Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 30 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABI13900.3.5                        50 END     1           2        2                Bardet-Biedl syndrome 5 (human) [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 223.0    0Xt7.1-TGas104b15.3.5                       73 PI      79        433      747                Fox protein [Xenopus tropicalis]
     3 389.0    0Xt7.1-TTpA063f13.5                          8 PI      88        433      741                BF-2 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012074894 Xt7.1-XZG63996.5 - 44 ESTs
                                                                       ........-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG63996.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTAAAAGTGTCTGTGCGTCCCTTGTCAAGCAGCGGGCAGCAGCCAGGAGGGAGGGGGCGATGCACAGGATTTGAAGGTAGGCACTCGCTGCAAGTTGACTACTACTTGCCCTGCCGAGCCTATTTCTCTTTCGGTGCCTGCCCATTGCCGAGGACCCGTAGCTGGAATGACCCTGTCAGGCAGCAGCAGTGCCAGCGACATGTCCGGCCAGACCGTGCTGAGCGCCGACGATGCGGACATCGATGTGGTGGGCGAGGGGGACGAGCCGCTGGACAAGGACAGTGAGTGCGGGAGCCCAGCCGGGCATGCGGAGGAAGCGGACGAACTCGGGGGCAAGGAGATAGCCAGGAGCCCCTCGGGCAGTGCCAATGAGGCAGAGGGCAAGGGCGAGAGCCAGCAGCAGGAGGGCATGCAGAACAAGCCCAAGAACAGCCTGGTGAAGCCCCCCTACTCCTACATCGCGCTGATCACCATGGCCATCCTGCAGAGCCCCCAGAAGAAGCTCACCCTGAGCGGCATCTGTGAGTTCATCAGCAACCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCTGGCAGAACTCCATCCGCCACAATCTCTCGCTTAATGACTGCTTCGTCAAAATCCCCCGGGAGCCCGGAAACCCAGGCAAGGGAAACTACTGGACCCTGGACCCCCAGTCCGAGGACATGTTCGACAATGGCAGTTTCCTCAGGAGAAGGAAGCGCTTTAAGAGACAACAGCCGGACTCATTGAGGGAGCAGACGGCTCTCATGATGCAAAGCTTTGGGGCTTACAGCCTGGCCGGTCCCTATGGGCGCCCCTATGGGCTCCACCCTGCAGCCTACACTCACCCTGCTGCCCTGCAGTATCCTTACATCCCCCCGGTGGGGCCCATGTTACCCCCGGCGGTGCCACTTCTGCCTTCCTCTGAACTGAGCAGGAAAGCCTTCAGCTCGCAGCTCAGCCCCAGCCTCCAGCTGCAGCTCAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTCTGAGCCCAGCAGCCGACCCTCCTTCAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAATGAATATATATGTATTATAAATGTTATTCCATCGTGTTGTACACAGTTTTGTAAATAAATTTTTTAAAATGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008226368                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGTCTGTGCGTCCCTTGTCAAGCAGCGGGCAGCAGCCAGGAGGGAGGGGGCGATGCACAGGATTTGAAGGTAGGCACTCGCTGCAAGTTGACTACTACTTGCCCTGCCGAGCCTATTTCTCTTTCGGTGCCTGCCCATTGCCGAGGACCCGTAGCTGGAATGACCCTGTCAGGCAGCAGCAGTGCCAGCGACATGTCCGGCCAGACCGTGCTGAGCGCCGACGATGCGGACATCGATGTGGTGGGCGAGGGGGACGAGCCGCTGGACAAGGACAGTGAGTGCGGGAGCCCAGCCGGGCATGCGGAGGAAGCGGACGAACTCGGGGGCAAGGAGATAGCCAGGAGCCCCTCGGGCAGTGCCAATGAGGCAGAGGGCAAGGGCGAGAGCCAGCAGCAGGAGGGCATGCAGAACAAGCCCAAGAACAGCCTGGTGAAGCCCCCCTACTCCTACATCGCGCTGATCACCATGGCCATCCTGCAGAGCCCCCAGAAGAAGCTCACCCTGAGCGGCATCTGTGAGTTCATCAGCAACCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCTGGCAGAACTCCATCCGCCACAATCTCTCGCTTAATGACTGCTTCGTCAAAATCCCCCGGGAGCCCGGAAACCCAGGCAAGGGAAACTACTGGACCCTGGACCCCCAGTCCGAGGACATGTTCGACAATGGCAGTTTCCTCAGGAGAAGGAAGCGCTTTAAGAGACAACAGCCGGACTCATTGAGGGAGCAGACGGCTCTCATGATGCAAAGCTTTGGGGCTTACAGCCTGGCCGGTCCCTATGGGCGCCCCTATGGGCTCCACCCTGCAGCCTACACTCACCCTGCTGCCCTGCAGTATCCTTACATCCCCCCGGTGGGGCCCATGTTACCCCCGGCGGTGCCACTTCTGCCTTCCTCTGAACTGAGCAGGAAAGCCTTCAGCTCGCAGCTCAGCCCCAGCCTCCAGCTGCAGCTCAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTCTGAGCCCAGCAGCCGACCCTCCTTCAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAATGAATATATATGTATTATAAATGTTATTCCATCGTGTTGTACACAGTTTTGTAAATAAATTTTTTAAAATGGTAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        8    10    14    15    14    15    15    15    15    15    15    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    15    16    15    16    15    16    15    16    15    16    15    16    16    17    16    17    15    17    16    17    15    16    15    16    15    16    15    16    15    16    15    16    15    16    14    16    15    17    15    17    15    17    15    17    15    17    15    17    15    17    15    17    15    16    15    16    15    16    14    15    12    13    12    12    12    12    13    13    12    12    12    12    11    11    10    10    10    10     9     9     9     9     9     9     9     9     8     8     8     8     8     8     6     7     7     8     8     9     7     9     8     9     8     9     8     9     8     9     9    10     9    10     9     9     6     6     7     7     7     7     7     7     8     8    11    11    11    12    12    13    15    17    17    19    19    20    19    20    20    21    20    21    18    21    18    20    18    20    20    22    21    23    21    23    22    24    22    24    22    24    22    24    23    24    23    24    23    24    22    24    22    24    23    24    23    24    23    24    24    25    24    25    24    25    24    25    23    24    22    24    24    24    25    25    24    25    25    25    24    25    24    25    24    25    24    25    24    25    24    25    23    24    24    24    22    24    22    24    22    24    23    24    23    24    22    24    23    24    21    22    20    22    20    22    20    22    20    22    17    19    17    19    17    18    17    17    16    16    16    16    16    16     7    12     7     7     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----T-T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -T----------
                                               BLH ATG     166    1527                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH MIN     166     205                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH OVR     166     124                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               EST CLI     -10      42                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               ORF LNG     166       7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Br ---- 2e-015     CAA72307.1 whn transcription factor [Branchiostoma lanceolatum] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================
                                                                       PROTEIN --- Sc ---- 5e-021     NP_014331.1 Fork Head homolog two; Fkh2p [Saccharomyces cerevisiae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Bb ==== 5e-045     BAD97363.1 forkhead protein FoxE4 [Branchiostoma belcheri] =====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dm ---- 2e-053     NP_523814.1 forkhead domain 59A CG3668-PA [Drosophila melanogaster] =============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 2e-055     NP_496411.1 UNCoordinated locomotion UNC-130, forkhead box D1 (37.3 kD) (unc-130)[Caenorhabditis elegans] -------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ci ---- 6e-065     BAE06435.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Cs ---- 2e-068     BAB68347.1 forkhead protein FoxD [Ciona savignyi] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ---- 2e-067     XP_001188749.1 PREDICTED: similar to forkhead transcription factor D [Strongylocentrotus purpuratus] ------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Bf ---- 2e-073     AAN03853.1 winged helix/forkhead transcription factor [Branchiostoma floridae] -------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Hs ==== 8e-136     NP_036315.1 forkhead box D3 [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Mm ==== 3e-136     NP_034555.3 forkhead box D3 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Gg ==== 6e-153     NP_990282.1 forkhead box D3 [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Dr ==== 9e-165     NP_571365.1 forkhead box D3; fork head domain protein 6 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xl ==== 0          BAA36334.1 XFD-6 [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === ?? ==== 0          NP_001079026.1 forkhead box D3 [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xt ==== 0          CAJ82837.1 forkhead box D3 [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG63996.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------TAA------------------------------------------------------------------------TAA------------------------------------------TGA------------------------------TAA------------TAG---------------------------TGA------------------------ATG------------TAA---------------------------TAA---ATG---------TAA---------------------TGA------ATG---------------------------------------TAA------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  0   1   1           Neu  FL                     TNeu088c09.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAGTGTCTGTGCGTCCCTTGTCAAGCAGCGGGCAGCAGCCAGGAGGGAGGGGGCGATGCACAGGATTTGAAGGTAGGCACTCGCTGCAAGTTGACTACTACTTGCCCTGCCGAGCCTATTTCTCTTTCGGTGCCTGCCCATTGCCGAGGACCCGTAGCTGGAATGACCCTGTCAGGCAGCAGCAGTGCCAGCGACATGTCCGGCCAGACCGTGCTGAGCGCCGACGATGCGGACATCGATGTGGTGGGCGAGGGGGACGAGCCGCTGGACAAGGACAGTGAGTGCGGGAGCCCAGCCGGGCATGCGGAGGAAGCGGACGAACTCGGGGGCAAGGAGATAGCCAGGAGCCCCTCGGGCAGTGCCAATGAGGCAGAGGGCAAGGGCGAGAGCCAGCAGCAGGAGGGCATGCAGAACAAGCCCAAGAACAGCCTGGTGAAGCCCCCCTACTCCTACATCGCGCTGATCACCATGGCCATCCTGCAGAGCCCCCAGAAGAAGCTCACCCTGAGCGGCATCTGTGAGTTCATCAGCAACCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCTGGCAGAACTCCATCCGCCACAATCTCTCGCTTAATGACTGCTTCGTCAAAATCCCCCGGGAGCCCGGAAACCCAGGCAAGGGAAACTACTGGACCCTGGACCCCCAGTCCGAGGACATGTTCGACAATGGCAGTTTCCTCAGGAGAAGGAAGCGCTTTAAGAGACAACAGCCGGACTCATTGAGGGAGCAGACGGCTCTCATGATGCAAAGCTTTGGGGCTTACAGCCTGGCCGGTCCCTATGGGCGCCCCTATGGGCTCCACCCTGCAGCCTACACTCACCCTGCTGCCCTGCAGTATCCTTACATCCCCCCGGTGGGGCCCATGTTACCCCCGGCGGTGCCACTTCTGCCTTCCTCTGAACTGAGCAGGAAAGCCTTCAGCTCGCAGCTCAGCCCCAGCCTCCAGCTGCAGCTCAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTCTGAGCCCAGCAGCCGACCCTCCTTCAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAATGAATATATATGTATTATAAATGTTATTCCATCGTGTTGTACACAGTTTTGTAAATAAATTTTTTAAAATGGTAAAAAAAAAAAAAAAAAAAAA
  5   1   1           Gas1 FL                     IMAGE:6988210.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGTGTCTGTGCGTCCCTTGTCAAGCAGCGGGCAGCAGCCAGGAGGGAGGGGGCGATGCACAGGATTTGAAGGTAGGCACTCGCTGCAAGTTGACTACTACTTGCCCTGCCGAGCCTATTTCTCTTTCGGTGCCTGCCCATTGCCGAGGACCCGTAGCTGGAATGACCCTGTCAGGCAGCAGCAGTGCCAGCGACATGTCCGGCCAGACCGTGCTGAGCGCCGACGATGCGGACATCGATGTGGTGGGCGAGGGGGACGAGCCGCTGGACAAGGACAGTGAGTGCGGGAGCCCAGCCGGGCATGCGGAGGAAGCGGACGAACTCGGGGGCAAGGAGATAGCCAGGAGCCCCTCGGGCAGTGCCAATGAGGCAGAGGGCAAGGGCGAGAGCCAGCAGCAGGAGGGCATGCAGAACAAGCCCAAGAACAGCCTGGTGAAGCCCCCCTACTCCTACATCGCGCTGATCACCATGGCCATCCTGCAGAGCCCCCAGAAGAAGCTCACCCTGAGCGGCATCTGTGAGTTCATCAGCAACCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCTGGCAGAACTCCATCCGCCACAATCTCTCGCTTAATGACTGCTTCGTCAAAATCCCCCGGGAGCCCGGAAACCCAGGCAAGGGAAACTACTGGACCCTGGACCCCCAGTCCGAGGACATGTTCGACAATGGCAGTTTCCTCAGGAGAAGGAAGCGCTTTAAGAGACAACAGCCGGACTCATTGAGGGAGCAGACGGCTCTCATGATGCAAAGCTTTGGGGCTTACAGCCTGGCCGGTCCCTATGGGCGCCCCTATGGGCTCCACCCTGCAGCCTACACTCACCCTGCTGCCCTGCAGTATCCTTACATCCCCCCGGTGGGGCCCATGTTACCCCCGGCGGTGCCACTTCTGCCTTCCTCTGAACTGAGCAGGAAAGCCTTCAGCTCGCAGCTCAGCCCCAGCCTCCAGCTGCAGCTCAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTCTGAGCCCAGCAGCCGACCCTCCTTCAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAATGAATATATATGTATTATAAATGTTATTCCATCGTGTTGTACACAGTTTTGTAAATAAATTTTTTAAAATGGAAAAAAAAAAAAAAAA
  5   1   2       bld TbA  5g3  in                   TTbA069f07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAAGGGGGGAATTTAAAAGTGTCTGTGCGTCCCTTGTCAAGCAGCGGGCAGCAGCCAGGAGGGAGGGGGCGATGCACAGGATTTGAAGGTAGGCACTCGCTGCAAGTTGACTACTACTTGCCCTGCCGAGCCTATTTCTCTTTCGGTGCCTGCCCATTGCCGAGGACCCGTAGCTGGAATGACCCTGTCAGGCAGCAGCAGTGCCAGCGACATGTCCGGCCAGACCGTGCTGAGCGCCGACGATGCGGACATCGATGTGGTGGGCGAGGGGGACGAGCCGCTGGACAAGGACAGTGAGTGCGGGAGCCCAGCCGGGCATGCGGAGGAAGCGGACGAACTCGGGGGCAAGGAGATAGCCAGGAGCCCCTCGGGCAGTGCCAATGAGGCAGAGGGCAAGGGCGAGAGCCAGCAGCAGGAGGGCATGCAGAACAAGCCCAAGAACAGCCTGGTgaagcccccctactcctacatcgcgctgatcaccatggccatcctgcagagcccccagaagaagctcaccctgagcggcatctgtgagttcatcagcaaccgcttcccctactatcgggagaagttcccggcctggcagaactccatccgccacaatctctcgcttaatgactgcttcgtcaaaatcccccgggagcccgganacccaggcaagggaaactactggaccctggacccccagtccgaggacatgttcgacaatggcagtttcctC
  5   1   2   12  bld Tad5 5g3  in                         XZT37586.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGTTAAAAGTGTCTGTGCGTCCCTTGTCAAGCAGCGGGCAGCAGCCAGGAGGGAGGGGGCGATGCACAGGATTTGAAGGTAGGCACTCGCTGCAAGTTGACTACTACTTGCCCTGCCGAGCCTATTTCTCTTTCGGTGCCTGCCCATTGCCGAGGACCCGTAGCTGGAATGACCCTGTCAGGCAGCAGCAGTGCCAGCGACATGTCCGGCCAGACCGTGCTGAGCGCCGACGATGCGGACATCGATGTGGTGGGCGAGGGGGACGAGCCGCTGGACAAGGACAGTGAGTGCGGGAGCCCAGCCGGGCATGCGGAGGAAGCGGACGAACTCGGGGGCAAGGAGATAGCCAGGAGCCCCTCGGGCAGTGCCAATGAGGCAGAGGGCAAGGGCGAGAGCCAGCAGCAGGAGGGCATGCAGAACAAGCCCAAGAACAGCCTGGTgaagcccccctactcctacattgcgctgatcaccatggccatcctgcagagcccccagaagaagctcaccctgagcgGCATCTGTGAGTTCATCAGCAACCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCtggcagaactccatccgccacaatctctcgcttaatgactgcttcgtcaaaatcccccgggagcccggaaacccaggcaagggaaactactggaccctggacccccagtccgaggacatgttcgacaatggcagtttcctCAGGAGAAGGAAGCGCTTTAAGAGACAACAGCCGGACTCATTGAGGGAGCAGACGGCTCTCATGATGCAAAGCTTTGGGGCTTACAGCCTGGCCGGTCCCTATGGGCGCCCCTATGGGCTCCACCCTGC
  5   1   2       bld Gas8 5g3  in                          st39n22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGGGGGAAATTTAAAGTGTCTGTGCGTCCCTTGTCAAGCAGCGGGCAGCAGCCAGGAGGGAGGGGGCGATGCACAGGATTTGAAGGTAGGCACTCGCTGCAAGTTGACTACTACTTGCCCTGCCGAGCCTATTTCTTTTTCGGTGCCTGCCCATTGCCGAGGACCCGTAGCTGGAATGACCCTGTCAGGCAGCAGCAGTGCCAGCGACATGTCCGGCCAGACCGTGCTGAGCGCCGACGATGCGGACATCGATGTGGTGGGCGAGGGGGACGAGCCGCTGGACAAGGACAGTGAGTGCGGGAGCCCAGCCGGGCATGCGGAGGAAGCGGACGAACTCGGGGGCAAGGAGATAGCCAGGAGCCCCTCGGGCAGTGCCAATGAGGCAGAGGGCAAGGGCGAGAGCCAGCAGCAGGAGGGCATGCAGAACAAGCCCAAGAACAGCCTGGTGAAGCCCCCCTACTCCTACATCGCGCTGATCACCATGGCCATCCTGCAGAGCCCCCAGAAGAAGCTCACCCTGAGCGGCATCTGTGAGTTCATCAGCAACCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCTGGCAGAACTCCATCCGCCACAATCTCTCGCTTAATGACTGCTTCGTCAAAATCCCCCGGGAGCCCGGAAACCCAGGCAAGGGAAACTACT
  5   1   2       bld TbA  5g3  in                   TTbA069c06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCCGGGATTTAAAAGTGTCTGTGCGTCCCTTGTCAAGCAGCGGGCAGCAGCCAGGAGGGAGGGGGCGATGCACAGGATTTGAAGGTAGGCACTCGCTGCGAGTTGACTACTACTTGCCCTGCCGAGCCTATTTCTCTTTCGGTGCCTGCCCATTGCCGAGGACCCGTAGCTGGAATGACCCTGTCAGGCAGCAGCAGTGCCAGCGACATGTCCGGCCAGACCGTGCTGAGCGCCGACGATGCGGACATCGATGTGGTGGGCGAGGGGGACGAGCCGCTGGACAAGGACAGTGAGTGCGGGAGCCCAGCCGGGCATGCGGAGGAAGCGGACGAACTCGGGGGCAAGGAGATAGCCAGGAGCCCCTCGGGCAGTGCCAATGAGGCAGAGGGCAAGGGCGAGAGCCAGCAGCAGGAGGGCATGCAGAACAAGCCCAAGAACAGCCTGGTgaagcccccctactcctacatcgcgctgatcaccatggccatcctgcagagcccccagaagaagctcaccctgagcggcatctgtgagttcatcagcaaccgcttcccctactatcgggagaagttcccggcctggcagaactccatccgccacaatctctcgcttaatgactgcttcgtcaaaatcccccgggagcccggaaacccaggcaagggaaactactggaccctggacccccagtccgaggacatgttcgacaatggcagtttcctCAAGAGAAGGAAGCGCTTTAAGAGACAACAGCCGGACTCAT
  5   1   2       bld Neu  5g3  in                   TNeu090j14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGAATTTAAAAGTGTCTGTGCGTCCCTTGTCAAGCGGCGGGCAGCAGCCAAGAGGGAGGGGGCGATGCACACGATTTGAAGGTAGGCACTCGCTGCAAGTTGACTACTACTTGCCCTGCCGAGCCTATTTCTCTTTCAGTGCCTGCCCATTGCCGAGGACCCGTAGCTGGAATGACCCTGTCACGCAACAGCAGTGGGAGCGACATGTCCGGCCAGACCGTGCTGAGCGCCGACTATGCGGACATCTATGTGGTGGGCGAGGGGGACGAGCCTCTGGACAATGACAGTGAGTGCGGGAGCCCACCCGGGCATGCGGAGGAAGCG
  5   1   2       bld Gas8 5g3  in                          st54h12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGGAATTTAAAGTGTCTGTGCGTCCCTTGTCAAGCAGCGGGCAGCAGCCAGGAGGGAGGGGGCGATGCACAGGATTTGAAGGTAGGCACTCGCTGCAAGTTGACTACTACTTGCCCTGCCGAGCCTATTTCTCTTTCGGTGCCTGCCCATTGCCGAGGACCCGTAGCTGGAATGACCCTGTCAGGCAGCAGCAGTGCCAGCGACATGTCCGGCCAGACCGTGCTGAGCGCCGACGATGCGGACATCGATGTGGTGGGCGAGGGGGACGAGCCGCTGGACAAGGACAGTGAGTGCGGGAGCCCAGCCGGGCATGCGGAGGAAGCGGACGAACTCGGGGGCAAGGAGATAGCCAGGAGCCCCTCGGGCAGTGCCAATGAGGCAGAGGGCAAGGGCGAGAGCCAGCAGCAGGAGGGCATGCAGAACAAGCCCAAGAACAGCCTGGTGAAGCCCCCCTACTCCTACATCGCGCTGATCACCATGGCCATCCTGCAGAGCCCCCAGAAGAAGCTCACCCTGAGCGGCATCTGTGAGTTCATCAGCAACCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCTGGCAGAACTCCATCCGCCACAATCTCTCGCTTAATGACTGCTTCGTCAAAATCCCCCGGGAGCCCGGAA
  5   1   2       bld Neu  5g3  in                   TNeu104g04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGAATTAAAAGTGTCTGTGCGTCCCTTGTCAAGCAGCGGGCAGCAGCCAGGAGGGAGGGGGCGATGCACAGGATTTGAAGGTAGGCACTCGCTGCAAGTTGACTACTACTTGCCCTGCCGAGCCTATTTCTCTTTCGGTGCCTGCCCATTGCCGAGGACCCGTAGCTGGAATGACCCTGTCAGGCAGCAGCAGTGCCAGCGACATGTCCGGCCAGACCGTGCTGAGCGCCGACGATGCGGACATCGATGTGGTGGGCGAGGGGGACGAGCCGCTGGACAAGGACAGTGAGTGCGGGAGCCCAGCCGGGCATGCGGAGGAAGCGGACGAACTCGGGGGCAAGGAGATAGCCAGGAGCCCCTCGGGCAGTGCCAATGAGGCAGAGGGCAAGGGCGAGAGCCAGCAGCAGGAGGGCATGCAGAACAAGCCCAAGAACAGCCTGGTgaagcccccctactcctacatcgcgctgatcaccatggccatcctgcagagcccccagaagaagctcaccctgagcgGCATCTGTGAGTTCATCAGCAACCG
  5   1   2       bld Neu  5g                        TNeu135n05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAATTTAAAAGTGTCTGTGCGTCCCTTGTCAAGCAGCGGGCAGCAGCCAGGAGGGAGGGGGCGATGCACAGGATTTGAAGGTAGGCACTCGCTGCAAGTTGACTACTACTTGCCCTGCCGAGCCTATTTCTCTTTCGGTGCCTGCCCATTGCCGAGGACCCGTAGCTGGAATGACCCTGTCAGGCAGCAGCAGTGCCAGCGACATGTCCGGCCAGACCGTGCTGAGCGCCGACGATGCGGACATCGATGTGGTGGGCGAGGGGGACGAGCCGCTGGACAAGGACAGTGAGTGCGGGAGCCCATCCGGGCATGCGGAGGAAGCGGACGAACTCGGGGGCAAGGAGATAGCCAGGAGCCCCTCGGGCAGTGCCAATGAGGCAGAGGGCAAGGGCGAGAGCCACAGCAGGAGGGCATGCAGAACAAGCCCAAGAACAGCCTGGTgaagcccccctactcctacatcgcgctgatcaccatggccatcctgcagagcccccagaagaagctcacCCTGAG
  5   1   2       bld Gas  5g                        TGas035o17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAATTTAAAATGTCTGTGCGTCCCTTGTCAAGCAGCGGGCAGCAGCCAGGAGGGAGGGGGCGATGCACAGGATTTGAAGGTAGGCACTCGCTGCAAGTTGACTACTACTTGCCCTGCCGAGCCTATTTCTCTTTCGGTGCCTGCCCATTGCCGAGGACCCGTAGCTGGAATGACCCTGTCAGGCAGCAGCAGTGCCAGCGACATGTCCGGCCAGACCGTGCTGAGCGCCGACGATGCGGACATCGATGTGGTGGGCGAGGGGGACGAGCCGCTGGACAAGGACAGTGAGTGCGGGAGCCCAGCCGGGCATGCGGAGGAAGCGGACGAACTCGGGGGCAAGGAGATAGCCAGGAGCCCCTCGGGCAGTGCCAATGAGGCAGAGGGCAAGGGCGAGAGCCAGCAGCAGGAGGGCATGCAGAACAAGCCCAAGAACAGCCTGGTgaagcccccctactcctacatcgcgctgatcaccatggccatcctgcagagcccccagaagaagctcaccctgagcggcatctgtgagttcatcagcaaccgcttcccctactatcgggagaagttcccggcctggcagaactccatccgccacaatctctcgcttaatgactgcttcgtcaaaatcccccg
  5   1   2       bld TpA  5g3  in                   TTpA007g23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAATTTAAAGTGTCTGTGCGTCCCTTGTCAGCAGCGGGCAGCAGCCAGGAGGGAGGGGGCGATGCACAGGATTTGAAGGTAGGCACTCGCTGCAAGTTGACTACTACTTGCCCTGCCGAGCCTATTTCTCTTTCGGTGCCTGCCCATTGCCGAGGACCCGTAGCTGGAATGACCCTGTCAGGCAGCAGCAGTGCCAGCGACATGTCCGGCCAGACCGTGCTGAGCGCCGACGATGCGGACATCGATGTGGTGGGCGAGGGGGACGAGCCGCTGGACAAGGACAGTGAGTGCGGGAGCCCAGCCGGGCATGCGGAGGAAGCGGACGAACTCGGGGGCAAGGAGATAGCCAGGAGCCCCTCGGGCAGTGCCAATGAGGCAGAGGGCAAGGGCGAGAGCCAGCAGCAGGAGGGCATGCAGAACAAGCCCAAGAACAGCCTGGTgaagcccccctactcctacatcgcgctgatcaccatggccatcctgcagagcccccagaagaagctcaccctgagcggcatctgtgagttcatcagcaaccgcttcccctactatcgggagaagttcccggcctggcagaactccatccgccacaatctctcgcttaatgactgcttcgtcaaaatcccccgggagcccggaaacccaggcaagggaaactactggaccctggacccccagtccgaggacatgttcgacaatggcagtttcctCAGGAGAAGGAAGCGCTTTAAGAGACAACAGCCGGACTCATTGAGGGAGCAGACGGCTCTCATGATGCAAAGCTTTGGGGCTTACAGCCTGGCCGGTCCCTATGGGCGCCCCTATGGGCTCCACCCTGCAGCCTACACTCACCCTGCTGCCCTGCAGTATCCTTACATCCCCC
  5   1   2       bld Neu  5g3  in                   TNeu099h16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAGTGTCTGTGCGTCCCTTGTCAAGCAGCGGGCAGCAGCCAGGAGGGAGGGGGCGATGCACAGGATTTGAAGGTAGGCACTCGCTGCAAGTTGACTACTACTTGCCCTGCCGAGCCTATTTCTCTTTCGGTGCCTGCCCATTGCCGAGGACCCGTAGCTGGAATGACCCTGTCAGGCAGCAGCAGTGCCAGCGACATGTCCGGCCAGACCGTGCTGAGCGCCGACGATGCGGACATCGATGTGGTGGGCGAGGGGGACGAGCCGCTGGACAAGGACAGTGAGTGCGGGAGCCCACCGGGCATGCGGAGGAAGCGGACGAACTCGGGGGCAAGGAGATAGCCAGGAGCCCCTCGGGCAGTGCCAATGAGGCAGAGGGCAAGGGCGAGAGCCACAGCAGGAGGGCATGCAGAACAAGCCCAAGAACAGCCTGGTgaagcccccctactcctacatcgcgctgatcaccatggccatcctgcagagcccccagaagaagctcaccctgagcgGCATCTGTGAGTTCATCAGCAACCGCTTCCCCTACTATCGGGAGAAGTTCCC
  5   1   2       bld Neu  FL   in                   TNeu088c09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGTGTCTGTGCGTCCCTTGTCAAGCAGCGGGCAGCAGCCAGGAGGGAGGGGGCGATGCACAGGATTTGAAGGTAGGCACTCGCTGCAAGTTGACTACTACTTGCCCTGCCGAGCCTATTTCTCTTTCGGTGCCTGCCCATTGCCGAGGACCCGTAGCTGGAATGACCCTGTCAGGCAGCAGCAGTGCCAGCGACAGTGTGCGGCCAGACCGTGCTGAGCGCCGACGATGCGGACATCGATGTGGTGGGCGAGGGGGACGAGCCGCTGGACAAGGACAGTGAGTGCGGGAGCCCACCGGGCATGCGGAGGAAGCGGACGAACTCTGGGGCAAGGAGATAGCCAGGAGCCCCTCGGGCAGTGCCAATGAGGCAGAGGGCAAGGGCGAGAGCCATCAGCAGGAGGGCATGCAGAACAAGCCCAAGAACAGCCTGGTgaagcccccctactcctacatcgcgctgatcaccatggccatcctgcagagcccccagaagaagctcaccctgagcgGCATCTGTGAGTTCATCAGCAACCGCTTCCCCTACTA
  5   1   2       bld Gas1 FL                            IMAGE:6988210                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGTGTCTGTGCGTCCCTTGTCAAGCAGCGGGCAGCAGCCAGGAGGGAGGGGGCGATGCACAGGATTTGAAGGTAGGCACTCGCTGCAAGTTGACTACTACTTGCCCTGCCGAGCCTATTTCTCTTTCGGTGCCTGCCCATTGCCGAGGACCCGTAGCTGGAATGACCCTGTCAGGCAGCAGCAGTGCCAGCGACATGTCCGGCCAGACCGTGCTGAGCGCCGACGATGCGGACATCGATGTGGTGGGCGAGGGGGACGAGCCGCTGGACAAGGACAGTGAGTGCGGGAGCCCAGCCGGGCATGCGGAGGAAGCGGACGAACTCGGGGGCAAGGAGATAGCCAGGAGCCCCTCGGGCAGTGCCAATGAGGCAGAGGGCAAGGGCGAGAGCCAGCAGCAGGAGGGCATGCAGAACAAGCCCAAGAACAGCCTGGTgaagcccccctactcctacatcgcgctgatcaccatggccatcctgcagagcccccagaagaagctcaccctgagcggcatctgtgagttcatcagcaaccgcttcccctactatcgggagaagttcccggcctggcagaactccatccgccacaatctctcgcttaatgactgcttcgtcaaaatcccccgggagcccggaaacccaggcaagggaaactactggaccctggacccccagtccgaggacatgttcgacaatggcagtttcctCAGGAGAAGGAAGCGCTTTTAGAGACAACAGCCGGGACTCATTGANGGGAGCAGACGGGCTCTCATGGATGCAAAGCTTTTGGGGGCTTACAGCCCTGGCCCGGGTCCCCTATGGGGCGGCCCCCTATGGGGGCTCCCACCCCTGGCAAGCCCTAACACCTCC
  5   1   2   14  bld Gas6 5g3  in                         ANBT2773.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCTGTGCGTCCCTTGTCAAGCAGCGGGCAGCAGCCAGGAGGGAGGGGGCGATGCACAGGATTTGAAGGTAGGCACTCGCTGCAAGTTGACTACTACTTGCCCTGCCGAGCCTATTTCTCTTTCGGTGCCTGCCCATTGCCGAGGACCCGTAGCTGGAATGACCCTGTCAGGCAGCAGCAGTGCCAGCGACATGTCCGGCCAGACCGTGCTGAGCGCCGACGATGCGGACATCGATGTGGTGGGCGAGGGGGACGAGCCGCTGGACAAGGACAGTGAGTGCGGGAGCCCAGCCGGGCATGCGGAGGAAGCGGACGAACTCGGGGGCAAGGAGATAGCCAGGAGCCCCTCGGGCAGTGCCAATGAGGCAGAGGGCAAGGGCGAGAGCCAGCAGCAGGAGGGCATGCAGAACAAGCCCAAGAACAGCCTGGTgaagcccccctactcctacatcgcgctgatcaccatggccatcctgcagagcccccagaagaagctcaccctgagcgGCATCTGTGAGTTCATCAGCAACCGCTTCCCCTACTATCGGGAGAAGTCCCCGGCCTGACAGAACTCCATCCGCCACAATCTCTCTCTTAATG
  5   1   2   14  bld Gas6 5g3  in                           ANBT85.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCTGTGCGTCCCTTGTCAAGCAGCGGGCAGCAGCCAGGAGGGAGGGGGCGATGCACAGGATTTGAAGGTAGGCACTCGCTGCAAGTTGACTACTACTTGCCCTGCCGAGCCTATTTCTCTTTCGGTGCCTGCCCATTGCCGAGGACCCGTAGCTGGAATGACCCTGTCAGGCAGCAGCAGTGCCAGCGACATGTCCGGCCAGACCGTGCTGAGCGCCGACGATGCGGACATCGATGTGGTGGGCGAGGGGGACGAGCCGCTGGACAAGGACAGTGAGTGCGGGAGCCCAGCCGGGCATGCGGAGGAAGCGGACGAACTCGGGGGCAAGGAGATAGCCAGGAGCCCCTCGGGCAGTGCCAATGAGGCAGAGGGCAAGGGCGAGAGCCAGCAGCAGGAGGGCATGCAGAACAAGCCCAAGAACAGCCTGGTgaagcccccctactcctacatcgcgctgatcaccatggccatcctgcagagcccccagaagaagctcaccctgagcgGCATCTGTGAGTTCATCAGCAACCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCtggcagaactccatccgccacaatctctcgcttaatgactgcttcgtcaaaatcccccgggagcccggaaacccaggcaagggaaactactggaccctggacccccagtccgaggacatgttcgacaatggcagtttcctCAGGAGAAGGAAGCGCTTTAAGAGACAACAGCCGGACTCATTGAGGGAGCAGACGGCTCTCATGATGCANAGCTNTGGGGCTTACAGCCTGGCCGGTCCCTATGGGCGCCCCTATGGGCTCCACCCTGCAGCCTACACTCACCCTGCTGCCCTGCAGTATCCTTACATCCCCCC
  5   1   2   10  bld Mus1 5g3  in                          CABH707.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGATTTGAAGGTAGGCACTCGCTGCAAGTTGACTACTACTTGCCCTGCCGAGCCTATTTCTCTTTCGGTGCCTGCCCATTGCCGAGGACCCGTAGCTGGAATGACCCTGTCAGGCAGCAGCAGTGCCAGCGACATGTCCGGCCAGACCGTGCTGAGCGCCGACGATGCGGACATCGATGTGGTGGGCGAGGGGGACGAGCCGCTGGACAAGGACAGTGAGTGCGGGAGCCCAGCCGGGCATGCGGAGGAAGCGGACGAACTCGGGGGCAAGGAGATAGCCAGGAGCCCCTCGGGCAGTGCCAATGAGGCAGAGGGCAAGGGCGAGAGCCAGCAGCAGGAGGGCATGCAGAACAAGCCCAAGAACAGCCTGGTgaagcccccctactcctacatcgcgctgatcaccatggccatcctgcagagcccccagaagaagctcaccctgagcgGCATCTGTGAGTTCATCAGCAACCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCtggcagaactccatccgccacaatctctcgcttaatgactgcttcgtcaaaatcccccgggagcccggaaacccaggcaagggaaactactggaccctggacccccagtccgaggacatgttcgacaatggcagtttcctCAGGAGAAGGAAGCGCTTTAAGAGACAACAGCCGGACTCATTGAGGGAGCAGACGGCTCTCATGATGCAAAGCTTTGGGGCTTACAGCCTGGCCGGTCCCTATGGGCGCCCCTATGGGCTCCACCCTGCAGCCTACACTCACCCTGCTGCCCTGCAGTATCCTTACAT
  5   1   2       bld Gas7      in                         XZG31316.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGACGAGCCGCTGGACAAGGACAGTGAGTGCGGGAGCCCAGCCGGGCATGCGGAGGAAGCGGACGAACTCGGGGGCAAGGAGATAGCCAGGAGCCCCTCGGGCAGTGCCAATGAGGCAGAGGGCAAGGGCGAGAGCCAGCAGCAGGAGGGCATGCAGAACAAGCCCAAGAACAGCCTGGTgaagcccccctactcctacatcgcgctgatcaccatggccatcctgcagagcccccagaagaagctcaccctgagcgGCATCTGTGAGTTCATCAGCAACCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCtggcagaactccatccgccacaatctctcgcttaatgactgcttcgtcaaaatcccccgggagcccggaaacccaggcaagggaaactactggaccctggacccccagtccgaggacatgttcgacaatggcagtttcctCAGGAGAAGGAAGCGCTTTAAGAGACAACAGCCGGACTCATTGAGGGAGCAGACGGCTCTCATGATGCAAAGCTTTGGGGCTTACAGCCTGGCCGGTCCCTATGGGCGCCCCTATGGGCTCCACCCTGCAGCCTACACTCACCCTGCTGCCCTGCAGTATCCTTACATCCCCCCGGTGGGGCCCATGTTACCCCCGGCGGTGCCACTTCTGCCTTCCTCTGAACTGAGCAGGAAAGCCTTCAGCTCGCAGCTCAGCCCCAGCCTCCAGCTGCAGCTCAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTCTGAGCCCAGCAGCCGACCCTCCTTCAGCAT
  5   1   2       bld Gas8      in                          st40n22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCATGCANAACAAGCCCAAGAACAGCCTGGTGAAGCCCCCCTACTCCTACATCGCGCTGATCACCATGGNCATCCTGCAGAGCCCCCAGAAGAAGNTCACCCTGAGCGGCATCTGTGANTTCATCAGCAACCGCTTCCCCTACTATCGGGAG
  3  -1   2       bld Brn4 5g   out                        CAAL9538.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TcgccacaatctctcgcttaatgactgcttcgtcaaaatcccccgggagcccggaaacccaggcaagggaaactactggaccctggacccccagtccgaggacatgttcgacaatggcagtttcctCAGGAGAAGGAAGCGCTTTAAGAGACAACAGCCGGACTCATTGAGGGAGCAGACGGCTCTCATGATGCAAAGCTTTGGGGCTTACAGCCTGGCCGGTCCCTATGGGCGCCCCTATGGGCTCCACCCTGCAGCCTACACTCACCCTGCTGCCCTGCAGTATCCTTACATCCCCCCGGTGGGGCCCATGTTACCCCCGGCGGTGCCACTTCTGCCTTCCTCTGAACTGAGCAGGAAAGCCTTCAGCTCGCAGCTCAGCCCCAGCCTCCAGCTGCAGCTCAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTCTGAGCCCAGCAGCCGACCCTCCTTCAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATNTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAG
  5   1   2       bld Neu       in                   TNeu107f01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAGCAGACGGCTCTCATGATGCAAAGCTTTGGGGCTTACAGCCTCTCCGGTCCCTATGGGCGCCCCTATGGGCTCCACCCTGCAGCCTACACTCACCCTGCTGCCCTGCAGTATCCTTACATCCCCCCGGTGGGGCCCATGTTACCCCCGGCGGTGCCACTTCTGCCTTCCTCTGAACTGAGCAGGAAAGCCTTCAGCTCGCAGCTCAACCCCAGCCTCCAGCTGCAGCTCAACAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTCTGAGCCCAGCAGCCGACCCTCCTTCAGCATAAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAAACTTTCCTGCGACCCCCATGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTATTATGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACACACGGCTGCAGTACCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTACAATTTGCAAACCACTTCTTTTACTA
  3   1   2       bld Neu  5g3  in                    TNeu104g04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAGACGGCTCTCATGATGCAAAGCTTTGGGGCTTACAGCCTGGCCGGTCCCTATGGGCGCCCCTATGGGCTCCACCCTGCAGCCTACACTCACCCTGCTGCCCTGCAGTATCCTTACATCCCCCCGGTGGGGCCCATGTTACCCCCGGCGGTGCCACTTCTGCCTTCCTCTGAACTGAGCAGGAAAGCCTTCAGCTCGCAGCTCAGCCCCAGCCTCCAGCTGCAGCTCAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTCTGAGCCCAGCAGCCGACCCTCCTTCAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAAAAAAAAAAAA
  5   1   2      seed Gas7      in                         XZG63996.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACCCTGCAGCCTACACTCACCCTGCTGCCCTGCAGTATCCTTACATCCCCCCGGTGGGGCCCATGTTACCCCCGGCGGTGCCACTTCTGCCTTCCTCTGAACTGAGCAGGAAAGCCTTCAGCTCGCAGCTCAGCCCCAGCCTCCAGCTGCAGCTCAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTCTGAGCCCAGCAGCCGACCCTCCTTCAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAATGAATATATATGTATTATAAATGTTATTCCATCGTGTTGTACACAGTTTTGTAAATAAATTTTTTAAAATGGTAAA
  3   1   2       bld Gas6 5g3  in                           ANBT85.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGCCTACACTCACCCTGCTGCCCTGCAGTATCCTTACATCCCCCCGGTGGGGCCCATGTTACCCCCGGCGGTGCCACTTCTGCCTTCCTCTGAACTGAGCAGGAAAGCCTTCAGCTCGCAGCTCAGCCCCAGCCTCCAGCTGCAGCTCAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTCTGAGCCCAGCAGCCGACCCTCCTTCAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAATGAATATATATGTATTATAAATGTTATTCCATCGTGTTGTACACAGTTTTGTAAATAAATTTTTAAAATG
  3   1   2       bld Neu       in                    TNeu107f01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGGGCCCATGTTACCCCCGGCGGTGCCACTTCTGCCTTCCTCTGAACTGAGCAGGAAAGCCTTCAGCTCGCAGCTCAGCCCCAGCCTCCAGCTGCAGCTCAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTCTGAGCCCAGCAGCCGACCCTCCTTCAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAATGAATATATATGTATTATAAATGTTATTCCATCGTGTTGTACACAGTTTTGTAAATAAATTTTTAAAATGGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Mus1 5g3  in                          CABH707.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCTTCCTCTGAACTGAGCAGGAAAGCCTTCAGCTCGCAGCTCAGCCCCAGCCTCCAGCTGCAGCTCAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTCTGAGCCCAGCAGCCGACCCTCCTTCAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAATGAATATATATGTATTATAAATGTTATTCCATCGTGTTGTACACAGTTTTGTAAATAAATTTTTTAAAATGGTCAAAAAAAA
  3   1   2       bld TbA  5g3  in                    TTbA069c06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAACTGAGCAGGAAAGCCTTCAGCTCGCAGCTCAGCCCCAGCCTCCAGCTGCAGCTCAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTTTGAGCCCAGCAGCCGACCCTCCTTCAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTTTGGACAGTTTTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATTTTTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTATTAAAAGCCAAGACTGAAGACTTTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGATTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAATGAATATATATGTATTATAAATGTTATTCCATCGTGTTGTACACAGTTTTGTAAATAAATTTTTTAAAGGAAAAAAAAAAAAAAAAAAAAAGCGC
  3   1   2       bld Gas6 5g3  in                         ANBT2773.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAACTGAGCAGGAAAGCCTTCAGCTCGCAGCTCAGCCCCAGCCTCCAGCTGCAGCTCAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTCTGAGCCCAGCAGCCGACCCTCCTTCAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAATGAATATATATGTATTATAAATGTTATTCCATCGTGTTGTACACAGTTTTGTAAATAAATTTTTTAAAATGG
  3   1   2       bld Gas7      in                         XZG31316.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAACTGAGCAGGAAAGCCTTCAGCTCGCAGCTCAGCCCCAGCCTCCAGCTGCAGCTCAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTCTGAGCCCAGCAGCCGACCCTCCTTCAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAATGAATATATATGTATTATAAATGTTATTCCATCGTGTTGTACACAGTTTTGTAAATAAATTTTTTAAAATGGTAAAAAAAAAAAAAAAGG
  3   1   2       bld Tad5 5g3  in                         XZT37586.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAACTGAGCAGGAAAGCCTTCAGCTCGCAGCTCAGCCCCAGCCTCCAGCTGCAGCTCAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTCTGAGCCCAGCAGCCGACCCTCCTTCAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCACTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAATGAATATATATGTATTATAAATGTTATTCCATCGTGTTGTACACAGTTTTGTAAATAAATTTTTTAAAATGGTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7      in                         XZG63996.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGCTCAGCCCCAGCCTCCAGCTGCAGCTCAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTCTGAGCCCAGCAGCCGACCCTCCTTCAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAATGAATATATATGTATTATAAATGTTATTCCATCGTGTTGTACACAGTTTTGTAAATAAATTTTTTAAAATGGT
  3   1   2       bld Neu  5g3  in                    TNeu099h16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCCCAGCCTCCAGNTGCAGCTCAGCAGCCTCAGCAGTACCGCAGCTTCCATCATTAAGTCTGAGCCCAGCAGCCGACCCTCTTTCAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAATGAATATATATGTATTATAAATGTTATTCCATCGTGTTGTACACAGTTTTGTAAATAAATTTTTTAAAATGGTAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA  5g3  in                    TTbA069f07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCCCAGCCTCCAGNTGCAGGTCAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTTTGAGCCCAGCAGCCGACCCTCCTTTAGCATAGAGAACATTATTGGGGTATTGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATTTTAAGTGTCCCCCCAAACCTCATTTTTGGACAGTTTTTACCTACAGCAGCGGGTGCAGTAGCCAAATGGCCAGCGCAATAATTTTTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTTTTTTTTTAAAAGCCAAGACTGAAGACTTTGATTGAACTTTTTTTGTTAAACTGTACAAATTTGGAATGCATTTTGTGCAGGTAACACGTCGACTATTTGTACATATTTTTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATTTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTTTCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAATGAATATATATGTATTATAAATGTTATTCCCTCGTGTTGTACCCAGTTTTGTAAATAAATTTTTTAAAATGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Gas8 5g3  in                          st39n22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCCAGCCTCCAGCTGCAGCTCAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTCTGAGCCCAGCAGCCGACCCTCCTTCAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAATGAATATATATGTATTATAAATGTTATTCCATCGTGTG
  3   1   2       bld Gas8 5g3  in                          st54h12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCAGCCTCCAGGTTGCAGCTCAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTCTGAGCCCAGCAGCCGACCCTCCTTCAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAATGAATATATATGTATTATAAATGT
  3  -1   2       bld Gas5                                  XZF1827.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCGCTCAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTCTGAGCCCAGCAGCCGACCCTCCTTCAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAATGAATATATATGTATTATAAATGTTATTCCATCGTGTTGTACACAGTTTTGTAAATAAATTTTTTAAAATGGCCAAAAAAAAAAAAAAAAAA
  3  -1   2       bld Gas5                                  XZF1643.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTCAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTCTGAGCCCAGCAGCCGACCCTCCTTCAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAATGAATATATATGTATTATAAATGTTATTCCATCGTGTTGTACACAGTTTTGTAAATAAATTTTTTAAAATGGCCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu  FL   in                    TNeu088c09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGCAGCCTCAGCAGTACCGCAGCCTCCATCATTAAGTTTGAGCCCAGCAGCCGACCCTCCTTCAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAATGAATATATATGTATTATAAATGTTATTCCATCGTGTTGTACACAGTTTTGTAAATAAATTTTTTAAAATGGTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu  5g3  in                    TNeu090j14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCATTAAGTTTGAGCCCAGCAGCCGACCNTCTTCTAGCATAGAGAACATTATTGGGGTATCGGCAGCCTCCTCGATAGCACCCCAGACTGTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAATGAATATATATGTATTATAAATGTTATTCCATCGTGTTGTACACAGTTTTGTAAATAAATTTTTTAAAACGGAAAAAAAAGAAAAAAAAA
  3   1   2       bld Gas8      in                          st30o23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAAT
  3   1   2       bld Gas8      in                          st31o23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGCCTCCTCGATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCNCNCAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATA
  5   1   2       bld Gas8      in                          st30o23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATAGCACCCCAGACTTTCCTGCGACCCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCACCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATCTTAAGTGTCCCCACAAACCTCATCTCTGGACAGTTCTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTCTTTTACTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAAAAA
  3   1   2       bld TpA  5g3  in                    TTpA007g23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCCAGTGACAGTGCAGTCAGCCCTTATGAGCCCCCAGCCCCTGGCCCTTAGTAGGAGCACAGCAGCCATTGGCCCAATTTTAAGTGTCCCCCCAAACCTCATTTTTGGACAGTTTTTACCTACAGCAGCGGCTGCAGTAGCCAAATGGCCAGCGCAATAATTTTTGGGGCAATCCCAGATTAGCAATTTGCAAACCAGCTTTTTTTTTTAAAAGCCAAGACTGAAGACTTTGATTGAACTTTTTTTGTTAAACTGTACAAATTTGGAATGCATTTTGTGCAGGTAACACGTCGACTATTTGTACATATTTTTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATTTGTAGATTAGACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCCCAAATGTACAAAGGAAATTAAATTTTAAATATTCCATTTTCAAATAAATAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAAGGAATATATATGTATTATAAATGTTATTCCATCGTGTTGTACCCAGTTTTGTAAATAAATTTTTTAAAATGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas8      in                          st40n22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCCAAATGGCCAGCGCAATAATCTCTGGGGCAATCACAGACTAGCAATTTGCAAACCAGCTTNTTTTNCTAAAAGCCAAGACTGAAGACTCTGATTGAACTTTTCTTGTTAAACTGTACAAATCTGGAATGCATTCTGTGCAGGTAACACGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTANGTAATGGGTTTTTATTTTTNNAAGAAAAAAATCTGTAGATTAGACTACTGAGCTNTCAGTTTTTTNGAAGGCTTACTATCCCTTTATCACAAANGTACAAAGGAAATTNAATTTTAAACTATTACATTTTCNANTAANTAAAAAATGTCATTATATTAAAAAAGTCTGTTTATATATGAANGAATATNTATGT
  5   1   2       bld Gas8      in                          st31o23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACTCTGATTGAACTTTTCNTGTNCAACTGTACAAATCTGGANTGCATTCTGTGCAGGTAACNCGTCGACTATTTGTACATATTTCTATTGGAAAAAGAGAATTGATCGAGTTTACGTAATGGGTTTTTATTTTTTTAAGAAAAAAATCTGTAGATTANACTACTGAGCTTTCAGTTTTTTTGAAGGCTTACTATCCCTTTATCACAAATGTACAAAGGAAATTAAATTTTAAATATTACATTTTCAAATAAATAAAAGATGTCATTATATTAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)