Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 26 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xt7.1-THdA051a22.5.5                       91 END     1           2        1                GABA(A) receptor-associated protein; GABA(A)-receptor-associated protein [Homosapiens]

 This cluster: approximate FL confidence score = 98%

 1012074864 Xt7.1-CABD6413.3 - 42 ESTs
                                                                       ........-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABD6413.3                             GCAGAGAGAGGGGAGAGTGAGCGGAACGGACCTGGACTGGCTGCTAAGGCGCAACAGTGGCGGAAAGCCAGGACATAAGGAACATACTGGATATTAGAGTTTGACCCTTGCTTGTGTGAGAGTGGTAGAACAGACGCAATCTGTCCGGCACTGTAGGGGCTTTGGGGGCGCAGCAGTGCGGAGCAGCGTGCAGTTTTGCGGGTGTCCTGGACTGGGCAGTTCCGCAAGGACCGGGGAGCACCGAGCGGGATTGACAGCGGCTTGTTCTTCCAGCGGGACTGAGCTCCAGCCCCTCACTGCTGGGGAACATGGAGCTGCCCGCCGTCGGAGAGCATGTGTTCGCGGTAGAAAGCATCGAGAAGAAGCGGATCCGCAAGGGCCGAGTGGAATACCTTGTCAAGTGGAGAGGATGGTCTTCCAAATATAACACCTGGGAGCCAGAAGAGAATATTTTGGATCCAAGGCTACTGGTTGCCTTTCAGAACAGGGAAAGACAAGAGCAGATCATGGGATATAGGAAACGTGGCCCCAAACCAAAGCATCATATTGTTTCTATACCGTCCTTTGCTCGCCGCTCCAATGTTTTGAATGGACGCAATGATTCGCCTGGTGAAAACCGAACCAAGTTGGACCTAGGGCCTATCCCCAAGAGCCAGCCCCATCAATATCAGCTAAACAGTAAAAAACATCACCAGTACCAGCCCAGTGGCAAGGACCACAATGAAAAGCATCATTCGAATACCAAGAAGAAATACTATTATCAGCTCAATAGCAAAAAACATCATCACTACCAACCTGATCCTAAGATGTATGAACAGTATGCCTTGGGAAAAGAGTCTCAAATCAGTACTGATCCCAGTAACAGACACAGAGAGTCCTGGGCACACACAAAGGCTGCAGATGTAGGGACTCAAATGAAGAATGGTACAGATCCAGTACTAAGTGGGCTGGAAAGAAATGGCCTCTCCAATGGAGTCTCTAGTAGCCCTTCAAAGGAACTGCCAAGCAATGGTATTGGAGGGAAGATGAAAATTGTGAAAAATAAAAATAAGAATGGGAGAATTGTGATAGTTATGAGCAAATATATGGAAAATGGGATGCAATCTGTAAAAATAAAGTCTTCAGAGGAGGACTGTGAAATGGGGGATCCGAGAAGAAGGTTGGAGTCCCCAAACTCCTTCAATGGGGACAAAACATGCAAAGCACAGGAAGAAAAAACCGAGCATTGGAAGAAGCGAGTGGAATCCAGGGTAAAGATAAATGAAAGTAATGGAAGTGTGGATAGAGGGTCAGTACAGCTTTCAGGCCTCAGGAGGACTTATTCTACTGCCAGTGAATCTATACATGATCAACCATTGCAGCTCACCTCGAAGAGTAACCATATTCCTTTGTCAAACAGGACCAGCTCTCCTATTTATGCAGGGGAGCCCTACAAAGATACAGTTTATACTAATCCAAGAAAACGTTGTCTGTCTGAAGCAAATGGGGACAGGGAGCTTTGTAAGAAGGCTCTTGCATCTCGGAGTGTAAGTGCTCCCAGCACACTGGAATGCAAGGCAGGCCTGACCCCTATTAATGTACCTGCACAGGAACCAGATATTATTCTCTTGGACTCCGACTTGGATGAACCCATAGACCTGCGCTGTGTGAAGTCTCGGTGTGACAGTGACCAAGAGGTGGAAAAACCTGAGGTCCAAGTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCATGTCCCGCTACAAATCCTCCATGTGTAAAATATTGTATTGTGTAATTATAATACAGGGTTATAAAAAGGACATTG
                                                  Xt7.1-CHK-1008226590                                   AGAGGGGAGAGTGAGCGGAACGGACCTGGACTGGCTGCTAAGGCGCAACAGTGGCGGAAAGCCAGGACATAAGGAACATACTGGATATTAGAGTTTGACCCTTGCTTGTGTGAGAGTGGTAGAACAGACGCAATCTGTCCGGCACTGTAGGGGCTTTGGGGGCGCAGCAGTGCGGAGCAGCGTGCAGTTTTGCGGGTGTCCTGGACTGGGCAGTTCCGCAAGGACCGGGGAGCACCGAGCGGGATTGACAGCGGCTTGTTCTTCCAGCGGGACTGAGCTCCAGCCCCTCACTGCTGGGGAACATGGAGCTGCCCGCCGTCGGAGAGCATGTGTTCGCGGTAGAAAGCATCGAGAAGAAGCGGATCCGCAAGGGCCGAGTGGAATACCTTGTCAAGTGGAGAGGATGGTCTTCCAAATATAACACCTGGGAGCCAGAAGAGAATATTTTGGATCCAAGGCTACTGGTTGCCTTTCAGAACAGGGAAAGACAAGAGCAGATCATGGGATATAGGAAACGTGGCCCCAAACCAAAGCATCATATTGTTTCTATACCGTCCTTTGCTCGCCGCTCCAATGTTTTGAATGGACGCAATGATTCGCCTGGTGAAAACCGAACCAAGTTGGACCTAGGGCCTATCCCCAAGAGCCAGCCCCATCAATATCAGCTAAACAGTAAAAAACATCACCAGTACCAGCCCAGTGGCAAGGACCACAATGAAAAGCATCATTCGAATACCAAGAAGAAATACTATTATCAGCTCAATAGCAAAAAACATCATCACTACCAACCTGATCCTAAGATGTATGAACAGTATGCCTTGGGAAAAGAGTCTCAAATCAGTACTGATCCCAGTAACAGACACAGAGAGTCCTGGGCACACACAAAGGCTGCAGATGTAGGGACTCAAATGAAGAATGGTACAGATCCAGTACTAAGTGGGCTGGAAAGAAATGGCCTCTCCAATGGAGTCTCTAGTAGCCCTTCAAAGGAACTGCCAAGCAATGGTATTGGAGGGAAGATGAAAATTGTGAAAAATAAAAATAAGAATGGGAGAATTGTGATAGTTATGAGCAAATATATGGAAAATGGGATGCAATCTGTAAAAATAAAGTCTTCAGAGGAGGACTGTGAAATGGGGGATCCGAGAAGAAGGTTGGAGTCCCCAAACTCCTTCAATGGGGACAAAACATGCAAAGCACAGGAAGAAAAAACCGAGCATTGGAAGAAGCGAGTGGAATCCAGGGTAAAGATAAATGAAAGTAATGGAAGTGTGGATAGAGGGTCAGTACAGCTTTCAGGCCTCAGGAGGACTTATTCTACTGCCAGTGAATCTATACATGATCAACCATTGCAGCTCACCTCGAAGAGTAACCATATTCCTTTGTCAAACAGGACCAGCTCTCCTATTTATGCAGGGGAGCCCTACAAAGATACAGTTTATACTAATCCAAGAAAACGTTGTCTGTCTGAAGCAAATGGGGACAGGGAGCTTTGTAAGAAGGCTCTTGCATCTCGGAGTGTAAGTGCTCCCAGCACACTGGAATGCAAGGCAGGCCTGACCCCTATTAATGTACCTGCACAGGAACCAGATATTATTCTCTTGGACTCCGACTTGGATGAACCCATAGACCTGCGCTGTGTGAAGTCTCGGTGTGACAGTGACCAAGAGGTGGAAAAACCTGAGGTCCAAGTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCATGTCCCGCTACAAATCCTCCATGTGTAAAATATTGTATTGTGTAATTATAATACAGGGTTATAAAAAGGACATTGCTCCAA
                                                      consensus depths                                  2     3     5     5     5     5     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9    10     9    10     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    10    11    11    11    11    11    11    12    12    12    12    12    13    13    13    13    13    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    10    13    11    13    11    13    11    13    11    13    11    13    11    12     9    12     7    10     7    10     8    11     8    11     8    10     8    10     8     8     7     7     6     6     6     6     7     7     8     8     8     8     9     9     9     9     9     9     9     9     8     8     7     7     7     7     7     7     7     7     8     8     8     8     8     8     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     7     7     8     8     8     8    16    16    16    16    16    16    16    16    17    17    16    18    16    18    18    20    19    21    19    22    19    22    20    22    20    22    20    22    20    22    21    23    21    23    21    23    20    23    20    23    20    23    20    23    20    23    21    23    20    22    19    23    19    22    21    22    21    22    21    22    21    22    21    22    19    22    21    22    21    22    21    22    21    22    21    22    21    22    21    22    20    22    21    22    21    22    21    21    21    21    21    21    21    21    21    21    20    21    21    21    20    21    20    21    20    21    18    21    18    21    18    21    18    21    18    21    18    21    18    21    18    21    17    21    17    21    17    21    16    21    16    21    16    20    14    18    14    18    10    15     7    11
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------C-
                                               BLH ATG     308    1418                             
                                               BLH MIN     308     153                             
                                               BLH MPR     233     153                             
                                               BLH OVR     308    1050                             
                                               CDS MIN     308     153                             
                                               ORF LNG     308     127                             
                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ---- 3e-010     XP_001180493.1 PREDICTED: similar to Chromobox homolog 1 (HP1 beta homolog Drosophila ) [Strongylocentrotus purpuratus] =============================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Ce ==== 7e-011     NP_498862.1 C.Elegans Chromodomain protein (33.8 kD) (cec-1) [Caenorhabditis elegans] ====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dm ---- 7e-016     NP_524199.1 Polycomb CG32443-PA [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dr ==== 7e-105     NP_991312.1 chromobox homolog 4 (Pc class homolog, Drosophila); polycomb 2 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 2e-134     NP_003646.2 chromobox homolog 4 [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Mm ==== 5e-138     NP_031651.1 chromobox homolog 4 (Drosophila Pc class) [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Gg ==== 8e-149     NP_989973.1 chromobox protein (CHCB3) [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 0          AAC59728.1 XPolycomb [Xenopus laevis]  ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === ?? ==== 0          NP_001080949.1 chromobox homolog 4 (Polycomb) [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 0          AAI35730.1 Unknown (protein for MGC:121719) [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABD6413.3                                              TGA------------------------TAA------------------------------------------------------TGA------------TGA------TAG---------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG---------ATG---------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------TAA------------------------ATG------------------------------------TAG---------------------------------TAATAA---ATG------------------ATG---------------------------TGA------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------ATG---------------------------TAG------TAA---------TAG------------------TAAATG------------------------------------------------------ATG------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  0   1   1           Egg  FLt3                   TEgg076c12.FL-Sanger                 CCCGGGGAGAATGCAGAGAGAGGGGAGAGTGAGCGGAACGGACCTGGACTGGCTGCTAAGGCGCAACAGTGGCGGAAAGCCAGGACATAAGGAACATACTGGATATTAGAGTTTGACCCTTGCTTGTGTGAGAGTGGTAGAACAGACGCAATCTGTCCGGCACTGTAGGGGCTTTGGGGGCGCAGCAGTGCGGAGCAGCGTGCAGTTTTGCGGGTGTCCTGGACTGGGCAGTTCCGCAAGGACCGGGGAGCACCGAGCGGGATTGACAGCGGCTTGTTCTTCCAGCGGGACTGAGCTCCAGCCCCTCACTGCTGGGGAACATGGAGCTGCCCGCCGTCGGAGAGCATGTGTTCGCGGTAGAAAGCATCGAGAAGAAGCGGATCCGCAAGGGCCGAGTGGAATACCTTGTCAAGTGGAGAGGATGGTCTTCCAAATATAACACCTGGGAGCCAGAAGAGAATATTTTGGATCCAAGGCTACTGGTTGCCTTTCAGAACAGGGAAAGACAAGAGCAGATCATGGGATATAGGAAACGTGGCCCCAAACCAAAGCATCATATTGTTTCTATACCGTCCTTTGCTCGCCGCTCCAATGTTTTGAATGGACGCAATGATTCGCCTGGTGAAAACCGAACCAAGTTGGACCTAGGGCCTATCCCCAAGAGCCAGCCCCATCAATATCAGCTAAACAGTAAAAAACATCACCAGTACCAGCCCAGTGGCAAGGACCACAATGAAAAGCATCATTCGAATACCAAGAAGAAATACTATTATCAGCTCAATAGCAAAAAACATCATCACTACCAACCTGATCCTAAGATGTATGAACAGTATGCCTTGGGAAAAGAGTCTCAAATCAGTACTGATCCCAGTAACAGACACAGAGAGTCCTGGGCACACACAAAGGCTGCAGATGTAGGGACTCAAATGAAGAATGGTACAGATCCAGTACTAAGTGGGCTGGAAAGAAATGGCCTCTCCAATGGAGTCTCTAGTAGCCCTTCAAAGGAACTGCCAAGCAATGGTATTGGAGGGAAGATGAAAATTGTGAAAAAAAAAAAAAAAAAA
  0   1   1           Tad5 FL                          XZT56370.FL-MGC                             GCAGAGAGAGGGGAGAGTGAGCGGAACGGACCTGGACTGGCTGCTAAGGCGCAACAGTGGCGGAAAGCCAGGACATAAGGAACATACTGGATATTAGAGTTTGACCCTTGCTTGTGTGAGAGTGGTAGAACAGACGCAATCTGTCCGGCACTGTAGGGGCTTTGGGGGCGCAGCAGTGCGGAGCAGCGTGCAGTTTTGCGGGTGTCCTGGACTGGGCAGTTCCGCAAGGACCGGGGAGCACCGAGCGGGATTGACAGCGGCTTGTTCTTCCAGCGGGACTGAGCTCCAGCCCCTCACTGCTGGGGAACATGGAGCTGCCCGCCGTCGGAGAGCATGTGTTCGCGGTAGAAAGCATCGAGAAGAAGCGGATCCGCAAGGGCCGAGTGGAATACCTTGTCAAGTGGAGAGGATGGTCTTCCAAATATAACACCTGGGAGCCAGAAGAGAATATTTTGGATCCAAGGCTACTGGTTGCCTTTCAGAACAGGGAAAGACAAGAGCAGATCATGGGATACAGGAAACGTGGCCCCAAACCAAAGCATCATATTGTTTCTATACCGTCCTTTGCTCGCCGCTCCAATGTTTTGAATGGACGCAATGATTCGCCTGGTGAAAACCGAACCAAGTTGGACCTAGGGCCTATCCCCAAGAGCCAGCCCCATCAATATCAGCTAAACAGTAAAAAACATCACCAGTACCAGCCCAGTGGCAAGGACCACAATGAAAAGCATCATTTGAATACCAAGAAGAAATACTATTATCAGCTCAATAGCAAAAAACATCATCACTACCAACCTGATCCTAAGATGTATGAACAGTATGCCTTGGGAAAAGAGTCTCAAATCAGTACTGATCCCAGTAACAGACACAGAGAGTCCTGGGCACACACAAAGGCTGCAGATGTAGGGACTCAAATGAAGAATGGTACAGATCCAGTACTAAGTGGGCTGGAAAGAAATGGCCTCTCCAATGGAGTCTCTAGTAGCCCTTCAAAGGAACTGCCAAGCAATGGTATTGGAGGGAAGATGAAAATTGTGAAAAATAAAAATAAGAATGGGAGAATTGTGATAGTTATGAGCAAATATATGGAAAATGGGATGCAATCTGTAAAAATAAAGTCTTCAGAGGAGGACTGTGAAATGGGGGATCCGAGAAGAAGGTTGGAGTCCCCAAACTCCTTCAATGGGGACAAAACATGCAAAGCACAGGAAGAAAAAACCGAGCATTGGAAGAAGCGAGTGGAATCCAGGGTAAAGATAAATGAAAGTAATGGAAGTGTGGATAGAGGGTCAGTACAGCTTTCAGGCCTCAGGAGGACTTATTCTACTGCCAGTGAATCTATACATGATCAACCATTGCAGCTCACCTCGAAGAGTAACCATATTCCTTTGTCAAACAGGACCAGCTCTCCTATTTATGCAGGGGAGCCCTACAAAGATACAGTTTATACTAATCCAAGAAAACGTTGTCTGTCTGAAGCAAATGGGGACAGGGAGCTTTGTAAGAAGGCTCTTGCATCTCGGAGTGTAAGTGCTCCCAGCACACTGGAATGCAAGGCAGGCCTGACCCCTATTAATGTACCTGCACAGGAACCAGATATTATTCTCTTGGACTCCGACTTGGATGAACCCATAGACCTGCGCTGTGTGAAGTCTCGGTGTGACAGTGACCAAGAGGTGGAAAAACCTGAGGTCCAAGTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCATGTCCCGCTACAAATCCTCCATGTGTAAAATATTGTATTGTGTAATTATAATACAGGGTTATAAAAAGGAAAAAAAAAAAAAAA
  5   1   1           HdA  FL                     THdA038p22.FL-Sanger                                      GGGGAGAGTGAGCGGAACGGACCTGGACTGGCTGCTAAGGCGCAACAGTGGCGGAAAGCCAGGACATAAGGAACATACTGGATATTAGAGTTTGACCCTTGCTTGTGTGAGAGTGGTAGAACAGACGCAATCTGTCCGGCACTGTAGGGGCTTTGGGGGCGCAGCAGTGCGGAGCAGCGTGCAGTTTTGCGGGTGTCCTGGACTGGGCAGTTCCGCAAGGACCGGGGAGCACCGAGCGGGATTGACAGCGGCTTGTTCTTCCAGCGGGACTGAGCTCCAGCCCCTCACTGCTGGGGAACATGGAGCTGCCCGCCGTCGGAGAGCATGTGTTCGCGGTAGAAAGCATCGAGAAGAAGCGGATCCGCAAGGGCCGAGTGGAATACCTTGTCAAGTGGAGAGGATGGTCTTCCAAATATAACACCTGGGAGCCAGAAGAGAATATTTTGGATCCAAGGCTACTGGTTGCCTTTCAGAACAGGGAAAGACAAGAGCAGATCATGGGATATAGGAAACGTGGCCCCAAACCAAAGCATCATATTGTTTCTATACCGTCCTTTGCTCGCCGCTCCAATGTTTTGAATGGACGCAATGATTCGCCTGGTGAAAACCGAACCAAGTTGGACCTAGGGCCTATCCCCAAGAGCCAGCCCCATCAATATCAGCTAAACAGTAAAAAACATCACCAGTACCAGCCCAGTGGCAAGGACCACAATGAAAAGCATCATTCGAATACCAAGAAGAAATACTATTATCAGCTCAATAGCAAAAAACATCATCACTACCAACCTGATCCTAAGATGTATGAACAGTATGCCTTGGGAAAAGAGTCTCAAATCAGTACTGATCCCAGTAACAGACACAGAGAGTCCTGGGCACACACAAAGGCTGCAGATGTAGGGACTCAAATGAAGAATGGTACAGATCCAGTACTAAGTGGGCTGGAAAGAAATGGCCTCTCCAATGGAGTCTCTAGTAGCCCTTCAAAGGAACTGCCAAGCAATGGTATTGGAGGGAAGATGAAAATTGTGAAAAATAAAAATAAGAATGGGAGAATTGTGATAGTTATGAGCAAATATATGGAAAATGGGATGCAATCTGTAAAAATAAAGTCTTCAGAGGAGGACTGTGAAATGGGGGATCCGAGAAGAAGGTTGGAGTCCCCAAACTCCTTCAATGGGGACAAAACATGCAAAGCACAGGAAGAAAAAACCGAGCATTGGAAGAAGCGAGTGGAATCCAGGGTAAAGATAAATGAAAGTAATGGAAGTGTGGATAGAGGGTCAGTACAGCTTTCAGGCCTCAGGAGGACTTATTCTACTGCCAGTGAATCTATACATGATCAACCATTGCAGCTCACCTCGAAGAGTAACCATATTCCTTTGTCAAACAGGACCAGCTCTCCTATTTATGCAGGGGAGCCCTACAAAGATACAGTTTATACTAATCCAAGAAAACGTTGTCTGTCTGAAGCAAATGGGGACAGGGAGCTTTGTAAGAAGGCTCTTGCATCTCGGAGTGTAAGTGCTCCCAGCACACTGGAATGCAAGGCAGGCCTGACCCCTATTAATGTACCTGCACAGGAACCAGATATTATTCTCTTGGACTCCGACTTGGATGAACCCATAGACCTGCGCTGTGTGAAGTCTCGGTGTGACAGTGACCAAGAGGTGGAAAAACCTGAGGTCCAAGTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCATGTCCCGCTACAAATCCTCCATGTGTAAAATATTGTATTGTGTAATTATAATACAGGGTTATAAAAAGGACATTGCTTCCAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld In63 5g                         IMAGE:8958590.5p AAGTCAATATATATTAAGATCTATTAAACATTCTTAATTCGTCCGTGAGCGGAACGGACCTGGACTGGCTGCTAAGGCGCAACAGTGGCGGAAAGCCAGGACATAAGGAACATACTGGATATTAGAGTTTGACCCTTGCTTGTGTGAGAGTGGTAGAACAGACGCAATCTGTCCGGCACTGTAGGGGCTTTGGGGGCGCAGCAGTGCGGAGCAGCGTGCAGTTTTGCGGGTGTCCTGGACTGGGCAGTTCCGCAAGGACCGGGGAGCACCGAGCGGGATTGACAGCGGCTTGTTCTTCCAGCGGGACTGAGCTCCAGCCCCTCACTGCTGGGGAACATGGAGCTGCCCGCCGTCGGAGAGCATGTGTTCGCGGTAGAAAGCATCGAGAAGAAGCGGATCCGCAAGGGCCGAGTGGAATACCTTGTCAAGTGGAGAGGATGGTCTTCCAAATATAACACCTGGGAGCCAGAAGAGAATATTTTGGATCCAAGGCTACTGGTTGCCTTTCAGAACAGGGAAAGACAAGAGCAGATCATGGGATATAGGAAACGTGGCCCCAAACCAAAGCATCATATTGTTTCTATACCGTCCTTTGCTCGCCGCTCCAATGTTTTGAATGGACGCAATGATTCGCCTGGTGAAAACCGAACCAAGTTGGACCTAGGGCCTATCCCCAAGAGCCAGCCCCATCAATATCAGCTAAACAGTAAAAAACATCACCAGTACCAGCCCAGTGGCAAGGACCACAATGAAAGCATCATTCGAATACCAAGAGAAATACTATTATCAGCTCAATAGCAAAAAACATCATCACTACCACCTGATCCTAGATGTTTGACAGTATGCTGGTAAAGAAGTCTCAATCAGTACTGATCCAGTTACAGAACCACAGAAGAGATCCTGGGCACACACACAAAGC
  5   1   2       bld Egg  FLt3 in                  TEgg076c12.p1kSP6w                 CCCGGGGAGAATGCAGAGAGAGGGGAGAGTGAGCGGAACGGACCTGGACTGGCTGCTAAGGCGCAACAGTGGCGGAAAGCCAGGACATAAGGAACATACTGGATATTAGAGTTTGACCCTTGCTTGTGTGAGAGTGGTAGAACAGACGCAATCTGTCCGGCACTGTAGGGGCTTTGGGGGCGCAGCAGTGCGGAGCAGCGTGCAGTTTTGCGGGTGTCCTGGACTGGGCAGTTCCGCAAGGACCGGGGAGCACCGAGCGGGATTGACAGCGGCTTGTTCTTCCAGCGGGACTGAGCTCCAGCCCCTCACTGCTGGGGAACATGGAGCTGCCCGCCGTCGGAGAGCATGTGTTCGCGGTAGAAAGCATCGAGAAGAAGCGGATCCGCAAGGGCCGAGTGGAATACCTTGTCAAGTGGAGAGGATGGTCTTCCAAATATAACACCTGGGAGCCAGAAGAGAATATTTTGGATCCAAGGCTACTGGTTGCCTTTCAGAACAGGGAAAGACAAGAGCAGATCATGGGATATAGGAAACGTGGCCCCAAACCAAAGCATCATATTGTTTCTATACCGTCCTTTGCTCGCCGCTCCAATGTTTTGAATGGACGCAATGATTCGCCTGGTGAAACCGAACCAAGTTGGACCTAGGGCCTATCCCCAAGAGCCAGCCCCATCAATATCAGCTANACAGTAAAAAACATCACCAGTACCAGCCCAGTGGCAAGGACCACAATGANAAGCATCATTCGAATACCAAGAAGAAATACTATTATCAGCTNCATAGCAAAAAACATCATCACTACCAACCTGA
  5   1   2       bld Tad5 FL   in                         XZT56370.5p                             GCAGAGAGAGGGGAGAGTGAGCGGAACGGACCTGGACTGGCTGCTAAGGCGCAACAGTGGCGGAAAGCCAGGACATAAGGAACATACTGGATATTAGAGTTTGACCCTTGCTTGTGTGAGAGTGGTAGAACAGACGCAATCTGTCCGGCACTGTAGGGGCTTTGGGGGCGCAGCAGTGCGGAGCAGCGTGCAGTTTTGCGGGTGTCCTGGACTGGGCAGTTCCGCAAGGACCGGGGAGCACCGAGCGGGATTGACAGCGGCTTGTTCTTCCAGCGGGACTGAGCTCCAGCCCCTCACTGCTGGGGAACATGGAGCTGCCCGCCGTCGGAGAGCATGTGTTCGCGGTAGAAAGCATCGAGAAGAAGCGGATCCGCAAGGGCCGAGTGGAATACCTTGTCAAGTGGAGAGGATGGTCTTCCAAATATAACACCTGGGAGCCAGAAGAGAATATTTTGGATCCAAGGCTACTGGTTGCCTTTCAGAACAGGGAAAGACAAGAGCAGATCATGGGATACAGGAAACGTGGCCCCAAACCAAAGCATCATATTGTTTCTATACCGTCCTTTGCTCGCCGCTCCAATGTTTTGAATGGACGCAATGATTCGCCTGGTGAAAACCGAACCAAGTTGGACCTAGGGCCTATCCCCAAGAGCCAGCCCCATCAATATCAGCTAAACAGTAAAAAACATCACCAGTACCAGCCCAGTGGCAAGGACCACAATGAAAAGCATCATTTGAATACCAAGAAGAAATACTATTATCAGCTCAATAGCAAAAAACATCATCACTACCAACCTGATCCTAAGATGTATGAACAGTATGCCT
  5   1   2   14  bld Te4  5g3  in                         CAAN9275.5p ......................................GGGAGAGTGAGCGGAACGGACCTGGACTGGCTGCTAAGGCGCAACAGTGGCGGAAAGCCAGGACATAAGGAACATACTGGATATTAGAGTTTGACCCTTGCTTGTGTGAGAGTGGTAGAACAGACGCAATCTGTCCGGCACTGTAGGGGCTTTGGGGGCGCAGCAGTGCGGAGCAGCGTGCAGTTTTGCGGGTGTCCTGGACTGGGCAGTTCCGCAAGGACCGGGGAGCACCGAGCGGGATTGACAGCGGCTTGTTCTTCCAGCGGGACTGAGCTCCAGCCCCTCACTGCTGGGGAACATGGAGCTGCCCGCCGTCGGAGAGCATGTGTTCGCGGTAGAAAGCATCGAGAAGAAGCGGATCCGCAAGGGCCGAGTGGAATACCTTGTCAAGTGGAGAGGATGGTCTTCCAAATATAACACCTGGGAGCCAGAAGAGAATATTTTGGATCCAAGGCTACTGGTTGCCTTTCAGAACAGGGAAAGACAAGAGCAGATCATGGGATACAGGAAACGTGGCCCCAAACCAAAGCATCATATTGTTTCTATACCGTCCTTTGCTCGCCGCTCCAATGTTTTGAATGGACGCAATGATTCGCCTGGTGAAAACCGAACCAAGTTGGACCTAGGGCCTATCCCCAAGAGCCAGCCCCATCAATATCAGCTAAACAGTAAAAAACATCACCAGTACCAGCCCAGTGGCAAGGACCACAATGAAAAGCATCATTTGAATACCAAGAAGAAATACTATTATCAGCTCAATAGCAAAAAACATCATCACTACCAACCTGATCCTAAGATGTATGAACAGTATGCC
  5   1   2       bld HdA  FL   in                  THdA038p22.p1kaSP6                                        GGAGAGTGAGCGGAACGGACCTGGACTGGCTGCTAAGGCGCAACAGTGGCGGAAAGCCAGGACATAAGGAACATACTGGATATTAGAGTTTGACCCTTGCTTGTGTGAGAGTGGTAGAACAGACGCAATCTGTCCGGCACTGTAGGGGCTTTGGGGGCGCAGCAGTGCGGAGCAGCGTGCAGTTTTGCGGGTGTCCTGGACTGGGCAGTTCCGCAAGGACCGGGGAGCACCGAGCGGGATTGACAGCGGCTTGTTCTTCCAGCGGGACTGAGCTCCAGCCCCTCACTGCTGGGGAACATGGAGCTGCCCGCCGTCGGAGAGCATGTGTTCGCGGTAGAAAGCATCGAGAAGAAGCGGATCCGCAAGGGCCGAGTGGAATACCTTGTCAAGTGGAGAGGATGGTCTTCCAAATATAACACCTGGGAGCCAGAAGAGAATATTTTGGATCCAAGGCTACTGGTTGCCTTTCAGAACAGGGAAAGACAAGAGCAGATCATGGGATATAGGAAACGTGGCCCCAAACCAAAGCATCATATTGTTTCTATACCGTCCTTTGCTCGCCGCTCCAATGTTTTGAATGGACGCAATGATTCGCCTGGTGAAAACCGAACCAAGTTGGACCTAGGGCCTATCCCCAAGAGCCAGCCCCATCAATATCAGCTAAACAGTAAAAAACATCACCAGTACCAGCCCAGTGGCAAGGACCACAATGANAAGCATCATTCGAATACCAAGAAGAAATACTATTATCAGCTCAATAGCAAAAAACATCATCACTACCAACCTGATTCCTAAGATGTATGAACAGTATGCCTTGGGAAAAAGAGTCTCANATCAGTACTGATCCCAGTAACAGACA
  3  -1   2       bld Int1      in                        CAAP10384.3p                                                       CGGACCTGGACTGGCTGCTAAGGCGCAACAGTGGCGGAAAGCCAGGACATAAGGAACATACTGGATATTAGAGTTTGACCCTTGCTTGTGTGAGAGTGGTAGAACAGACGCAATCTGTCCGGCACTGTAGGGGCTTTGGGGGCGCAGCAGTGCGGAGCAGCGTGCAGTTTTGCGGGTGTCCTGGACTGGGCAGTTCCGCAAGGACCGGGGAGCACCGAGCGGGATTGACAGCGGCTTGTTCTTCCAGCGGGACTGAGCTCCAGCCCCTCACTGCTGGGGAACATGGAGCTGCCCGCCGTCGGAGAGCATGTGTTCGCGGTAGAAAGCATCGAGAAGAAGCGGATCCGCAAGGGCCGAGTGGAATACCTTGTCAAGTGGAGAGGATGGTCTTCCAAATATAACACCTGGGAGCCAGAAGAGAATATTTTGGATCCAAGGCTACTGGTTGCCTTTCAGAACAGGGAAAGACAAGAGCAGATCATGGGATATAGGAAACGTGGCCCCAAACCAAAGCATCATATTGTTTCTATACCGTCCTTTGCTCGCCGCTCCAATGTTTTGAATGGACGCAATGATTCGCCTGGTGAAAACCGAACCAAGTTGGACCTAGGGCCTATCCCCAAGAGCCAGCCCCATCAATATCAGCTAAACAGTAAAAAACATCACCAGTACCAGCCCAGTGGCAAGGACCACAATGAANAGCATCATTCGAATACCAAGAAGAAATACTATTATCAGCTCAATAGCAAAAAACATCATCACTACCAACCTGATCCTAAGATGTATGAACAGTATGCCTTGGGAAAAGAGTCTCANATCAGTACTGATCCCAGTAACAGACACAGAGAGTCCTGGGCACACACAAAGGCTGCAGATGTAGGGACTCAAATGA
  3  -1   2       bld Lun1      in                          CABD558.3p                                                             CTGGACTGGCTGCTAGGCGCAACAGTGGCGGAAAGCCAGGACATAAGGAACATACTGGATATTAGAGTTTGACCCTTGCTTGTGTGAGAGTGGTAGAACAGACGCAATCTGTCCGGCACTGTAGGGGCTTTGGGGGCGCAGCAGTGCGGAGCAGCGTGCAGTTTTGCGGGTGTCCTGGACTGGGCAGTTCCGCAAGGACCGGGGAGCACCGAGCGGGATTGACAGCGGCTTGTTCTTCCAGCGGGACTGAGCTCCAGCCCCTCACTGCTGGGGAACATGGAGCTGCCCGCCGTCGGAGAGCATGTGTTCGCGGTAGAAAGCATCGAGAAGAAGCGGATCCGCAAGGGCCGAGTGGAATACCTTGTCAAGTGGAGAGGATGGTCTTCCAAATATAACACCTGGGAGCCAGAAGAGAATATTTTGGATCCAAGGCTACTGGTTGCCTTTCAGAACAGGGAAAGACAAGAGCAGATCATGGGATATAGGAAACGTGGCCCCAAACCAAAGCATCATATTGTTTCTATACCGTCCTTTGCTCGCCGCTCCAATGTTTTGAATGGACGCAATGATTCGCCTGGTGAAAACCGAACCAAGTTGGACCTAGGGCCTATCCCCAAGAGCCAGCCCCATCAATATCAGCTAAACAGTAAAAAACATCACCAGTACCAGCCCAGTGGCAAGGACCACAATGAAAAGCATCATTCGAATACCAAGAAGAAATACTATTATCAGCTCAATAGCAAAAAACATCATCACTACCAACCTGATCCTAAGATGTATGAACAGTATGCCTTGGGAAAAGAGTCTCAAATCAGTACTGATCCCAGTAACAGACACAGAGAGTCCTGGGCACACACAAAGGCTGCAGATGTAGGGAC
  5   1   2       bld Hrt1 5x3  out                       CAAQ12940.5p                                                                                                                                                                     CAATCTGTCCGGCACTGTAGGGGCTTTGGGGGCGCAGCAGTGCGGAGCAGCGTGCAGTTTTGCGGGTGTCCTGGACTGGGCAGTTCCGCAAGGACCGGGGAGCACCGAGCGGGATTGACAGCGGCTTGTTCTTCCAGCGGGACTGAGCTCCAGCCCCTCACTGCTGGGGAACATGGAGCTGCCCGCCGTCGGAGAGCATGTGTTCGCGGTAGAAAGCATCGAGAAGAAGCGGATCCGCAAGGGCCGAGTGGAATACCTTGTCAAGTGGAGAGGATGGTCTTCCAAATATAACACCTGGGAGCCAGAAGAGAATATTTTGGATCCAAGGCTACTGGTTGCCTTTCAGAACAGGGAAAGACAAGAGCAGATCATGGGATATAGGAAACGTGGCCCCAAACCAAAGCATCATATTGTTTCTATACCGTCCTTTGCTCGCCGCTCCAATGTTTTGAATGGACGCAATGATTCGCCTGGTGAAAACCGAACCAAGTTGGACCTAGGGCCTATCCCCAAGAGCCAGCCCCATCAATATCAGCTAAACAGTAAAAAACATCACCAGTACCAGCCCAGTGGCAAGGACCACAATGAAAAGCATCATTCGAATACCAAGAAGAAATACTATTATCAGCTCAATAGCAAAAAACATCATCACTACCAACCTGATCCTAAGATGTATGAACAGTATGCCTTGGGAAAAGAGTCTCAAATCAGTACTGATCCCAGTAACAGACACAGAGAGTCCTGGGCACACACAAAGGCTGCAGATGTAGGGACTCAAATGAAGAATGGTACAGATCCAGTACTAAGTGGGCTGGAAAGAAATGGCCTCTCCAATGGAGTCTCTAGTAGCCCTTCAAAGGAACTGCCAAGCAATGGTATTGAAGGG
  5   1   2       bld HdA  5g3  in                   THdA052n03.p1kSP6                                                                                                                                                                                                                                                                                    GGATTGACAGCGGCTTGTTCTTCCAGCGGGACTGAGCTCCAGCCCCTCACTGCTGGGGAACATGGAGCTGCCCGCCGTCGGAGAGCATGTGTTCGCGGTAGAAAGCATCGAGAAGAAGCGGATCCGCAAGGGCCGAGTGGAATACCTTGTCAAGTGGAGAGGATGGTCTTCCAAATATAACACCTGGGAGCCAGAAGAGAATATTTTGGATCCAAGGCTACTGGTTGCCTTTCAGAACAGGGAAAGACAAGAGCAGATCATGGGATACAGGAAACGTGGCCCCAAACCAAAGCATCATATTGTTTCTATACCGTCCTTTGCTCGCCGCTCCAATGTTTTGAATGGACGCAATGATTCGCCTGGTGAAAACCGAACCAAGTTGGACCTAGGGCCTATCCCCAAGAGCCAGCCCCATCAATATCAGCTAAACAGTAAAAAACATCACCAGTACCAGCCCAGTGGCAAGGACCACAATGAAAAGCATCATTCGAATACCAAGAAGAAATACTATTATCAGCTCAATAGCAAAAAACATCATCACTACCAACCTGATTCCTAAGATGTATGAACAGTATGCCTTGGGGAAAAGAGTCTCANATCAGTACTGATCCCAGTACAGACACAGAGAGTCCTGGGCACACACAAAGCTG
  5   1   2   10  bld Ovi1 5g3  in                          CABI692.5p ................................................................................................................................................................................................................................................................................................................CCATCGATTCGCAGCCCCTCACTGCTGGGGAAATGGAGCTGCCCGCCGTCGGAGAGCATGTGTTCGCGGTAGAAAGCATCGAGAAGAAGCGGATCCGCAAGGGCCGAGTGGAATACCTTGTCAAGTGGAGAGGATGGTCTTCCAAATATAACACCTGGGAGCCAGAAGAGAATATTTTGGATCCAAGGCTACTGGTTGCCTTTCAGAACAGGGAAAGACAAGAGCAGATCATGGGATATAGGAAACGTGGCCCCAAACCAAAGCATCATATTGTTTCTATACCGTCCTTTGCTCGCCGCTCCAATGTTTTGAATGGACGCAATGATTCGCCTGGTGAAAACCGAACCAAGTTGGACCTAGGGCCTATCCCCAAGAGCCAGCCCCATCAATATCAGCTAAACAGTAAAAAACATCACCAGTACCAGCCCAGTGGCAAGGACCACAATGAAAAGCATCATTCGAATACCAAGAAGAAATACTATTATCAGCTCAATAGCAAAAAACATCATCACTACCAACCTGATCCTAAGATGTATGAACAGTATGCCTTGGGAAAAGAGTCTCAAATCAGTACTGATCCCAGTAACAGACACAGAGAGTCCTGGGCACACACAAAGGCTGCAGATGTAGGGACTCAAATGAAGAATGGTACAGATCCAGTACTAAGTGGGCTGGAAAGAAATGGCCTCTCCAATGGAGTCTCTAGTAGCCCTTCAAAGGAACTGCCAAGCAATGGTATTGGAGGGAAGATGAAAATTGTGAAAAATAAAAATAAGAATGGGAGAATTGTGATAGTTATGAGCAAATATATGGAAAATGGGATGCAATCTGTAAAAATAAAGTCTTC
  3   1   2       bld Egg  FLt3 in                    TEgg076c12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAACAGGAAAGACAGAGCAGATCATGGATATAGAAACGTGGCCCCAAACCAAAGCATCATATTGTTTCTATACCGTCCTTTGCTCGCCGCTCCAATGTTTTGAATGGACGCAATGATTCGCCTGGTGAAAACCGAACCAAGTTGGACCTAGGGCCTATCCCCAAGAGCCAGCCCCATCAATATCAGCTAAACAGTAAAAAACATCACCAGTACCAGCCCAGTGGCAAGGACCACAATGAAAAGCATCATTCGAATACCAAGAAGAAATACTATTATCAGCTCAATAGCAAAAAACATCATCACTACCAACCTGATCCTAAGATGTATGAACAGTATGCCTTGGGAAAAGAGTCTCAAATCAGTACTGATCCCAGTAACAGACACAGAGAGTCCTGGGCACACACAAAGGCTGCAGATGTAGGGACTCAAATGAAGAATGGTACAGATCCAGTACTAAGTGGGCTGGAAAGAAATGGCCTCTCCAATGGAGTCTCTAGTAGCCCTTCAAAGGAACTGCCAAGCAATGGTATTGGAGGGAAGATGAAAATTTGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Lun1      in                         CABD6413.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGAATTCGGCACGAGGCTATACCGTCCTTTGCTCGCCGCTCCAATGTTTTGAATGGACGCAATGATTCGCCTGGTGAAAACCGAACCAAGTTGGACCTAGGGCCTATCCCCAAGAGCCAGCCCCATCAATATCAGCTAAACAGTAAAAAACATCACCAGTACCAGCCCAGTGGCAAGGACCACAATGAAAAGCATCATTCGAATACCAAGAAGAAATACTATTATCAGCTCAATAGCAAAAAACATCATCACTACCAACCTGATCCTAAGATGTATGAACAGTATGCCTTGGGAAAAGAGTCTCAAATCAGTACTGATCCCAGTAACAGACACAGAGAGTCCTGGGCACACACAAAGGCTGCAGATGTAGGGACTCAAATGAAGAATGGTACAGATCCAGTACTAAGTGGGCTGGAAAGAAATGGCCTCTCCAATGGAGTCTCTAGTAGCCCTTCAAAGGAACTGCCAAGCAATGGTATTGGAGGGAAGATGAAAATTGTGAAAAATAAAAATAAGAATGGGAGAATTGTGATAGTTATGAGCAAATATATGGAAAATGGGATGCAATCTGTAAAAATAAAGTCTTCAGAGGAGGACTGTGAAATGGGGGATCCGAGAAGAAGGTTGGAGTCCCCAAACTCCTTCAATGGGGACAAAACATGCAAAGCACAGGAAGAAAAAACCGAGCATTGGAAGAAGCGAGTGGAATCCAGGGTAAAGATAAATGAAAGTAATGGAAGTGTGGATAGAGGGTCAGTACAGCTTTCAGGCCTCAGGAGGACTTATTCTACTGCCAGTGAATCTATACATGATCAACCATTGCAGCTCACCCTCGAGAGTAACCATATTCCTTTGTCAAACAGGACCAGCTCTCCTATTTATGCA
  5   1   2       bld Ova1      in                        CABE10405.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCTCCAATGTTTTGAATGGACGCAATGATTCGCCTGGTGAAAACCGAACCAAGTTGGACCTAGGGCCTATCCCCAAGAGCCAGCCCCATCAATATCAGCTAAACAGTAAAAAACATCACCAGTACCAGCCCAGTGGCAAGGACCACAATGAAAAGCATCATTCGAATACCAAGAAGAAATACTATTATCAGCTCAATAGCAAAAAACATCATCACTACCAACCTGATCCTAAGATGTATGAACAGTATGCCTTGGGAAAAGAGTCTCAAATCAGTACTGATCCCAGTAACAGACACAGAGAGTCCTGGGCACACACAAAGGCTGCAGATGTAGGGACTCAAATGAAGAATGGTACAGATCCAGTACTAAGTGGGCTGGAAAGAAATGGCCTCTCCAATGGAGTCTCTAGTAGCCCTTCAAAGGAACTGCCAAGCAATGGTATTGGAGGGAAGATGAAAATTGTGAAAAATAAAAATAAGAATGGGAGAATTGTGATAGTTATGAGCAAATATATGGAAAATGGGATGCAATCTGTAAAAATAAAGTCTTCAGAGGAGGACTGTGAAATGGGGGATCCGAGAAGAAGGTTGGAGTCCCCAAACTCCTTCAATGGGGACAAAACATGCAAAGCACAGGAAGAAAAAACCGAGCATTGGAAGAAGCGAGTGGAATCCAGGGTAAAGATAAATGAAAGTAATGGAAGTGTGGATAGAGGGTCAGTACAGCTTTCAGGCCTCAGGAGGACTTATTCTACTGCCAGTGAATCTATACATGATCAACCATTGCAGCTCACCTCGAAGAGTAACCATATTCCTTTGTNCAACA
  5   1   2       bld Spl1      in                          CABK854.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCAAATCAGTACTGATCCCAGTAACAGACACAGAGAGTCCTGGGCACACACAAAGGCTGCAGATGTAGGGACTCAAATGAAGAATGGTACAGATCCAGTACTAAGTGGGCTGGAAAGAAATGGCCTCTCCAATGGAGTCTCTAGTAGCCCTTCAAAGGAACTGCCAAGCAATGGTATTGGAGGGAAGATGAAAATTGTGAAAAATAAAAATAAGAATGGGAGAATTGTGATAGTTATGAGCAAATATATGGAAAATGGGATGCAATCTGTAAAAATAAAGTCTTCAGAGGAGGACTGTGAAATGGGGGATCCGAGAAGAAGGTTGGAGTCCCCAAACTCCTTCAATGGGGACAAAACATGCAAAGCACAGGAAGAAAAAACCGAGCATTGGAAGAAGCGAGTGGAATCCAGGGTAAAGATAAATGAAAGTAATGGAAGTGTGGATAGAGGGTCAGTACAGCTTTCAGGCCTCAGGAGGACTTATTCTACTGCCAGTGAATCTATACATGATCAACCATTGCAGCTCACCTCGAAGAGTAACCATATTCCTTTGTCAAACAGGACCAGCTCTCCTATTTATGCAGGGGAGCCCTACAAAGATACAGTTTATACTAATCCAAGAAAACGTTGTCTGTCTGAAGCAAATGGGGACAGGGAGCTTTGTAAGAAGGCTCTTGCATCTCGGAGTGTAAGTGCTCCCAGCACACTGGAATGCAAGGCAGGCCTGACCCCTATTAATGTACCTGCACAGGAACCAGATATTATTCTCTTGGACTCCGACTTGGATGAACCCATAGACCTGCGCTGTGTGAAGTCTCGGTGTGACAGTGACCAAGAGGTGGAAAACCTGAGGTCCAGTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCT
  5   1   2       bld Ova1      in                        CABE13279.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCCAGTACTAAGTGGGCTGGAAAGAAATGGCCTCTCCAATGGAGTCTCTAGTAGCCCTTCAAAGGAACTGCCAAGCAATGGTATTGGAGGGAAGATGAAAATTGTGAAAAATAAAAATAAGAATGGGAGAATTGTGATAGTTATGAGCAAATATATGGAAAATGGGATGCAATCTGTAAAAATAAAGTCTTCAGAGGAGGACTGTGAAATGGGGGATCCGAGAAGAAGGTTGGAGTCCCCAAACTCCTTCAATGGGGACAAAACATGCAAAGCACAGGAAGAAAAAACCGAGCATTGGAAGAAGCGAGTGGAATCCAGGGTAAAGATAAATGAAAGTAATGGAAGTGTGGATAGAGGGTCAGTACAGCTTTCAGGCCTCAGGAGGACTTATTCTACTGCCAGTGAATCTATACATGATCAACCATTGCAGCTCACCTCGAAGAGTAACCATATTCCTTTGTCAAACAGGACCAGCTCTCCTATTTATGCAGGGGAGCCCTACAAAGATACAGTTTATACTAATCCAAGAAAACGTTGTCTGTCTGAAGCAAATGGGGACAGGGAGCTTTGTAAGAAGGCTCTTGCATCTCGGAGTGTAAGTGCTCCCAGCACACTGGAATGCAAGGCAGGCCTGACCCCTATTAATGTACCTGCACAGGAACCAGATATTATTCTCTTGGACTCCGACTTGGATGAACCCATAGACCTGCGCTGTGTGAAGTCTCGGTGTGACAGTGACCAAGAGGTGGAAAAACCTGAGGTCCAAGTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTGAATTT
  5   1   2       bld BrSp      in                     EC2BBA29BG08.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGAAAGAAATGGCCTCTCCAATGGAGTCTCTAGTAGCCCTTCAAAGGAACTGCCAAGCAATGGTATTGGAGGGAAGATGAAAATTGTGAAAAATAAAAATAAGAATGGGAGAATTGTGATAGTTATGAGCAAATATATGGAAAATGGGATGCAATCTGTAAAAATAAAGTCTTCAGAGGAGGACTGTGAAATGGGGGATCCGAGAAGAAGGTTGGAGTCCCCAAACTCCTTCAATGGGGACAAAACATGCAAAGCACAGGAAGAAAAAACCGAGCATTGGAAGAAGCGAGTGGAATCCAGGGTAAAGATAAATGAAAGTAATGGAAGTGTGGATAGAGGGTCAGTACAGCTTTCAGGCCTCAGGAGGACTTATTCTACTGCCAGTGAATCTATACATGATCAACCATTGCAGCTCACCTCGAAGAGTAACCATATTCCTTTGTCAAACAGGACCAGCTCTCCTATTTATGCAGGGGAGCCCTACAAAGATACAGTTTATACTAATCCAAGAAAACGTTGTCTGTCTGAAGCAAATGGGGACAGGGAGCTTTGTAAGAAGGCTCTTGCATCTCGGAGTGTAAGTGCTCCCAGCACACTGGAATGCAAGGCAGGCCTGACCCCTATTAATGTACCTGCACA
  5   1   2       bld TpA                            TTpA040l07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCTCTCAATGGAGTCTCTAGTAGCCCTTCAAAGGAACTGCCAAGCAATGGTATTGGAGGGAAGATGAAAATTGTGAAAAATAAAAATAAGAATGGGAGAATTGTGATAGTTATGAGCAAATATATGGAAAATGGGATGCAATCTGTAAAAATAAAGTCTTCAGAGGAGGACTGTGAAATGGGGGATCCGAGAAGAAGGTTGGAGTCCCCAAACTCCTTCAATGGGGACAAAACATGCAAAGCACAGGAAGAAAAAACCGAGCATTGGAAGAAACGAGTGGAATCCAGGGTAAAGATAAATGAAAGTAATGGAAGTGTGGATAGAGGGTCAGTACAGCTTTCAGGCCTCAGGAGGACTTATTCTACTGCCAGTGAATCTATACATGATCAACCATTGCAGCTCACCTCGAAGAGTAACCATATTCCTTTGTCAAACAGGACCAGCTCTCCTATTTATGCAGGGGAGCCCTACAAAGATACAGTTTATACTAATCCAAGAAAACGTTGTCTGTCTGAAGCAAATGGGGACAGGGAGCTTTGTAAGAAGGCTCTTGCATCTCGGAGTGTAAGTGCTCCCAGCACACTGGAATGCAAGGCAGGCCTGACCCCTATTAATGTACCTGCACAGGAACCAGATATTATTCTCTTGGACTCCGACTTGGATGAACCCATAGACCTGCGCTGTGTGAAGTCTCGGTGTGACAGTGACCAAGAGGTGGAAAAACCTGAGGTCCAAGTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTGTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCC
  5   1   2       bld Tad5      out                        XZT57694.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCAAATATATGGAAAATGGGATGCAATCTGTAAAAATAAAGTCTTCAGAGGAGGACTGTGAAATGGGGGATCCGAGAAGAAGGTTGGAGTCCCCAAACTCCTTCAATGGGGACAAAACATGCAAAGCACAGGAAGAAAAAACCGAGCATTGGAAGAAGCGAGTGGAATCCAGGGTAAAGATAAATGAAAGTAATGGAAGTGTGGATAGAGGGTCAGTACAGCTTTCAGGCCTCAGGAGGACTTATTCTACTGCCAGTGAATCTATACATGATCAACCATTGCAGCTCACCTCGAAGAGTAACCATATTCCTTTGTCAAACAGGACCAGCTCTCCTATTTATGCAGGGGAGCCCTACAAAGATACAGTTTATACTAATCCAAGAAAACGTTGTCTGTCTGAAGCAAATGGGGACAGGGAGCTTTGTAAGAAGGCTCTTGCATCTCGGAGTGTAAGTGCTCCCAGCACACTGGAATGCAAGGCAGGCCTGACCCCTATTAATGTACCTGCACAGGAACCAGATATTATTCTCTTGGACTCCGACTTGGATGAACCCATAGACCTGCGCTGTGTGAAGTCTCGGTGTGACAGTGACCAAGAGGTGGAAAAACCTGAGGTCCAAGTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTT
  5   1   2       bld Tad0                               IMAGE:6985981                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCGGGATGTGAAATGGGGGATCCGAGAAGAAGGTTGGAGTCCCCAAACTCCTTCAATGGGGACAAAACATGCAAAGCACAGGAAGAAAAAACCGAGCATTGGAAGAAGCGAGTGGAATCCAGGGTAAAGATAAATGAAAGTAATGGAAGTGTGGATAGAGGGTCAGTACAGCTTTCAGGCCTCAGGAGGACTTATTCTACTGCCAGTGAATCTATACATGATCAACCATTGCAGCTCACCTCGAAGAGTAACCATATTCCTTTGTCAAACAGGACCAGCTCTCCTATTTATGCAGGGGAGCCCTACAAAGATACAGTTTATACTAATCCAAGAAAACGTTGTCTGTCTGAAGCAAATGGGGACAGGGAGCTTTGTAAGAAGGCTCTTGCATCTCGGAGTGTAAGTGCTCCCAGCACACTGGAATGCAAGGCAGGCCTGACCCCTATTAATGTACCTGCACAGGAACCAGATATTATTCTCTTGGACTCCGACTTGGATGAACCCATAGACCTGCGCTGTGTGAAGTCTCGGTGTGACAGTGACCAAGAGGTGGAAAAACCTGAGGTCCAAGTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAACTATATGCAGGGAAACCGTGTTTCCTTCTGACTGCATATACTAACTGACACTTCAGCAGTCGCATGATTTATCTCCTATGAATATATAAATTAAGTG
  5   1   2       bld Tad5                                 XZT30390.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGCGAGTGGAATCCAGGGTAAAGATAAATGAAAGTAATGGAAGTGTGGATAGAGGGTCAGTACAGCTTTCAGGCCTCAGGAGGACTTATTCTACTGCCAGTGAATCTATACATGATCAACCATTGCAGCTCACCTCGAAGAGTAACCATATTCCTTTGTCAAACAGGACCAGCTCTCCTATTTATGCAGGGGAGCCCTACAAAGATACAGTTTATACTAATCCAAGAAAACGTTGTCTGTCTGAAGCAAATGGGGACAGGGAGCTTTGTAAGAAGGCTCTTGCATCTCGGAGTGTAAGTGCTCCCAGCACACTGGAATGCAAGGCAGGCCTGACCCCTATTAATGTACCTGCACAGGAACCAGATATTATTCTCTTGGACTCCGACTTGGATGAACCCATAGACCTGCGCTGTGTGAAGTCTCGGTGTGACAGTGACCAAGAGGTGGAAAAACCTGAGGTCCAAGTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCNAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAAAT
  5   1   2       bld BrSp      in                     EC2BBA35AH09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGCTCTTGCATCTCGGAGTGTAAGTGCTCCCAGCACACTGGAATGCAAGGCAGGCCTGACCCCTATTAATGTACCTGCACAGGAACCAGATATTATTCTCTTGGACTCCGACTTGGATGAACCCATAGACCTGCGCTGTGTGAAGTCTCGGTGTGACAGTGACCAAGAGGTGGAAAAACCTGAGGTCCAAGTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATTATATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGG
  5  -1   2       bld Int1      in                        CAAP10384.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGATATTATTCTCTTGGACTCCGACTTGGATGAACCCATAGACCTGCGCTGTGTGAAGTCTCGGTGTGACAGTGACCAAGAGGTGGAAAAACCTGAGGTCCAAGTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTACTGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCATGTCCCGCCCTCGTGCCGATT
  3   1   2       bld Spl1      in                          CABK854.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGACTCGACTTTGGATGACCCCATAGACCTGCGCTGTGTGAAGTCTCGGTGTGACAGTGACCAGAGGGTGGAAAAACCTGAGGTCCAAGTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCATGTCCCGCTACAAATCCTCCATGTGTAAAATATTGTATTGTGTAATTATAATACAGGGTTATAAAAAGGACATTCTTCCAA
  3   1   2       bld Ova1      in                        CABE10405.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGACTTGGATGAACCCATAGACCTGCGCTGTGTGAAGTCTCGGTGTGACAGTGACCAAGAGGTGGAAAAACCTGAGGTCCAAGTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCATGTCCCGCTACAAATCCTCCATGTGTAAAATATTGTATTGTGTAATTATAATACAGGGTTAT
  3   1   2       bld HdA  FL   in                    THdA038p22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACTTGGATGAACCCATAGACCTGCGCTGTGTGAAGTCTCGGTGTGACAGTGACCAAGAGGTGGAAAAACCTGAGGTCCAAGTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCATGTCCCGCTACAAATCCTCCATGTGTAAAATATTGTATTGTGTAATTATAATACAGGGTTTAAAAAGGACATGCTTCCAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Lun1      in                         CABD6413.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACTTGGATGAACCCATAGACCTGCGCTGTGTGAAGTCTCGGTGTGACAGTGACCAAGAGGTGGAAAAACCTGAGGTCCAAGTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCATGTCCCGCTACAAATCCTCCATGTGTAAAATATTGTATTGTGTAATTATAATACAGGGTTATAAAAAGGACATTGCTCCAAAAAA
  3   1   2       bld Ova1      in                        CABE13279.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACTTGGATGAACCCATAGACCTGCGCTGTGTGAAGTCTCGGTGTGACAGTGACCAAGAGGTGGAAAAACCTGAGGTCCAAGTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCATGTCCCGCTACAAATCCTCCATGTGTAAAATATTGTATTGTGTAATTATAATACAGGGTTATAAAAAGGAAAAAAA
  3   1   2      seed Ovi1 5g3  in                          CABI692.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACTTGGATGAACCCATAGACCTGCGCTGTGTGAAGTCTCGGTGTGACAGTGACCAAGAGGTGGAAAAACCTGAGGTCCAAGTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCATGTCCCGCTACAAATCCTCCATGTGTAAAATATTGTATTGTGTAATTATAATACAGGGTTAT
  3   1   2       bld Tad5 FL   in                         XZT56370.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACTTGGATGAACCCATAGACCTGCGCTGTGTGAAGTCTCGGTGTGACAGTGACCAAGAGGTGGAAAAACCTGAGGTCCAAGTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCATGTCCCGCTACAAATCCTCCATGTGTAAAATATTGTATTGTGTAATTATAATACAGGGTTAT
  5  -1   2       bld Lun1      in                          CABD558.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACTTGGATGAACCCATAGACCTGCGCTGTGTGAAGTCTCGGTGTGACAGTGACCAAGAGGTGGAAAAACCTGAGGTCCAAGTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCATGTCCCGCTACAAATCCTCCATGTGTAAAATATTGTATTGTGTAATTATAATACAGGGTTATAAAAAGGACATTG
  3   1   2       bld HdA  5g3  in                    THdA052n03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGTGACAGTGACCAAGAGGTGGAAAAACCTGAGGTCCAAGTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTTTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTTCTGGATATATCCATGTCCCGCTACAAATCCTCCATGTGTAAAATATTGTATTGTGTAATTATAATACAGGGTTATAAAAAGGAAAAAAAAAAAAAAAAAAGC
  3   1   2       chi HdA       out                  THdA026f23.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGAAAAACCTGAGGTCCAAGTCACTCGGAAACCTCAATCAGTCTGATGTGGATGTTTGTGAGTCAGAATTTAAACCTTTCTTTGGAAAAATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAAAAAATAACGGTGCGATTCTTAAAACTATATGCAGGGAAACCGTTGTTTCCTTCTGAACTGCACATATTAAATTGAACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTACGGACATATTACATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCAGTATGCCAAAGCCCTTTAATCCATGTCTGTTTTGATTGAAAACTAGGTTAAAAGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGCGTCCCTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCCTATATACGTTTTTTTTTTCAAGTTAGTTGGGATGGCATGTTGCAGTAGCTGACAAGCAGCAATAAAATAAAAGTCCTTTGTCCTTACCATTGTACTTCTGAGTGGGCTCGTAATAATGCTGACTACAGGATACAGCTCAGCTTAGAGATACAGATGGTGAGCAAGGTTTTAGAATTAAAGTACAGTATTGCGACACATAAAACATGAAAAGCAAGTAACCTTAGACTTTAAGAACATTAGTAAAGGCACATGTTTAGACTCTCTGTTAAAAAAAAAAAAGC
  3   1   2       bld Te4  5g3  in                         CAAN9275.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTCACTCAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCATGTCCCGCTACAAATCCTCCATGTGTAAAATATTGTATTGTGTAATTATAATACAGGGTTATAAAAAGG
  5   1   2       bld Spl1                                CABK10753.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGAAACCTCAGTCAGTTGATGTGGATGTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCATGTCCCGCTACAAATCCTCCATGTGTAAAATATTGTATTGTGTAATTATAATACAGGGTTATAAAAAGGACATTGCTTCCAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA                             TTbA050j08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGTTGATGTGGATGTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTTTTAAAACTATATGCAGGGAAACCGTGTTTCCTTTTGAACTGCATATATTAAACTGACACTTTCCAGCCAGTGGGCATGATTTTTAATTTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTACCAGTGGCTGGATTTTAATAACTTATGTGCCATCCAAGGATCATTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGTTTTTCGGTGTCCTTGTTCTGTTTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCCCCTTTTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTACCCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTTTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCATGTCCCGCTACAAATCCTCCATGTGTAAAATATTGTATTGTGTAATTATAATCCAGGGTTTAAAAAGGACATTGCTTCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Tad5      in                         XZT22001.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCACGCGTCCGGTTTGTGAGTCTGAATTTAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCCGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCATGTCCCGCTACAAATCCTCCATGTGTAAAATATTGTATTGTGTAATTATAATACAGGGTTATAAAAAGG
  5   1   2       bld Tad5      in                         XZT22001.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTTGTGAGTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCATGTCCCGCTACAAATCCTCCATGTGTAAAATATTGTATTGTGTAATTATAATACAGGGTTATAAAAA
  3   1   2       bld BrSp      in                     EC2BBA29BG08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTCTGAATTTAAACCTTTCTTTGGAAATATAGTAATTACAGATGTCACAGCCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATTATATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCAGGTCCCGCTACAAATCCTCCATGGTAAAATATTGT
  3   1   2       bld Spl1      in                         CABK5805.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCATGTCCCGCTACAAATCCTCCATGTGTAAAATATTGTATTGTGTAATTATAATACAGGGTTATAAAAAGGACATTGCTTCC
  5   1   2       bld Spl1      in                         CABK5805.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCATTGCCTTACGGTCACTTTTAAGGAATATATAACGGTGTGATTCTTAAAACTATATGCAGGGAAACCGTGTTTCCTTCTGAACTGCATATACTAAACTGACACTTTCCAGCCAGTCGGCATGATTTTTAATCTTCCCTATGGATATATTATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCATGTCCCGCTACAAATCCTCCATGTGTAAAATATTGTATTGTGTAATTATAATACAGGGTTATAAAAAGGACATTGCTTCCAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp      in                     EC2BBA35AH09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCCTATGGATATATTATTATATATATATATAGAGTTGCTGGAAGGGCCTAGCAGTGGCTGGATTCTAATAACTTATGTGCCATCCAAGGATCACTATGACAAAGCACTTAAATCCATGTCTGTTTTGATTGAAAACTAGGTTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCAGGTCCCGCTACAAATCCTCCATGTGTAAAATATTGT
  5   1   2       bld Neu                            TNeu135c05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTAATTGTGTTTATTTATTTTATATTTATACCTGGAAATGATCGGCTCTTCGGTGTCCTTGTTCTGTCTGGGAGAATCGTGTTAGCTGTTCAGTGTTCCGCCTTCTTATACACGTGAAAGAGAGAGAGGACAGACTTTGTAACCTTATATACGTTTTTTTTTTTATTTTTTAAACATTTATTTATATTTTGTTTGCAAAAAAAAATGAGAGCTCTTTCTAGTATATGCTGCTATTAGAATTGTTAATGCTTCCTGTAGCTGCTTGGATGTAAAAATTAAATGGAGAATTGTTATGTGAGCAGCAGGAGGCTGTATAAGAGAGGTCTGGATATATCCATGTCCCGCTACAAATCCTCCATGTGTAAAATATTGTATTGTGTAATTATAATACAGGGTTATAAAAAGGACATTGCTTCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)