Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 21 Sep 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZT61521.5                           13 END     2           4       20                lamin A/C [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012074891 Xt7.1-CABE517.5 - 48 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                       Xt7.1-CABE517.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATTCCAGTGGTGAAGAATGTGCTGAACGAACCATTTATAGAGTCATCGGAGAAGAGGGTGAAACTGATGAAGATTTCGCAGAGGAAGAGGAATTAGAGCGTCAGTTCCGTTCCCAGTCTCACCAATCGGTGGATCCCAGCTGTTCCATCATGTAATTTAGAGCTGGGAAAGTTGAAGGAAAATCTGGTGGAGTTTTTCTAAATCTCCCTATTCTGCTGGAATATTTGGAATGTGTTTGATGTTCTAACGTTTGATCTTCTTGCTGTTCACCTGAGAACATTTTGGTGGGCATTTCTTTCCCTTGGAGCCTGCGGACTTGAGAACTGACAAAGGAAATAACGTGCATTTCATTGCAAGACTGTAGAAACCCGTACAATGTGCACATACTTACAATTAATGTTTCTGTGAAAGCTACTGGCTTGGTGCTTCCCATGTGAATGGGGCAAAGAATATTTGTTTCTAAAACACAATGTAACTTCTGAAAATGCTCCCGCCCTTCATCCTTTTCCAGATATTGAACTACAACTTTCAAAACCCCCAACTGTGTTTAGACTTTGATTGGATGTTGGGAGTTGTAGATCAAGATCTGGCAGGCTGCTGGTTGCCCATGCATTGCTGTAGCTCTCTCTGGCCTTTCGCCTTTATGCAAATTCTCTGACTAGGGCTTATGCATATTAAATACATGCTGTCTGCCACTGTCAGCAGCCATTCAGCATGTGGCCTTAATGTGTGTGCTTGCCAGATGCATAACATGGCAACCCAGCTTCAAGCTTGAACAAGTGAATATTGCTGGTATTTCTACAAGTGTAAGAGCAATGTTTTGCCTGTGATCATGTGCCATGTTTAATACAGTCTTTAATGCAAGAGGGCTAAATGAAAGCTATCTGGACCCCTAACTTGCTATAAATCCTGATCATGTAGTCACATTGCATATTCTGTGAAGGCAAGGAAAGTTTACTGTATAGCTATAGATGTGACAAAGTTCTTTCCTTTAAGAACAGCTTTATTTAAGCTATAGCATACCTTCACCTCTGACACTGTTCAGGGCAGACCGAGCGGTGGCAAATGATCACATTATCAAGGCAACAAGTTTCTGCAGTTCCCAGCCAGGTCACTCAGGTCTGCCCTTAATCAAACTAGACCTGATAATGTCCCACAGCACTTCTGCCATCAGACCAGAGTTGTGCTGTGGTGTCTCTGTCATCCAGCTGTGCAACCCTCATTGTACACTATTTGATTCCATTCTTACACCCCTTGGGGTTAATACAAAGACCCATAGGTTTGCAGCACACTAATTCACTCCTCTCAATGTAAGCTTCTATTTTTAGATACATTTTCTGTTATTAACGATTTAAAAAGGAAAAGTAAACATTTATTTTATATACTTTGTAAGCTTATAAAAAACACACAACTTAATACTTTTGTAAACTACAGAGTGTGTTCCCACAGACTGTTGTGAGTGAGCTCACTGGCAGCTATTGTTTGCCTTATAGTGTTCATGTAGCATGTGTTTGTGTTGCTGTGATCATTTCATGGTTTTATGTGCACTTAGTAAGAATTATTAGATACAAAAAGGGGCAATTCTAATGCCAGAGCCATGATTTGCATGTTGTGACTGAGCTATTAAATTGCACCCCAAAGCATTCCCTTATGGATATTGACTCTTATTGGTTCCTGAGCGTTGTAGTTTAGCAATAGCTGCAGAGCCAGTTCAAAGGTTAGTGTGAAAAAGTGGTATATTGAAGGAAAATATAGGTGGGTAAAAAGTTACCAATCTTGCGGTTTGTTATAAAAATAGGCATCCTCTTGCGATACCCTGACCTTTTGGTTTGGGTGTGGGGGTGGTACATAGTTGCTATAGTTTCAACCAGTGTTTGCAGTAGGTAAATTTTTTTTTTAGTTCTAAGCTGGAGGCTGTGCCAGTGCTAGAGTGGGAAGGGGGTTCTTATTTACTCCTTGGGGAAAATGGCTCCAATAAACAATTGCTAAGTTCAGTTTCCTTTGCCCCTAGCTGGACTGATTAAAGCTAAAGCCTGTAAGAATGATTGCCTTTTAATGGTTTTTATGGCATTTGTCTACTGTACCGATTCCCACAGCAGTCAGCCCTATGTATCTTAAAGACAGAGCATTCTAAACACCTTTACTTACTGTCCAGCTCAGCTCCTCCTATATTACTGGATTGCAGCTCTTGGGACAGTGCCTGCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATGAATAAAGAGATTTTCTATAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008225873                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTGGTGAAGAATGTGCTGAACGAACCATTTATAGAGTCATCGGAGAAGAGGGTGAAACTGATGAAGATTTCGCAGAGGAAGAGGAATTAGAGCGTCAGTTCCGTTCCCAGTCTCACCAATCGGTGGATCCCAGCTGTTCCATCATGTAATTTAGAGCTGGGAAAGTTGAAGGAAAATCTGGTGGAGTTTTTCTAAATCTCCCTATTCTGCTGGAATATTTGGAATGTGTTTGATGTTCTAACGTTTGATCTTCTTGCTGTTCACCTGAGAACATTTTGGTGGGCATTTCTTTCCCTTGGAGCCTGCGGACTTGAGAACTGACAAAGGAAATAACGTGCATTTCATTGCAAGACTGTAGAAACCCGTACAATGTGCACATACTTACAATTAATGTTTCTGTGAAAGCTACTGGCTTGGTGCTTCCCATGTGAATGGGGCAAAGAATATTTGTTTCTAAAACACAATGTAACTTCTGAAAATGCTCCCGCCCTTCATCCTTTTCCAGATATTGAACTACAACTTTCAAAACCCCCAACTGTGTTTAGACTTTGATTGGATGTTGGGAGTTGTAGATCAAGATCTGGCAGGCTGCTGGTTGCCCATGCATTGCTGTAGCTCTCTCTGGCCTTTCGCCTTTATGCAAATTCTCTGACTAGGGCTTATGCATATTAAATACATGCTGTCTGCCACTGTCAGCAGCCATTCAGCATGTGGCCTTAATGTGTGTGCTTGCCAGATGCATAACATGGCAACCCAGCTTCAAGCTTGAACAAGTGAATATTGCTGGTATTTCTACAAGTGTAAGAGCAATGTTTTGCCTGTGATCATGTGCCATGTTTAATACAGTCTTTAATGCAAGAGGGCTAAATGAAAGCTATCTGGACCCCTAACTTGCTATAAATCCTGATCATGTAGTCACATTGCATATTCTGTGAAGGCAAGGAAAGTTTACTGTATAGCTATAGATGTGACAAAGTTCTTTCCTTTAAGAACAGCTTTATTTAAGCTATAGCATACCTTCACCTCTGACACTGTTCAGGGCAGACCGAGCGGTGGCAAATGATCACATTATCAAGGCAACAAGTTTCTGCAGTTCCCAGCCAGGTCACTCAGGTCTGCCCTTAATCAAACTAGACCTGATAATGTCCCACAGCACTTCTGCCATCAGACCAGAGTTGTGCTGTGGTGTCTCTGTCATCCAGCTGTGCAACCCTCATTGTACACTATTTGATTCCATTCTTACACCCCTTGGGGTTAATACAAAGACCCATAGGTTTGCAGCACACTAATTCACTCCTCTCAATGTAAGCTTCTATTTTTAGATACATTTTCTGTTATTAACGATTTAAAAAGGAAAAGTAAACATTTATTTTATATACTTTGTAAGCTTATAAAAAACACACAACTTAATACTTTTGTAAACTACAGAGTGTGTTCCCACAGACTGTTGTGAGTGAGCTCACTGGCAGCTATTGTTTGCCTTATAGTGTTCATGTAGCATGTGTTTGTGTTGCTGTGATCATTTCATGGTTTTATGTGCACTTAGTAAGAATTATTAGATACAAAAAGGGGCAATTCTAATGCCAGAGCCATGATTTGCATGTTGTGACTGAGCTATTAAATTGCACCCCAAAGCATTCCCTTATGGATATTGACTCTTATTGGTTCCTGAGCGTTGTAGTTTAGCAATAGCTGCAGAGCCAGTTCAAAGGTTAGTGTGAAAAAGTGGTATATTGAAGGAAAATATAGGTGGGTAAAAAGTTACCAATCTTGCGGTTTGTTATAAAAATAGGCATCCTCTTGCGATACCCTGACCTTTTGGTTTGGGTGTGGGGGTGGTACATAGTTGCTATAGTTTCAACCAGTGTTTGCAGTAGGTAAATTTTTTTTTTAGTTCTAAGCTGGAGGCTGTGCCAGTGCTAGAGTGGGAAGGGGGTTCTTATTTACTCCTTGGGGAAAATGGCTCCAATAAACAATTGCTAAGTTCAGTTTCCTTTGCCCCTAGCTGGACTGATTAAAGCTAAAGCCTGTAAGAATGATTGCCTTTTAATGGTTTTTATGGCATTTGTCTACTGTACCGATTCCCACAGCAGTCAGCCCTATGTATCTTAAAGACAGAGCATTCTAAACACCTTTACTTACTGTCCAGCTCAGCTCCTCCTATATTACTGGATTGCAGCTCTTGGGACAGTGCCTGCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATGAATAAAGAGATTTTCTATAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     5     5     5     5     5     5     5     5     6     6     5     5     5     5     5     5     5     5     5     5     6     6     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9    10    10    10    11     9    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     9     9     8     8     8     8     8     8     8     8     7     8     8     9     8     9     8     9     8     9     8     9     8     9     6     9     7     9     7     9     7     9     7     8     6     8     7    11     8    13     8    13     7    12     7    12     8    12    12    16    12    16    13    17    14    18    14    18    14    18    15    19    15    21    15    21    16    22    17    23    18    23    18    23    18    23    20    25    20    25    18    26    17    26    19    26    19    26    20    27    20    27    21    27    21    27    21    27    21    27    21    27    22    28    22    28    25    28    24    28    25    28    25    28    25    28    24    27    24    27    24    27    24    27    25    28    25    28    25    28    24    28    25    27    25    27    25    27    25    27    25    27    25    27    25    27    24    27    23    26    23    26    23    26    23    25    23    25    23    25    23    25    22    24    22    24    21    24    21    24    21    23    20    22    20    22    19    21    11    12     9    10
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -C-T--------
                                                                       ...PROTEIN --- Xt ---- 2e-016     NP_001076823.1 lamin A/C [Xenopus tropicalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 1e-021     AAH78034.1 LOC397910 protein [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 1e-021     NP_001081545.1 lamin LIII [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================
                                                       Xt7.1-CABE517.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGTAA---------------------------------------------------------------------------------TGA------------TGA---------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------ATGTGAATG---------------------------------------TGA---------------------------------TGA------------------------------TAG------------------------TAG---------------------------------------------------------------------------------TAG---------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------TGA---------ATG---------------------------------------------------TAA------------------------------------------TGA---------------------TAG---TAGATGTGA---------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------TAG------------------------TAA------------------------------------------TAA------------------------TAA---------------------------------TGA---------------------------TAG------------ATG------------------------ATG---------------------------TAG---------------------ATG---------TGA---------------TGA---------------------------------------TGA---------------------------------------------------------------TGA---------------------------------TAA------------------------------------------------------TGA------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------TAA---TAA------TAA---TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------TAA------TAATAATAATAA---TAA---------------------------------------TAG------ATG------------------ATG------------TAA------------------------------------------------------------------------------------TGA------------TAG------------------------------------------------------TGA---------------------------------------------------ATG------ATG---------------------------------------------------------------------------------ATG------------------------------------------------------------TGA---------------TAA---------------------------ATGTGA---------------------------------TAA------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                   ]
  5   1   1       add Egg                            TEgg140m17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTTCCCGAGCTTCTACAAGTCAATCAAGCCGCCTTTCACGTGGGAAAAAGAGAAAGTTAGAAGAGACTGGCAGATCAGTGACCAAAAGAGCCTACAAGGTTGTTCAGGAGGCCTCCTCCACAGGGCCAGTGTCTGTAGAAGATATTGACCCAGAAGGGAACTATGTCAGGCTGCTGAACAACACAGAAGAGGATCATTCTCTGCATGGATGGGTAGTTAGGAGAAAGCATGGAAGCCTTCCAGAAATTGCATATAAACTTCCATGTCGTTTTGTTCTGAAATCCGAACAACGTGTCACTATCTGGGCTGCAGGAGCTGGTGCTGTACACAGTCCTCCCACTGATTTGGTCTGGAAGTCTCATAAGAATTGGGGAACAGGAGATATTAAAATTATTCTCCTTGATTCCAGTGGTGAAGAATGTGCTGAACGAACCATTTATAGAGTCATCGGAGAAGAGGGTGAAACTGATGAAGATTTCGCAGAGGAAGAGGAATTAGAGCGTCAGTTCCGTTCCCAGTCTCACCAATCGGTGGATCCCAGCTGTTCCATCATGTAATTTAGAGCTGGGAAAGTTGAAGGAAAATCTGGGTGGAGTTTTTCTAATCTCCCTATTCTGCTGGAATATTTGGAAATGTGTTTGATGTTCTAACGTTTGATCTTCTTGC
  5   1   2       bld Te4       ?                         CAAN11597.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCATGGAAGCCTTCCAGAAATTGCATATAAACTTCCATGTCGTTTTGTTCTGAAATCCGAACAACGTGTCACTATCTGGGCTGCAGGAGCTGGTGCTGTACACAGTCCTCCCACTGATTTGGTCTGGAAGTCTCATAAGAATTGGGGAACAGGAGATATTAAAATTATTCTCCTTGATTCCAGTGGTGAAGAATGTGCTGAACGAACCATTTATAGAGTCATCGGAGAAGAGGGTGAAACTGATGAAGATTTCGCAGAGGAAGAGGAATTAGAGCGTCAGTTCCGTTCCCAGACAAAAAGAAGAAAAAAGAAATGTTGTTCAGTTTCATAATGGCTTACTTGCATCAAAGTGTAGTAAGCTCCCGCAGTCTCACCAATCGGTGGATCCCAGCTGTTCCATCATGTAATTTAGAGCTGGGAAAGTTGAAGGAAAATCTGGTGGAGTTTTTCTAAATCTCCCTATTCTGCTGGAATATTTGGAATGTGTTTGATGTTCTAACGTTTGATCTTCTTGCTGTTCACCTGAGAACATTTTGGTGGGCATTTCTTTCCCTTGGAGCCTGCGGACTTGAGAACTGACAAAGGAAATAACGTGCATTTCATTGCAAGACTGTAGAAACCCGTACAATGTGCACATACTTACAATTAATGTTTCTGTGAAAGCTACTGGCTTGGTGCTTCCCATGTGAATGGGGCAAAGAATATTTGTTTCTAAAACACAATGTAACTTCTGAAAATGCTCCCGCCCTTCATCCTTTTCCAGATATTGAACTACAACTTTCAAAACCCCCAACTGTGTTTAGACTTTGATTGGATGTTGNGAGTTGTAGATCAAGATCTGGCAGGCTGCTGGTTGCCCATGCATTGCTGTAGCTCTCTCTGGCCTTTCGCCTTTATGCAAATTCTCTGACTAGGGCTAATGCATA
  5   1   2       bld Lun1      in                         CABD1550.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTGATTCCAGTGGTGAAGAATGTGCTGAACGAACCATTTATAGAGTCATCGGAGAAGAGGGTGAAACTGATGAAGATTTCGCAGAGGAAGAGGAATTAGAGCGTCAGTTCCGTTCCCAGTCTCACCAATCGGTGGATCCCAGCTGTTCCATCATGTAATTTAGAGCTGGGAAAGTTGAAGGAAAATCTGGTGGAGTTTTTCTAAATCTCCCTATTCTGCTGGAATATTTGGAATGTGTTTGATGTTCTAACGTTTGATCTTCTTGCTGTTCACCTGAGAACATTTTGGTGGGCATTTCTTTCCCTTGGAGCCTGCGGACTTGAGAACTGACAAAGGAAATAACGTGCATTTCATTGCAAGACTGTAGAAACCCGTACAATGTGCACATACTTACAATTAATGTTTCTGTGAAAGCTACTGGCTTGGTGCTTCCCATGTGAATGGGGCAAAGAATATTTGTTTCTAAAACACAATGTAACTTCTGAAAATGCTCCCGCCCTTCATCCTTTTCCAGATATTGAACTACAACTTTCAAAACCCCCAACTGTGTTTAGACTTTGATTGGATGTTGGGAGTTGTAGATCAAGATCTGGCAGGCTGCTGGTTGCCCATGCATTGCTGTAGCTCTCTCTGGCCTTTCGCCTTTATGCAAATTCTCTGACTAGGGCTTATGCATATTAAATACATGCTGTCTGCCACTGTCAGCAGCCATTCAGCATGTGGCCTTAATGTGTGTGCTTGCCAGATGCATAACATGGCAACCCAGCTTCAAGCTTGAACAAGTGAATATTGCTGGTATTTCTACAAGTGTAAGAGCAATGTTTTTGCTGTGATCATGTGCCATGTTTAATACAGTCTTTAATGC
  5   1   2       bld Gas7      in                         XZG58660.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTCCGTTCCCAGTCTCACCAATCGGTGGATCCCAGCTGTTCCATCATGTAATTTAGAGCTGGGAAAGTTGAAGGAAAATCTGGTGGAGTTTTTCTAAATCTCCCTATTCTGCTGGAATATTTGGAATGTGTTTGATGTTCTAACGTTTGATCTTCTTGCTGTTCACCTGAGAACATTTTGGTGGGCATTTCTTTCCCTTGGAGCCTGCGGACTTGAGAACTGACAAAGGAAATAACGTGCATTTCATTGCAAGACTGTAGAAACCCGTACAATGTGCACATACTTACAATTAATGTTTCTGTGAAAGCTACTGGCTTGGTGCTTCCCATGTGAATGGGGCAAAGAATATTTGTTTCTAAAACACAATGTAACTTCTGAAAATGCTCCCGCCCTTCATCCTTTTCCAGATATTGAACTACAACTTTCAAAACCCCCAACTGTGTTTAGACTTTGATTGGATGTTGGGAGTTGTAGATCAAGATCTGGCAGGCTGCTGGTTGCCCATGCATTGCTGTAGCTCTCTCTGGCCTTTCGCCTTTATGCAAATTCTCTGACTAGGGCTTATGCATATTAAATACATGCTGTCTGCCACTGTCAGCAGCCATTCAGCATGTGGCCTTAATGTGTGTGCTTGCCAGATGCATAACATGGCAACCCAGCTTCAAGCTTGAACAAGTGAATATTGCTGGTATTTCTACAAGTGTAAGAGCAATGTTTTGCCTGTGATCATGTGCCATGTTTAATACAGTCTTTAAATGCAGAGGGCTAAATGAAAGCTACCTGGACCCCTAACTTGCTATAAATCCTGATCATGTAGTCACATTGCATATTCTGTGAAGGCAAGGA
  5   1   2       bld Te4       in                         CAAN9319.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGCTACTGGCTTGGTGCTTCCCATGTGAATGGGGCAAAGAAGATTTGTTTCTAAAACACAATGTAACTTCTGAAAATGCTCCCGCCCTTCATCCTTTTCCAGATATTGAACTACAACTTTCAAAACCCCCAACTGTGTTTAGACTTTGATTGGATGTTGGGAGTTGTAGATCAAGATCTGGCAGGCTGCTGGTTGCCCATGCTTTGCTGTAGCTCTCTCTGGCCTTTCGCCTTTATGCAAATTCTCTGACTAGGGCTTATGCATATTAAATACATGCTGTCTGCCACTGTCAGCAGCCATTCAGCATGTGGCCTTAATGTGTGTGCTTGCCAGATGCATAACATGGCAACCCAGCTTCAAGCTTGAACAAGTGAATATTGCTGGTATTTCTACAAGTGTAAGAGCAATGTTTTGCCTGTGATCATGTGCCATGTTTAATACAGTCTTTAATGCAAGAGGGCTAAATGAAAGCTACCTGGACCCCTAACTTGCTATAAATCCTGATCATGTAGTCACATTGCATATTCTGTGAAGGCAAGGAAAGTTTACTGTATAGCTATAGATGTGACAAAGTTCTTTCCTTTAAGAACAGCTTTATTTAAGCTATAGCATACCTTCACCTCTGACACTGTTCAGGGCAGACCGAGCGGTGGCAAATGATCACATTATCAAGGCAACAAGTTTCTGCAGTTCCCAGCCAGGTCACTCAGGTCTGCCCTTAATCAAACTAGACCTGATAATGTCCCACAGCACTTCTGCCATCAGACCAGAGTTGTGCTGTGGTGTCTCTGTCATCCAGCTGTG
  5   1   2       bld Gas7      in                         XZG22603.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCCCCTTCATCCTTTTCCAGATATTGAACTACAACTTTCAAAACCCCCAACTGTGTTTAGACTTTGATTGGATGTTGGGAGTTGTAGATCAAGATCTGGCAGGCTGCTGGTTGCCCATGCATTGCTGTAGCTCTCTCTGGCCTTTCGCCTTTATGCAAATTCTCTGACTAGGGCTTATGCATATTAAATACATGCTGTCTGCCACTGTCAGCAGCCATTCAGCATGTGGCCTTAATGTGTGTGCTTGCCAGATGCATAACATGGCAACCCAGCTTCAAGCTTGAACAAGTGAATATTGCTGGTATTTCTACAAGTGTAAGAGCAATGTTTTGCCTGTGATCATGTGCCATGTTTAATACAGTCTTTAATGCAAGAGGGCTAAATGAAAGCTATCTGGACCCCTAACTTGCTATAAATCCTGATCATGTAGTCACATTGCATATTCTGTGAAGGCAAGGAAAGTTTACTGTATAGCTATAGATGTGACAAAGTTCTTTCCTTTAAGAACAGCTTTATTTAAGCTATAGCATACCTTCACCTCTGACACTGTTCAGGGCAGACCGAGCGGTGGCAAATGATCACATTATCAAGGCAACAAGTTTCTGCAGTTCCCAGCCAGGTCACTCAGGTCTGCCCTTAATCAAACTAGACCTGATAATGTCCCACAGCACTTCTGCCATCAGACCAAAGTTGTGCTGTGGGGTCTCTGTCATCCAGCTGTGCAACCC
  5   1   2       bld Egg       in                   TEgg039m09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCAGATGCATAACATGGCAACCCAGCTTCAAGCTTGAACAAGTGAATATTGCTGGTATTTCTACAAGTGTAAGAGCAATGTTTTGCCTGTGATCATGTGCCATGTTTAATACAGTCTTTAATGCAAGAGGGCTAAATGAAAGCTATCTGGACCCCTAACTTGCTATAAATCCTGATCATGTAGTCACATTGCATATTCTGTGAAGGCAAGGAAAGTTTACTGTATAGCTATAGATGTGACAAAGTTCTTTCCTTTAAGAACAGCTTTATTTAAGCTATAGCATACCTTCACCTCTGACACTGTTCAGGGCAGACCGAGCGGTGGCAAATGATCACATTATCAAGGCAACAAGTTTCTGCAGTTCCCAGCCAGGTCACTCAGGTCTGCCCTTAATCAAACTAGACCTGATAATGTCCCACAGCACTTCTGCCATCAGACCAGAGTTGTGCTGTGGTGTCTCTGTCATCCAGCTGTGCAACCCTCATTGTACACTATTTGATTCCATTCTTACACCCCTTGGGGTTAATACAAAGACCCATAGGTTTGCAGCACACTAATTCACTCCTCTCAATGTAAGCTTCTATTTTTAGATACATTTTCTGTTATTAACGATTTAAAAAGGAAAAGTAAACATTTATTTTATATACT
  3   1   2       bld Gas7      in                         XZG22603.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCATGTGCCATGTTTAATACAGTCTTTAATGCAAGAGGGCTAAATGAAAGCTATCTGGACCCTAAACTTGCTATAAATCCTGATCATGTAGTCACATTGCATATTCTGTGAAGGCAAGGAAAGTTTACTGTATAGCTATAGATGTGACAAAGTTCTTTCCTTTAAGAACAGCTTTATNTAAGCTATAGCATACCTTCACCTCTGACACTGTTCAGGGCAGACCGAGCGGTGGCAAATGATCACATTATCAAGGCAACAAGTTTCTGCAGTTCCCAGCCAGGTCACTCAGGTCTGCCCTTAATCAAACTAGACCTGATAATGTCCCACAGCACTTCTGCCATCAGACCAGAGTTGTGCTGTGGTGTCTCTGTCATCCAGCTGTGCAACCCTCATTGTACACTATTTGATTCCATTCTTACACCCCTTGGGGTTAATACAAAGACCCATAGGTTTGCAGCACACTAATTCACTCCTCTCAATGTAAGCTTCTATTTTTAGATACATTTTCTGTTATTAACGATTTAAAAAGGAAAAGTAAACATTTATTTTATATACTTTGTAAGCTTATAAAAAACACACAACTTAATACTTTTGTAAACTACAGAGTGTGTTCCCACAGACTGTTGTGAGTGAGCTCACTGGCAGCTATTGTTTGCCTTATAGTGTTCATGTAGCATGTGTTTGTGTTGCTGTGATCATTTCATGGTTTTATGTGCACTTAGTAAGAATTATTAGATACAAAAAGGGGCAATTCTAATGCCAGAGCCATGATTTGCATGTTGTGACTGAGCTATTAAATTGCACCCCAAAGCATT
  5   1   2       bld Gas7      in                         XZG11911.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TACTCAGGTCTGCCCTTAATCAACTAGACCTGATATGTCCCACAGCACTTCTGCCATCAGACCAGAGTTGTGCTGTGGTGTCTCTGTCATCCAGCTGTGCAACCCTCATTGTACACTATTTGATTCCATTCTTACACCCCTTGGGGTTAATACAAAGACCCATAGGTTTGCAGCACACTAATTCACTCCTCTCAATGTAAGCTTCTATTTTTAGATACATTTTCTGTTATTAACGATTTAAAAAGGAAAAGTAAACATTTATTTTATATACTTTGTAAGCTTATAAAAAACACACAACTTAATACTTTTGTAAACTACAGAGTGTGTTCCCACAGACTGTTGTGAGTGAGCTCACTGGCAGCTATTGTTTGCCTTATAGTGTTCATGTAGCATGTGTTTGTGTTGCTGTGATCATTTCATGGTTTTATGTGCACTTAGTAAGAATTATTAGATACAAAAAGGGGCAATTCTAATGCCAGAGCCATGATTTGCATGTTGTGACTGAGCTATTAAATTGCACCCCAAAGCATTCCCTTATGGATATTGACTCTTATTGGTTCCTGAGCGTTGTAGTTTAGCAATAGCTGCAGAGCCAGTTCANAGGTTAGTGTGAAAAAGTGGTATATTGAAGGAAAATATAGGTGGGTAAAAAGTTACCAATCTTGCGGTTTGTTATAAAAATAGGCATCCTCTTGCGATACCCTGACCTTTTGGTTTGNGTGTGGG
  5   1   2       bld Ova1      in                        CABE10694.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTCATCCAGCTGTGCAACCCTCATTGTACACTATTTGATTCCATTCTTACACCCCTTGGGGTTAATACAAAGACCCATAGGTTTGCAGCACACTAATTCACTCCTCTCAATGTAAGCTTCTATTTTTAGATACATTTTCTGTTATTAACGATTTAAAAAGGAAAAGTAAACATTTATTTTATATACTTTGTAAGCTTATAAAAAACACACAACTTAATACTTTTGTAAACTACAGAGTGTGTTCCCACAGACTGTTGTGAGTGAGCTCACTGGCAGCTATTGTTTGCCTTATAGTGTTCATGTAGCATGTGTTTGTGTTGCTGTGATCATTTCATGGTTTTATGTGCACTTAGTAAGAATTATTAGATACAAAAAGGGGCAATTCTAATGCCAGAGCCATGATTTGCATGTTGTGACTGAGCTATTAAATTGCACCCCAAAGCATTCCCTTATGGATATTGACTTTTATTGGTTCCTGAGCGTTGTAGTTTAGCAATAGCTGCAGAGCCAGTTCAAAGGTTAGTGTGAAAAAGTGGTATATTGAAGGAAAATATAGGTGGGTAAAAAGTTACCAATCTTGCGGTTTGTTATAAAAATAGGCATCCTCTTGCGATACCCTGACCTTTTGGTTTGGGTGTGGGGGTGGTACATAGTTGCTATAGTTTCAACCAGTGTTTGCAGTAGGTAAATTTTTTTTTTAGTTCTAAGCTGGAGGCTGTGCCAGTGCTAGAGTGGGAAGGGGGTTCTTATTTACTCCTTGGGGAAAATGGCTCCAATAAACAATTGCTAAGTTCAGTTTCCTTTGCCCCTAGCTGGACTGATTAAAGCTAAAGCCTGT
  5   1   2       bld Tad5                                 XZT31821.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCAGCTGTGCAACCCTCATTGTACACTATTTGATTCCATTCTTACACCCCTTGGGGTTAATACAAAGACCCATAGGTTTGCAGCACACTAATTCACTCCTCTCAATGTAAGCTTCTATTTTTAGATACATTTTCTGTTATTAACGATTTAAAAAGGAAAAGTAAACATTTATTTTATATACTTTGTAAGCTTATAAAAAACACACAACTTAATACTTTTGTAAACTACAGAGTGTGTTCCCACAGACTGTTGTGAGTGAGCTCACTGGCAGCTATTGTTTGCCTTATAGTGTTCATGTAGCATGTGTTTGTGTTGCTGTGATCATTTCATGGTTTTATGTGCACTTAGTAAGAATTATTAGATACAAAAAGGGGCAATTCTAATGCCAGAGCCATGATTTGCATGTTGTGACTGAGCTATTAAATTGCACCCCAAAGCATTCCCTTATGGATATTGACTCTTATTGGTTCCTGAGCGTTGTAGTTTAGCAATAGCTGCAGAGCCAGTTCAAAGGTTAGTGTGAAAAAGTGGTATATTGAAGGAAAATATAGGTGGGTAAAAAGTTACCAATCTTGCGGTTTGTTATAAAAATAGGCATCCTCTTGCGATACCCTGACCTTTTGGTTTGNGTGTGGGGGTGGTACATAGTTGCTATAGTTTCAACCAGTGTTTGCAGTAGGTAAATTTTTTTTTTAGTTCTAAGCTGGAGGCTGTGCCAGTGCTAGAGTGNGAAGGGGGTTCTTATTTACTCCTTGGGGAAAATGGCTCCAATAAAACATTGCTAAAGTCAGTTTCCTTTGCCCCTAGCTGGACTGATTAAAGCTAAAGCCTGTAAGAAATGATGCCTTTTAATGTTTTTATGGCATTTGTCTACTGTACCGATTCCCACAGC
  5   1   2       bld Ova1      in                         CABE8448.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAAGACCCACTAGGTTTGCAGCACACTAATTCACTCCTCTCAATGTAAGCTTCTATTTTTAGATACATTTTCTGTTATTAACGATTTAAAAAGGAAAAGTAAACATTTATTTTATATACTTTGTAAGCTTATAAAAAACACACAACTTAATACTTTTGTAAACTACAGAGTGTGTTCCCACAGACTGTTGTGAGTGAGCTCACTGGCAGCTATTGTTTGCCTTATAGTGTTCATGTAGCATGTGTTTGTGTTGCTGTGATCATTTCATGGTTTTATGTGCACTTAGTAAGAATTATTAGATACAAAAAGGGGCAATTCTAATGCCAGAGCCATGATTTGCATGTTGTGACTGAGCTATTAAATTGCACCCCAAAGCATTCCCTTATGGATATTGACTTTTATTGGTTCCTGAGCGTTGTAGTTTAGCAATAGCTGCAGAGCCAGTTCAAAGGTTAGTGTGAAAAAGTGGTATATTGAAGGAAAATATAGGTGGGTAAAAAGTTACCAATCTTGCGGTTTGTTATAAAAATAGGCATCCTCTTGCGATACCCTGACCTTTTGGTTTGGGTGTGGGGGTGGTACATAGTTGCTATAGTTTCAACCAGTGTTTGCAGTAGGTAAATTTTTTTTTTAGTTCTAAGCTGGAGGCTGTGCCAGTGCTAGAGTGGGAAGGGGGTTCTTATTTACTCCTTGGGGAAAATGGCTCCAATAAACAATTGCTAAGTTCAGTTTCCTTTGCCCCTAGCTGGACTGATTAAAGCTAAAGCCTGTAAGAATGATTGCCTTTTAATGGTTTTTATGGCATTTGTCTACTGTACCGATTCC
  5   1   2       bld Eye       in                         CCAX2341.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTGCAGCACACTAATTCACTCCTCTCAATGTAAGCTTCTATTTTTAGATACATTTTCTGTTATTAACGATTTAAAAAGGAAAAGTAAACATTTATTTTATATACTTTGTAAGCTTATAAAAAACACACAACTTAATACTTTTGTAAACTACAGAGTGTGTTCCCACAGACTGTTGTGAGTGAGCTCACTGGCAGCTGTTGTTTGCCTTATAGTGTTCATGTAGCATGTGTTTGTGTTGCTGTGATCATTTCATGGTTTTATGTGCACTTAGTAAGAATTATTAGATACAAAAAGGGGCAATTCTAATGCCAGAGCCATGATTTGCATGTTGTGACTGAGCTATTAAATTGCACCCCAAAGCATTCCCTTATGGATATTGACTCTTATTGGTTCCTGAGCGTTGTAGTTTAGCAATAGCTGCAGAGCCAGTTCAAAGGTTAGTGTGAAAAAGTGGTATATTGAAGGAAAATATAGGTGGGTAAAAAGTTACCAATCTTGCGGTTTGTTATAAAAATAGGCATCCTCTTGCGATACCCTGACCTTTTGGTTTGGGTGTGGGGGTGGTACATAGTTGCTATAGTTTCAACCAGTGTTTGCAGTAGGTAAATTTTTTTTTTTAGTTCTAAGCTGGAGGCTGTGCCAGTGCTAGAGTGGGAAGGGGGTTCTTATTTACTCCTTGGGGAAAATGGCTCCAATAAACAATTGCTAAGTTCAGTTTCCTTTGCCCCTAGCTGGACTGATTAAAGCTAAAGCCTGTAAGAATGATT
  5   1   2       bld Gas7      in                         XZG24409.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTATTTTTAGATACATTTTCTGTTATTAACGATTTAAAAATGAAAAGTAAACATTTATTTTATATACTTTGTAAGCTTATAAAAAACACACAACTTAATACTTTTGTAAACTACAGAGTGTGTTCCCACAGACTGTTGTGAGTGAGCTCACTGGCAGCTATTGTTTGCCTTATAGTGTTCATGTAGCATGTGTTTGTGTTGCTGTGATCATTTCATGGTTTTATGTGCACTTAGTAAGAATTATTAGATACAAAAAGGGGCAATTCTAATGCCAGAGCCATGATTTGCATGTTGTGACTGAGCTATTAAATTGCACCCCAAAGCATTCCCTTATGGATATTGACTCTTATTGGTTCCTGAGCGTTGTAGTTTAGCAATAGCTGCAGAGCCAGTTCAAAGGTTAGTGTGAAAAAGTGGTATATTGAAGGAAAATATAGGTGGGTAAAAAGTTACCAATCTTGCGGTTTGTTATAAAAATAGGCATCCTCTTGCGATACCCTGACCTTTTGGTTTGGGTGTGGGGGTGGTACATAGTTGCTATAGTTTCAACCAGTGTTTGCAGTAGGTAAATTTTTTTTTTAGTTCTAAGCTGGAGGCTGTGCCAGTGCTAGAGTGNGAAGGGGGTTCTTATTTACTCCTTGGGGAAAATGGCTCCAATAAACAATTGCTAATTTCAGTTTCCTTTGCCCCTAGCTGGACTGATTAAAGCTAAAGCCTGTAAGAATGATTGCCT
  5   1   2       bld Gas7      in                         XZG52567.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATTTATTTTATATACTTTGTAAGCTTATAAAAAACACACAACTTAATACTTTTGTAAACTACAGAGTGTGTTCCCACAGACTGTTGTGAGTGAGCTCACTGGCAGCTATTGTTTGCCTTATAGTGTTCATGTAGCATGTGTTTGTGTTGCTGTGATCATTTCATGGTTTTATGTGCACTTAGTAAGAATTATTAGATACAAAAAGGGGCAATTCTAATGCCAGAGCCATGATTTGCATGTTGTGACTGAGCTATTAAATTGCACCCCAAAGCATTCCCTTATGGATATTGACTCTTATTGGTTCCTGAGCGTTGTAGTTTAGCAATAGCTGCAGAGCCAGTTCAAAGGTTAGTGTGAAAAAGTGGTATATTGAAGGAAAATATAGGTGGGTAAAAAGTTACCAATCTTGCGGTTTGTTATAAAAATAGGCATCCTCTTGCGATACCCTGACCTTTTGGTTTGGGTGTGGGGGTGGTACATAGTTGCTATAGTTTCAACCAGTGTTTGCAGTAGGTAAATTTTTTTTTTAGTTCTAAGCTGGAGGCTGTGCCAGTGCTAGAGTGGGAAGGGGGTTCTTATTTACTCCTTGGGGAAAATGGCTCCAATAAACAATTGCTAAGTTCAGTTTCCTTTGCCCCTAGCTGGACTGATTAAAGCTAAAGCCTGTAAGAATGATTGCCTTTTAATGGTTTTTATGGCATTTGT
  5   1   2       bld Gas0      in                         dad19b06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGGGGTGTTTGTGTTGCTGTGATCATTTCATGGTTTTATGTGCACTTAGTAAGAATTATTAGATACAAAAAGGGGCAATTCTAATGCCAGAGCCATGATTTGCATGTTGTGACTGAGCTATTAAATTGCACCCCAAAGCATTCCCTTATGGATATTGACTCTTATTGGTTCCTGAGCGTTGTAGTTTAGCAATAGCTGCAGAGCCAGTTCAAAGGTTAGTGTGAAAAAGTGGTATATTGAAGGAAAATATAGGTGGGTAAAAAGTTACCAATCTTGCGGTTTGTTATAAAAATAGGCATCCTCTTGCGATACCCTGACCTTTTGGTTTGGGTGTGGGGGTGGTACATA
  5   1   2       bld Egg       in                   TEgg031h13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGCTGTGATCATTTCATGGTTTTATGTGCACTTAGTAAGAATTATTAGATACAAAAAGGGGCAATTCTAATGCCAGAGCCATGATTTGCATGTTGTGACTGAACTATTAAATTGCACCCCAAAGCATTCCCTTATGGATATTGACTCTTATTGGTTCCTGAGCGTTGTAGTTTAGCAATAGCTGCATAGCCAATTCAAAGGTTAGTGTAAAAAAGTGGTATATTGAAGGAAAATATATGTGGGTAAAAAGTTACCAATCTTGCGGTTTGTTATAAAAATAGGCATCCTCTTGCGATACCCTGACCTTTTGGTTTGGGTGTGGGG
  3   1   2       bld Egg       in                    TEgg031h13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCGTTGTAGTTTAGCAATAGCTGCAGAGCCAGTTCAAAGGTTAGTGTGAAAAAGTGGTATATTGAAGGAAAATATAGGTGGGTAAAAAGTTACCAATCTTGCGGTTTGTTATAAAAATAGGCATCCTCTTGCGATACCCTGACCTTTTGGTTTGGGTGTGGGGGTGGTACATAGTTGCTATAGTTTCAACCAGTGTTTGCAGTAGGTAAATTTTTTTTTTAGTTCTAAGCTGGAGGCTGTGCCAGTGCTAGAGTGGGAAGGGGGTTCTTATTTACTCCTTGGGGAAAATGGCTCCAATAAACAATTGCTAAGTTCAGTTTCCTTTGCCCCTAGCTGGACTGATTAAAGCTAAAGCCTGTAAGAATGATTGCCTTTTAATGGTTTTTATGGCATTTGTCTACTGTACCGATTCCCACAGCAGTCAGCCCTATGTATCTTAAAGACAGAGCATTCTAAACACCTTTACTTACTGTCCAGCTCAGCTCCTCCTATATTACTGGATTGCAGCTCTTGGGACAGTGCCTGCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATTAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Eye       in                         CCAX3563.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTAGCAATAGCTGCAGAGCCAGTTCAAAGGTTAGTGGTGAAAAAGTGGTATATTGAAGGAAAAATATAGGTGGGTAAAAAGTTACCAATCTTGCCGGTTGTTATAAAAATAGGCATCCTCTTGCGATACCCTGACCTTTTGGTTTGGGTGTGGGGGGTGGTACATAGTTGCTATAGTTTCAACCAGTGTTTGCAGTAGGTAAATTTTTTTTTTAGTTCTAAGCTGGAGGCTGTGCCAGTGCTAGAGTGGGAAGGGGGTTCTTATTTACTCCTTGGGGAAAATGGCTCCATAAACAATTGCTAAGTTCAGTTTCCTTTGCCCCTAGCTGGACTGATTAAAGCTAAAGCCTG
  5   1   2       bld Te5       in                         CAAO1997.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTAAGCTGGAGGCTGTGCCAGTGCTAGAGTGGGAAGGGGGTTCTTATTTACTCCTTGGGGAAAATGGCTCCAATAAACAATTGCTAAGTTCAGTTTCCTTTGCCCCTAGCTGGACTGATTAAAGCTAAAGCCTGTAAGAATGATTGCCTTTTAATGGTTTTTATGGCATTTGTCTACTGTACCGATTCCCACAGCAGTCAGCCCTATGTATCTTAAAGACAGAGCATTCTAAACACCTTTACTTACTGTCCAGCTCAGCTCCTCCTATATTACTGGATTGCAGCTCTTGGGACAGTGCCTGCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAATATCATAGGCCA
  5   1   2       bld Te3       in                         CAAM2174.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAAAGCCTGTAAGAATGATTGCCTTTTAATGGTTTTTATGGCATTTGTCTACTGTACCGATTCCCACAGCAGTCAGCCCTATGTATCTTAAAGACAGAGCATTCTAAACACCTTTACTTACTGTCCAGCTCAGCTCCTCCTATATTACTGGATTGCAGCTCTTGGGACAGTGCCTGCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCANAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCCACACAGACCAATGTGAA
  3   1   2       bld Tad5 FL   out                        XZT61521.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAAGAATGATGCCTTTTAATGTTTTTTATGGCATTTGTCTACTGTACGATTTCCCACAGCAGTCAGCCCTATGTATCTAAAGACAGAGCATTCTAAACACCTTTACTTACTGTCCAGCTCAGCTCCTCCTATATTACTGGATTGCAGCTCTTGGGACAGTGCCTGCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATGAATAAAGAGATTTTCTAT
  3   1   2       bld Te5       in                         CAAO1997.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATGCNTTTTTAATGGGTTTTTATGGCATTTGTCTACTGTACCGATTCCCACAGCAGTCAGCCCTATGTATCTAAAGACAGAGCATTCTAAACACCTTTACTTACTGTCCAGCTCAGCTCCTCCTATATTACTGGATTGCAGCTCTTGGGACAGTGCCTGCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATGAATAAAGAGATTTTCTAT
  5   1   2       bld Ova1      in                          CABE517.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATCGATTCGTTTTATGGTTTTTATGGCATTTGTCTACTGTACCGATTCCCACAGCAGTCAGCCCTATGTATCTTAAAGACAGAGCATTCTAAACACCTTTACTTACTGTCCAGCTCAGCTCCTCCTATATTACTGGATTGCAGCTCTTGGGACAGTGCCTGCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATGAATAAAGAGATTTTCTATAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu       in                   TNeu113o01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCCTTTTAATGGTTTTTATGGCATTTGTCTACTGTACCGATTCCCACAGCAGTCAGCCCTATGTATCTTAAAGACAGAGCATTCTAAACACCTTTACTTACTGTCCAGCTCAGCTCCTCCTATATTACTGGATTGCAGCTCTTGGGACAGTGCCTGCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATTTAGTTAAAGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATC
  3   1   2       bld Egg       in                    TEgg039m09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATGGTTTTTATGGCATTTGTCTACTGTACCGATTCCCCACAGCAGTCAGCCCTATGTATCTTAAAGACAGAGCATTCTAAACNACCTTTANCTTACTGTCCAGCTCAGCTCCTCCNTATATTACTGGATTGCAGCTCTTGGGACAGTGCCTGCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCNAAAAAATTCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATGAATAAAGAGATTTTCTTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Lun1      in                         CABD1550.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTATGGTTTTTTAGGCATTTTGTCTACTGTACGATTTCCCACAGCAGTCAGCCCTATGTATTTAAAGACAGAGCATTCTAAACACCTTTACTTACTGTCCAGCTCAGCTCCTCCTATATTACTGGATTGCAGCTCTTGGGACAGTGCCTGCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATGAATAAAGAGATTTTCTAT
  3   1   2       bld Gas7      in                         XZG58660.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGTTTTTATGGCATTTGTCTACTGTACGATTTCCCACAGCAGTCAGCCCTATGTATCTTAAAGACAGAGCATTCTAAACACCTTTACTTACTGTCCAGCTCAGCTCCTCCTATATTACTGGATTGCAGCTCTTGGGACAGTGCCTGCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATGAATAAAGAGATTTTCTATAAAAAAAAAAAAAAAGG
  3   1   2       bld Neu       in                    TNeu113o01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGGCATTTGTCTACTGTACCGATTCNCACAGCAGTCAGCCCTATGTATCTTAAAGACAGAGCATTCTAAACACCTTTACTTACTGTCCAGCTCAGCTCCTCCTATATTACTGGATTGCAGCTCTTGGGACAGTGCCTGCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATGAATAAAGAGATTTTCTATAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                         CABE8448.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTACCGATTCCCACAGCAGTCAGCCCTATGTATCTAAAGACAGAGCATTCTAAACACCTTTACTTACTGTCCAGCTCAGCTCCTCCTATATTACTGGATTGCAGCTCTTGGGACAGTGCCTGCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATGAATAAAGAGATTTTCTATAAAAT
  3   1   2       bld Te3       in                         CAAM2174.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGACAGAGCATTCTAAACACCTTTACTTACTGTCCAGCTCAGCTCCTCCTATATTACTGGATTGCAGCTCTTGGGACAGTGCCTGCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATGAATAAAGAGATTTTCTAT
  3   1   2       bld Gas7      in                         XZG24409.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGACAGAGCATTCTAAACACCTTTACTTACTGTCCAGCTCAGCTCCTCCTATATTACTGGATTGCAGCTCTTGGGACAGTGCCTGCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATGAATAAAGAGATTTTCTATAAAAAAAAAAAAAAAGG
  3   1   2      seed Ova1      in                        CABE10694.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGACAGAGCATTCTAAACACCTTTACTTACTGTCCAGCTCAGCTCCTCCTATATTACTGGATTGCAGCTCTTGGGACAGTGCCTGCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATGAATAAAGAGATTTTCTAT
  3   1   2       bld Ova1      in                          CABE517.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACAGAGCATTCTAAACACCTTTACTTACTGTCCAGCTCAGCTCCTCCTATATTACTGGATTGCAGCTCTTGGGACAGTGCCTGCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATGAATAAAGAGATTTTCTAT
  3   1   2       bld Te4       in                         CAAN9319.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTTTACTTACTGTCCAGCTCAGCTCCTCCTATATTACTGGATTGCAGCTCTTGGGACAGTGCCTGCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATGAATAAAGAGATTTTCTATAAAAT
  3   1   2       bld Lun1      out                        CABD7676.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGCTCCTCCTATATTACTGGATTGCAGCTCTTGGGACAGTGCCTGCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATGAATAAAGAGATTTTCTAT
  5   1   2       bld HdA       in                   THdA045n12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCTTGGGACAGTGCCTGCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAAATCTATTACAACATATAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAGAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGCTAAATATCATANGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGT
  3   1   2       bld Gas7      in                         XZG52567.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCCTGAACTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATGAATAAAGAGATTTTCTATAAAAAAAAAAAAAAAGG
  3   1   2       bld Eye       in                         CCAX2341.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTACATAGTACTGGTATACTTTTGCTCTGTACATGCTGTGTTCCACGGAAAGCCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTCAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATTTAGCACACAGCCTCCAGCATATGGGTACAATGTTTAGCACAGTAGTAACTGGAAATATTTTTTGGTTTTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTTTTTTATTTATACTGTGAGTCAATGTTTTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATTTATGAATAAAGAGATTTTTTATA
  3   1   2       bld HdA       in                    THdA045n12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATACTTTTGCTCTGTACATGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCACAAAAATCTATTACAACATATAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATTTAGTTAAGGTTTTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATTTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATGAATAAAGAGATTTTCTTAAAAAAAAAAAAAAAAAAGCG
  5   1   2       bld Egg                            TEgg136k16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGGGGGCTGTGTTCACGGAAAGCACATTAACTGCTTAAAGTCCAGAAGCTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATG
  5   1   2       bld Tbd1      in                         CBXT9388.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATGAATAAAGAGATTTTCTATAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                         CBXT9388.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGTAGGATGAGGGCCAAAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATGAATAAAGAGATTTTCTATAAAAAAAAAAAAAAA
  5   1   2       bld Egg                            TEgg015g03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAGCCAAAAAATCTATTACAACATATAAATAATATAATAATAATAAATATAACACAACTATCCAGGTTCCCTCCTAACAAATTGCTTTCCCTACAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCATTAACCTCTCCTGCGTGTGGACCCTGTGCTCCAACATATTTAATTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCACCTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTACGATATCTA
  3   1   2       bld Gas7      in                         XZG11911.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATATAGCACAACTATGCAGGTTCCATCGTATCAAATTGCTTTACCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGGTCCAACATATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATTAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTGGCAGGCAACTAGGATATCTAGCACTCAGCCTCCAGCATATGGGTTCAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGA
  3   1   2       bld Egg0                                 dad71c05.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTATCCAGGTTCCATCCTAACAAATTGCTTTCCCTAGAAGAGCATGGTGCTGGCCATTCCCTGCATGGCTAACCAGCAGTAACCTCTCCTGCGTGTGGTCCCTGTGCTCCAACATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTTACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAATAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCC
  3   1   2       bld Gas0      in                         dad19b06.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCCTGCGTGTGGTCCCTGTGCTCCAACATTTAGTTAAGGTTCTGTTCACAGGGCTTTTCCCCTCTACTGCAGATATCAACTGAAATCCTGGGGACTAGCCGGCTATAAGAATAATAAGCACATGGAGCACATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGAATGTGCACGGCTAGCCCACAACAAGACCAAGTGTGAAGCCCTATTTTGTTGTGTTATTTNTATATCTATGAATAAAGAGNATTTTCTATAAAAAAA
  3   1   2       bld Eye       in                         CCAX3563.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATATAACTGTATTGTTCAGTCATGACTTGGGGGGGTTACCATACAACTAGGATATCTAGCACACAGCCTCCAGCATATGGGTACAATGTCTAGCACAGTAGTAACTGGAAATATTTCTTGGTTCTATGCCCCAAAAAAAGCTGAATATAGTTTGACCATCTCCAGTGTAATGGTAAAATATCATAGGCCAAGCCCATATAAATGTGTTAGAAAAAGTCTTTTATTTATACTGTGAGTCAATGTTCTATATTAAGATGTGCACGGTAGCCACAACAGACCAATGTGAAGCCTATTTTGTTTGTTATTTTATATCTATGAATAAAGAGATTTTCTATA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)