 - 42 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     4     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     6     4     6     5     6     5     7     5     7     6     7     6     7     7     8     7     8     7     8     6     7     6     7     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     5     5     6     5     6     5     6     5     7     5     7     6     7     7     8     7     8     7     8     7     8     8     9     8     9     8     9     8     9     7     8     7     8     6     7     6     7     7     8     7     8     7     8     7     8     7     8     7     9     8    11     9    11     9    12     9    12     9    12     8    12     8    12     8    12     9    14     9    14     9    14    10    15    14    20    14    21    18    22    19    23    19    23    21    25    22    26    21    25    21    25    21    24    21    24    21    25    20    25    21    25    22    25    21    26    22    27    23    27    22    27    22    27    22    27    23    27    21    26    21    26    22    25    21    25    21    25    22    25    21    25    23    25    23    25    27    30    27    30    28    30    28    30    27    30    26    30    26    29    26    29    26    29    24    29    27    29    24    29    26    28    25    28    27    29    26    29    28    29    27    29    27    28    27    28    25    28    24    28    25    27    25    26    25    26    24    25    23    24    20    23    16    21    17    20     3     9     8     9
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTAAGAATGTTAAATGGCTAAAA
                                                                       ...PROTEIN --- Bb ---- 3e-030     BAC06835.1 Bb-cadherin [Branchiostoma belcheri] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                      PROTEIN --- Cs ---- 1e-039     BAB70657.1 Delta [Ciona savignyi] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 3e-039     NP_500460.1 EGF-like protein [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Bf ---- 2e-050     CAC19873.1 putative notch receptor protein [Branchiostoma floridae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 8e-050     NP_476859.2 CG3936-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 2e-052     BAE78963.1 Ci-Notch protein [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                              PREDICTED - Sp ---- 1e-055     XP_001178383.1 PREDICTED: similar to fibropellin Ib isoform 3 [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                  PROTEIN --- Mm ---- 3e-072     NP_031892.2 delta-like 3 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 1e-072     NP_005609.3 delta-like 1 [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 2e-076     XP_421132.2 PREDICTED: similar to delta-like 4 protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                               PREDICTED - Dr ---- 2e-108     XP_694695.1 PREDICTED: similar to DeltaC [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                      PROTEIN --- Xl ---- 0          AAB37131.1 Notch ligand X-Delta-2 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                      PROTEIN --- ?? ---- 0          NP_001079551.1 similar to delta-like 1 [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                      PROTEIN --- Xt ---- 0          AAI35386.1 Unknown (protein for MGC:121328) [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xt7.1-IMAGE:6991347.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------TAA------------------------------------------------------TAG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------TAA------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------TGA---------------------------------TAG------------ATG------TGA------------------------------------ATGTAA------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       bld Gas7      in                         XZG47048.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTCTTTCTCTCTGTTTGTTACACTTTCCTAACCTTTTTCTCTGCTTTTCTCTTTACTTATATGTGCTTCTTTCCACTTTCACCACATAAAAACATCACTTTGTCTCTCTTTGTTTTCATAAAATCTTTTATTCTTTTCATTCCAAATATCAACTCTACTTTATTCTCCACATTGGCTTGTCTTTGCCCATCATTCTTGGTCATCCTATTCTCCTCTCTCCTTTTACTATACTTTGCCACCTTTTGTACATTTTCTCTCTGCCTGCCCACATTATCCCTCTCAGGACCTGGAAAATGACTATGAATGTGTTTGCCCACGGGGCTTCTATGGCAAGAACTGTGATATCAGCGCTATGACATGTGAGGATGGCCCTTGCTTTAATGGGGGCACCTGTATTGAGAAGAGCAGTGGAGTAGGGTACATCTGCCGCTGCCCCCTCAACTACCATGGCTCTAACTGTGAAAAGAAGATTGATCGCTGTACCAACAGTCCCTGTCTGAATGGTGAGTCCTCAGAAATCCCAAACCAGTTAGGATATTGCTGAGTGTATGGAAAGGTTGAACTTGAAAACAGGTATAGTTTTCTGCCTAACTTACAATGTTTTGTCACTATGTGACATTCTGAAAGTCAGCCACCCATTACTACTTATCATTAACATTACAACATTATCACAGTGATAACATGTAGTAACCATAGTGCCATATTTTACATTACAGATTTGTGACACAAGATTTGGTTTTGAAGCGGTTATACACCATCTTTTAATAACTGATTT
  5   1   2       bld Gas7      in                         XZG64126.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATTAACATTACAACATTATCACAGTGATAACATGTAGTAACCATAGTGCCATATTTTACATTACAGATTTGTGACACAAGATTTGGTTTTGAAGCGGTTATACACCATCTTTTAATAACTGATTTTGGGTCCCTACCCACAGTCTAAGAATTCCTGTTCTACCTATCATAGTCATAATCATGTACATATCATAGTGTATAACACTTGTGTTCTTTCTTGTCCAATTGCTCTAAAGTCTATTTTCTCTCATTCCATTCAGGAGGTCAGTGTCTAGACATGGGCCGAAATGTATTGTGCAAGTGCCGTCCTGGATTTTCTGGTCCTAGATGTGAGCTAAACATTGATGACTGTGCTAGTAACCCATGTGCAAATGGAGGTACTTGTGTCGATGCAGTGAACAGCTATACATGCTCCTGCACTCTTGGATATGGGGGCAAAGACTGTACCCTACGGGTAGATGCCTGCAGTTCCCAACCCTGCAGCAATGGTGGAACCTGCTTCACCCACTTTAGTGGCCATGTATGCCAGTGCCCCACAGGCTTCATGGGAACCAGTTGTGAATTTAGAGTACATGATCCCACCCCAGCTTCCCATGGTGCTGACTCCTCAAACACTCTTACTATGGTGGTTTGTCTGGGACTGCTGACATTCTTTTTGCTAGGCTGTGGAGTATACTTGGTTATGAGAGGTATGAGAAGGGGGCACTTCAATGAAAAAGGACGAGTCAA
  5   1   2       bld Gas8      in                          st86g06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAATGGAGGCAGTTGCAACGACCTGGAAAATGACTATGAATGTGTTTGCCCACGGGGCTTCTATGGCAAGAACTGTGATATCAGCGCTATGACATGTGAGGATGGCCCTTGCTTTAATGGGGGCACCTGTATTGAGAAGAGCAGTGGAGTAGGGTACATCTGCCGCTGCCCCCTCAACTACCATGGCTCTAACTGTGAAAAGAAGATTGATCGCTGTACCAACAGTCCCTGTCTGAATGGAGGTCAGTGTCTAGACATGGGCCGAAATGTATTGTGCAAGTGCCGTCCTGGATTTTCTGGTCCTAGATGTGAGCTAAACATTGATGACTGTGCTAGTAACCCATGTGCAAATGGAGGTACTTGTGTCGATGCAGTGAACAGCTATACATGCTCCTGCACTCTTGGATATGGGGGCAAAGACTGTACCCTACGGGTAGATGCCTGCAGTTCCCAACCCTGCAGCAATGGTGGAACCTGCTTCACCCACTTTAGTGGCCATGTATGCCAGTGCCCCACAGGCTTCATGGGAACCAGTTGTGAATTTAGAGTACATGATCCCACCCCAGCTTCCCATGGTGCTGACTCCTCAAACACTCTTACTATGGTGGTTTGTCTGGGACTGCTGACATTCTTTTTGCTGGGCTGTGGAGTATACTTGGTTATGAGAGGTATGAGAAGGGGGCACT
  5   1   2       bld Gas7      in                         XZG35218.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGAAAAGAAGATTGATCGCTGTACCAACAGTCCCTGTCTGAATGGAGGTCAGTGTCTAGACATGGGCCGAAATGTATTGTGCAAGTGCCGTCCTGGATTTTCTGGTCCTAGATGTGAGCTAAACATTGATGACTGTGCTAGTAACCCATGTGCAAATGGAGGTACTTGTGTCGATGCAGTGAACAGCTATACATGCTCCTGCACTCTTGGATATGGGGGCAAAGACTGTACCCTACGGGTAGATGCCTGCAGTTCCCAACCCTGCAGCAATGGTGGAACCTGCTTCACCCACTTTAGTGGCCATGTATGCCAGTGCCCCACAGGCTTCATGGGAACCAGTTGTGAATTTAGAGTACATGATCCCACCCCAGCTTCCCATGGTGCTGACTCCTCAAACACTCTTACTATGGTGGTTTGTCTGGGACTGCTGACATTCTTTTTGCTGGGCTGTGGAGTATACTTGGTTATGAGAGGTATGAGAAGGGGGCACTTCAATGAAAAAGGACGAGTCAAAAACAACCTGGAACCAAAGAATAATCTGATAGAAAAGGAACCCCATTTCAAAATACCTAATCCAGACTATCTAAGAGAAAAATCAAGTAGCAAACAGAAGCTTCTACAAGGATCTGAAAGTGAGGAAGAAAGAAGTGGACGCAGAAGTGATCGAAAGCCAGAAATCAGACAGTGTAACTCCACTTCAAAGTATCCAGAGGATGGCGCTTATCACCCAATATATATTCTTCCGGAACCTGAGCAGTGTATATTTGCTACTGAGGTCTAATCATCCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTAAAGCTGATACT
  5   1   2       bld TbA       in                   TTbA018b19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGAAAGAAGATTGATCGCTGTACCCTCTACACCGTCTGAATGGAGGTCAGTGTCTAGACATGGGCCGAAATGTATTGTGCAAGTGCCGTCCTGGATTTTCTGGTCCTAGATGTGAGCTAAACATTGATGACTGTGCTAGTAACCCATGTTT
  5   1   2       bld Gas7      in                         XZG65724.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGACGCGTGGGCGGACGCGTGGGGAAATGTATTGTGCAAGTGCCGTCCTGGATTTTCTGGTCCTAGATGTGAGCTAAACATTGATGACTGTGCTAGTAACCCATGTGCAAATGGAGGTACTTGTGTCGATGCAGTGAACAGCTATACATGCTCCTGCACTCTTGGATATGGGGGCAAAGACTGTACCCTACGGGTAGATGCCTGCAGTTCCCAACCCTGCAGCAATGGTGGAACCTGCTTCACCCACTTTAGTGGCCATGTATGCCAGTGCCCCACAGGCTTCATGGGAACCAGTTGTGAATTTAGAGTACATGATCCCACCCCAGCTTCCCATGGTGCTGACTCCTCAAACACTCTTACTATGGTGGTTTGTCTGGGACTGCTGACATTCTTTTTGCTGGGCTGTGGAGTATACTTGGTTATGAGAGGTATGAGAAGGGGGCACTTCAATGAAAAAGGACGAGTCAAAAACAACCTGGAACCAAAGAATAATCTGATAGAAAAGGAACCCCATTTCAAAATACCTAATCCAGACTATCTAAGAGAAAAATCAAGTAGCAAACAGAAGCTTCTACAAGGATCTGAAAGTGAGGAAGAAAGAAGTGGACGCAGAAGTGATCGAAAGCCAGAAATCAGACAGTGTAACTCCACTTCAAAGTATCCAGAGGATGGCGCTTATCACCCAATATATATTCTTCCGGAACCTGAGCAGTGTATATTTGCTACTGAGGTCTAATCATCCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTNAAGCTGATACTTTCCCCCTTNNATATTTAAAATAATCC
  5   1   2       chi Gas7      in                         XZG56344.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCACGCGTCCGATTTTCTGGTCCTAGATGTGAGCTAAACATTGATGACTGTGCTAGTAACCCATGTGCAAATGGAGGTACTTGTGTCGATGCAGTGAACAGCTATACATGCTCCTGCACTCTTGGATATGGGGGCAAAGACTGTACCCTACGGGTAGATGCCTGCAGTTCCCAACCCTGCAGCAATGGTGGAACCTGCTTCACCCACTTTAGTGGCCATGTATGCCAGTGCCCCACAGGCTTCATGGGAACCAGTTGTGAATTTAGAGTACATGATCCCACCCCAGCTTCCCATGGTGCTGACTCCTCAAACACTCTTACTATGGTGGTTTGTCTGGGACTGCTGACATTCTTTTTGCTGGGCTGTGGAGTATACTTGGTTATGAGAGGTATGAGAAGGGGGCACTTCAATGAAAAAGGACGAGTCAAAAACAACCTGGAACCAAAGAATAATCTGATAGAAAAGGAACCCCATTTCAAAATACCTAATCCAGACTATCTAAGAGAAAAATCAAGTAGCAAACAGAAGCTTCTACAAGGATCTGAAAGTGAGGAAGAAAGAAGTGGACGCAGAAGTGATCGGTCTAATCATCCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAG
  5   1   2       chi Tad5      in                         XZT41012.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCAAATAATGATATATGAAGGAAAGTGAGAAGGAACTGTTGCCTCTTACTTCTAAATCTGACAATGCCTCATACAGGAACATAGAATGGCACAGACAGGTGAGATTTCAGTCAGAATTACTGATATCTGATTGAATCATAGAATGACTTGTCCAAACTGTCTGCCATTGTCCACATACATGCACTGATTGGTTTGTCCAGAAACAGGAAAAGTGATGTACCGTGTTAGCCAGTCAAAATGTTTACAGGGTAACCCTTTTCAAAAGGGTTGTCCAGAAAGAAATGAGCTAAAGTGCCCAACAGCCTCTGCGCAGGTTATGGATACCTTTACTTGAGCAAACACTTCTTGAGCCATTAACCTGTATATGTATGCGTGTAGCAATATGAAAGGTCTGCAACTCCAAGCTGTACTTACAATACCTTTACTTACCCTTACTTCTTCTCTCCTTCCTCAGGTCTAATCATCCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAGAGAAGACTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTTACTAATGGAGAAAGAA
  5   1   2       bld Neu                            TNeu012j22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTAGAGTCATGATCCCCCCCACTTCCCTGGTGCTGACTCCTCAAACACTCTTACTATGGTGGTTTGTCTGGGACTGCTGACATTCTTTTTGCTGGGCTGTGGAGTATACTTGGTTATGAGAGGTATGAGAAGGGGGCACTTCAATGAAAAAGGACGAGTCAAAAACAACCTGGAACCAAAGAATAATCTGATAGAAAAGGAACCCCATTTCAAAATACCTAATCCAGACTATCTAAGAGAAAAATCAAGTAGCAAACAGAAGCTTCTACAAGGATCTGAAAGTGAGGAAGAAAGAAGTGGACGCAGAAGTGATCGAAAGCCAGAAATCAGACAGTGTAACTCCACTTCAAAGTATCCAGAGGATGGCGCTTATCACCCAATATATATTCTTCCGGAACCTGAGCAGTGTATATTTGCTACTGAGGTCTAATCATCCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTNTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTT
  5   1   2       bld Neu       in                   TNeu130p19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCCCCGGGAAACACTCTTACTATGGTGGTTTGTCTGGGACTGCTGACATTCTTTTTGCTGGGCTGTGGAGTATACTTGGTTATGAGAGGTATGAGAAGGGGGCACTTCAATGAAAAAGGACGAGTCAAAAACAACCTGGAACCAAAGAATAATCTGATAGAAAAGGAACCCCATTTCAAAATACCTAATCCAGACTATCTAAGAGAAAAATCAAGTAGCAAACAGAAGCTTCTACAAGGATCTGAAAGTGAGGAAGAAAGAAGTGGACGCAGAAGTGATCGAAAGCCAGAAATCAGACAGTGTAACTCCACTTCAAAGTATCCAGAGGATGGCGCTTATCACCCAATATATATTCTTCCGGAACCTGAGCAGTGTATATTTGCTACTGAGGTCTAATCATCCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTG
  5   1   2       bld Tad5      in                         XZT13530.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATTCTTTTTGCTAGGCTGTGGAGTATACTTGGTTATGAGAGGTATGAGAAGGGGGCACTTCAATGAAAAAGGACGAGTCAAAAACAACCTGGAACCAAAGAATAATCTGATAGAAAAGGAACCCCATTTCAAAATACCTAATCCAGACTATCTAAGAGAAAAATCAAGTAGCAAACAGAAGCTTCTACAAGGATCTGAAAGTGAGGAAGAAAGAAGTGGACGCAGAAGTGATCGAAAGCCAGAAATCAGACAGTGTAACTCCACTTCAAAGTATCCAGAGGATGGCGCTTATCACCCAATATATATTCTTCCGGAACCTGAGCAGTGTATATTTGCTACTGAGGTCTAATCATCCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAGAGAAGACTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCANAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCTACACATTGA
  5   1   2       bld Tad5                                 XZT54369.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAATCTGATAGAAAAGGAACCCCATTTCAAAATACCTAATCCAGACTATCTAAGAGAAAAATCAAGTAGCAAACAGAAGCTTCTACAAGGATCTGAAAGTGAGGAAGAAAGAAGTGGACGCAGAAGTGATCGAAAGCCAGAAATCAGACAGTGTAACTCCACTTCAAAGTATCCAGAGGATGGCGCTTATCACCCAATATATATTCTTCCGGAACCTGAGCAGTGTATATTTGCTACTGAGGTCTAATCATCCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAGAGAAGACTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATG
  3   1   2      seed Neu0 5g3  out                      IMAGE:6991347                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAATCCAGGTAGGCAAACGGAAGCTTTTACAAGGATCTGAAAGTGAGGAAGAAAGAAGTGGACGCAGAAGTGATCGAAAGCCAGAAATCAGACAGTGTAACTCCACTTCAAAGTATCCAGAGGATGGCGCTTATCACCCAATATATATTCTTCCGGAACCTGAGCAGTGTATATTTGCTACTGAGGTCTAATCATCCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAGAGAAGACTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGTTATTGTTTAAAGAGTT
  3   1   2       bld Gas                             TGas088g24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAGTAGCAAACAGAAGCTTCTACAAGGATCTGAAAGTGAGGAAGAAAGAAGTGGACGCAGAAGTGATCGAAAGCCAGAAATCAGACAGTGTAACTCCACTTCAAAGTATCCAGAGGATGGCGCTTATCACCCAATATATATTCTTCCGGAACCTGAGCAGTGTATATTTGCTACTGAGGTCTAATCATCCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAAAGACTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGTTATTGTTTAAAGAGTTTTATAAGACATATTTTAATAAAATTGTATATTAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld HdA                           THdA030g06.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGAAGCTTCTACAGGATCTGAAAGTGAGGAAGAAAGAAGTGGACGCAGAAGTGATCGAAAGCCAGAAATCAGACAGTGTAACTCCACTTCAAAGTATCCAGAGGATGGCGCTTATCACCCAATATATATTCTTCCGGAACCTGAGCAGTGTATATTTGCTACTGAGGTCTAATCATCCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAAAGACTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACANTTGAGGAGGGTTNCTGGAGTTTTCTNTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAAT
  3   1   2       bld TbA       in                    TTbA018b19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAAGTGAGGAAGAAAGAAGTGGACGCAGAAGTGATCGAAAGCCAGAAATCAGACAGTGTAACTCCACTTCAAAGTATCCAGAGGATGGCGCTTATCACCCAATATATATTCTTCCGGAACCTGAGCAGTGTATATTTGCTACTGAGGTCTAATCATCCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAAAGACTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGTTATTGTTTAAAGAGTTTTATAAAACATATATTTTAATAAAATTGTATATTAGAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Gas7      in                         XZG56344.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAGAAAAATCAAGTAGCAAACAGAAGCTTCTACAAGGATCTGAAAGTGAGGAAGAAAGAAGTGGACGCAGAAGTGATCGGTCTAATCATCCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAGAGAAGACTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGTTATTGTTTAAAGAGTTTTATAAAACATATATTTTAATAAAATTTG
  3   1   2       bld Gas7      in                         XZG64126.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGTATCCAGAGGATGGCGCTTATCACCCAATATATATTCTTCCGGAACCTGAGCAGTGTATATNTGCTACTGAGGTCTAATCATCCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAGAGAAGACTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGTTATTGTTTAAAGAGTTTTATAAAACATATATTTTAATAAAATTTGTATATTT
  3   1   2       bld Gas7      in                         XZG35218.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATATATATTCTTCCGGAACCTGAGCAGTGTATATTTGCTACTGAGGTCTAATCATCCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAGAGAAGACTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGTTATTGTTTAAAGAGTTTTATAAAACATATATTTTAATAAAATTTGTATATTT
  3   1   2       bld Gas8      in                          st86g06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCTGAGCAGTGTATATTTGCTACTGAGGTCTAATCATCCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAGAGAAGACTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGTTATGTTAAAGAGTTTATAAACA
  3   1   2       bld HdA  5g3  out                   THdA032p04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGCAGTGTATATTTGCTACTGAGGTCTAATCATCCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAGAGAAGACTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGTTATTGTTTAAAGAGTTTTATAAAACATATATTTTAATAAAATTTGTATATTAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Neu       in                    TNeu130p19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGCAGTGTATATTTGCTACTGAGGTCTAATCATCCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAGAGAAGACTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGTTATTGTTTAAAGAGTTTTATAAAACATATATTTTAATAAAATTTGTATATTTAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld HdA  5g3  out                   THdA015n13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGCAGTGTATATTTGCTACAGAGGTCTAATCATCCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTAAAGCGGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTTATATTGAGAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCCGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACAGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAAAGAGTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATTTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGATAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTTTGGAGTTTTCTTTTGGCGATTTCTTTCTTCATTCTTTTGATAAATATAACCACTAGCATTCTGTTTTTTGAAAAAGTGATTATTCCTCCCTTACACTTTGATATACACGCTGTTGATGTAAATAGGAAATTTATTTTGTATTTATAAATCAGTATATATGTTGTTGTTTAAAGAAGTTTTATAAAAAAAAATATTTTAATAAAATTTGTATATTAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Tad5      in                         XZT13530.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCAGTGTATATTTGCTACTGAGGTCTAATCATCCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAGAGAAGACTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGTTATTGTTTAAAGAGTTTTATAAAACATATATTTTAATAAAATTTGTATATTT
  3   1   2       bld Tad5      in                         XZT41012.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTTCCTCAGGTCTAATCATCCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAGAGAAGACTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGTTATTGTTTAAAGAGTTTTATAAAACATATATTTTAATAAAATTTGTATATTTAG
  3   1   2       bld Gas8      in                         st114k14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTACTGAGGTCTNATCATCCCATAAAAAGAAGACTTCACACTATCATCANTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTNATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAGAGAAGACTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTANGGATAGATCTACCAAAGTCTTNCCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTNTGATATACACGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGT
  3   1   2       bld Tad5 FL   out                        XZT27697.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCATAAAAAGAAGACTTCACACTATCATCACTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAGAGAAGACTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATTTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACCCTTAAGGATAGATCTACCAAAGTCTTCCCAGTTAATTTTAAGTGCTCCAAAGGCCTACCCATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTCCATTCCACTTTGATATACCCGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGTTATTGTTTAAAGAGTTTTATAAAACCATTTTTTTTTTTT
  3   1   2       bld Gas7      in                         XZG47048.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATCATCACTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAGAGAAGACTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGTTATTGTTTAAAGAGTTTTATAAAACATATATTTTAATAAAATTTGTA
  3   1   2       bld Gas7      in                         XZG65724.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATCACTGCAATGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTATTTAAAATAATCCTCCTTTTTATTTATGGACATAGGTATCTTATATTTATAACCACTTTTAGAAAAATCTATATCTATTGCGGCTGCTATTTATGCCAAGTATATGGGCAGATAAAATTAACTCTTTACTAGGGGTACATTTCCTTAGTATATCCCCCCGGAATACTCCTACTGCTTTGCTTTTCATTTTTCTGTACGAAGGAGAAGAGTTTTTAGTAAGAATGTTAAATGGCTAAGAGAAGACTAAGTCCCATATAAATAAAAGGCATAATTCCAAAGCAAGCTTTTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGGGAATTTTAACTAAGGGGGAAAGACCCCTTAGGGATAGTTCTCCCAAAGTCTTCCCAGTTAATTTTAAGTGCTCCAAAGGCCTCCCCATTGAGGGGGGTTCGGGAGTTTTCTTTTGGGGATTTCTTTCTCCCCTCTTTGATAAATATAACCCCTAGCATTCTGTCTTTATGAAAAAGGGATTATTCCTCCATTCCCCTTTGATATCCCCGCTGTTGAGGTAAATAGGATATTTATATTGTATTTATAAATCGGTATATATGTTATTGTTTAAAGAGTTTTATAAACCATTTTTTTTATTAAAAAAACC
  3   1   2       bld Gas8                                  st87g06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCCAAGAACTGTAAAGCTGATACTTTCCCCCTTATTNTTTAAAATAATCCTCCTNNNTNTNNATNGACATATGTATCNTATATTTATAAACACTTTTAGAAAAATCTATNTCTATTNCTGCTGCTANGTATGACAAGTATATGGGCAGNTAAAATTAACTCTTTACTATGTNTACATTTCCNTAGTATATCACACCTGAATANTCGTNCTGCTNTGCTTTTCATTCTTCTGTACGAAGGAGAAGNGTTCCTAGTAAGAATGTTAAATGGCTAAGAGAAGACTAAGTGCCATATAAATAAAAGGCATAANTCCAAAGCAAGCATCTGCGCAANCAGTAAGGGGNCTTTGTCCNTTCNGTGAATTTTCAGTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTNCCAGNTAATTGTAAGTGCTCCAANGGCNTACACATTGAGGAGGGTTCTGGANTTTTCTTTTGGTGATTTCTTTCTTCACTCTNTGATAAATATAACCNNTNGCANTCTGTCNTTATGAAAAAGTGATTATTCCTACNTTGCACTNTGATATNCATCGCTGTGGATGTAAATAGGATA
  3   1   2       bld Eye       in                         CCAX5112.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAGAGAAGACTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTTTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGGGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACCCGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGTTATTGTTTAAAGAGTTTTATAAAACATATATTTTAATAAAATTTGTATATTTA
  5   1   2       bld Neu                            TNeu077b14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCTTTTTATTTATTGACATATGTATCTTATATTTATAAACACTTTTAGAAAAATCTATATCTATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTGCTTAGTAAGAATGTTAAATGGCTAAAAGACTAAGTGCCATATAAATAAAAGGCGTAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGT
  3   1   2       bld Gas1 5g3  out                      IMAGE:6990554                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATTATATTATTGGGCTGTATTTATGCAAAGATATGGCAGATAAATTAACTTTTTTCTAGGTGTACATTTCTTGAGTATTTCACACGTGAATACTCATAATGCTTTGCTTTTCATTCTTCTGTACGAGGAGAAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAGAGAAGACTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGTTATTGTTTAAAGAGTTTTATAAAACATATATTTTAATAAAATTTGTATATTTAGATATGTGTGTGCTGAAATATAATAACACTTTTGTGAGCATATGTATTGAAAAAAGCTTTTAAAAGGGAAAGTGACTTATCAGATGCAGAAACATGGTTTTTGCACATTGCGCCATCTAGTCTCAGAGACTGATTGAACAAAGTAAAACACAACATGAATAATTCAGCAGTAACATATACCTTCC
  3   1   2       bld Neu0 5g3  out                    NISC_ng18c10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTGCTGCTGCTATTTATGACAAGTATATGGGCAGATAAAATTAACTCTTTACTATGTGTACATTTCCTTAGTATATCACACCTGAATACTCCTACTGCTTTGCTTTTCATTCTTCTGTACGAAGGAGAAGAGTTCTTAGTAAGAATGTTAAATGGCTAAGAGAAGACTAAGTGCCATATAAATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGTTATTGTTTAAAGAGTTTTATAAAACATATATTTTAATAAAATTTGTATATTTAAAAAAAAAAAAAAAAAG
  3   1   2       bld Neu       in                    TNeu055l24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGTAAATAGGATATTTATATAGTGTTTATAAATCTGTATATATGTTATTGTTTAACCCGCGGTAGGGAACATATATTTTAATAAAATTTGTTATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu063e03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGTTATTGTTTAAAGAGTTTTATAAAACATATANTTTTAATAAAATTTGATATTTAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu       in                   TNeu055l24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGTTATTGTTTAAAGAGTTTTATAAAACATATATTTTAATAAAATTTGTATATTT
  5   1   2       bld Neu       in                   TNeu063e03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATAAAAGGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGTTATTGTTTAAAGAGTTTTATAAAACATA
  5   1   2       bld Neu                            TNeu027a18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATAAAAGCATAATTCCAAAGCAAGCATCTGCGCAAACAGTAAGGGGACTTTGTCCCTTCTGTGAATTTTAACTAATGGAGAAAGAACACTTAAGGATAGATCTACCAAAGTCTTACCAGTTAATTCTAAGTGCTCCAAAGGCCTACACATTGAGGAGGGTTCTGGAGTTTTCTTTTGGTGATTTCTTTCTTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGTTATTGTTTAAAGAGTTTTATAAAACATATATTTTAATAAAATTTGTATATTT
  3  -1   2       add Gas       ?                     TGas123g15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTTTTTTTTTTTTTTTCTCTCACTCTTTGATAAATATAACCACTAGCATTCTGTCTTTATGAAAAAGTGATTATTCCTACATTACACTTTGATATACACGCTGTTGATGTAAATAGGATATTTATATTGTATTTATAAATCTGTATATATGTTATTGTTTAAAGAGTTTTATAAAACATATATTTTAATAAAATTTGTATATTTAG

In case of problems mail me! (