Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA076d23.5                         63 END     1           2        1                Similar to p47 (rat) [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012074950 Xt7.1-CABI11758.3 - 47 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABI11758.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGCGTCCTATCGGGTGCTGAGCCGGTTGCTAGGCTGCGCTCCTGAGGCGGAGGACGCTGCAAGACCCCGGCTAATGGTGTTCCGGAACATGCTGAGAGGAGAGGAGGAGGGGGGAGAGGCCGCTCCGGAGCCCGAGGCTCTAGTGGAAGCGCTGCCTGCTGAAGGGAGCCCCCAGTCGGCGGAGCTGTGTAACCGGCACCGCAAGGCCGCGCAGCCCGGGCTGGGGCTGGAACTGCAACTGGGGGCCCTGGGACTGCGGGGGGCCGGCTGCCCCTGTGAGGAGACCAGCGATGCGCTGTTAGTGCTGGAAGCGCCGGAGGCCCGCCGGCTGGAGGAACAGGAGGAAGGGGAGGCAGCGGGACAGGCCCCGAGCAGGAGGGCCCAGAACAGGAAGGCCTCCCTGCGGAACCGACTCTCCAGGATCTTCCGCACCAAGAGCTGCGCCGGGCCCCCAGGAACTGCTGAGAGAGAGCTGGGGGGCTCCGGGGGGAGTCTGACTGACATGTCCCGGGACAGAGAGTTGGAGCTTGGCAGGAAGCCGCGATTGACCAGAACTCAAAGTGCCTTTTCTCCAGTCTCCTTCAGTCCGCTCTTCACTGGTGAAACGGTGTCGCTTGTGGACGTGGACATTTCACAGAGAGGATCCTCCTCTACACATCCTCCCACTCCCCCTCCGCCTCCCCGTAGGAGCCTCAGCCTTTTAGATGACATTGGTGGAATTCAACCAGCGTCTGTTCTAGTGGGACCCATGGGATCCTCTCTGCAGTCTTTCCCACTGCCCCCACCTCCTCCTCCACATGCCCCAGAACCTTTACCACGCTTGGTTCCGCTAAGACCAACTGAGTGTGTCCCAGTTCCACTGGTGCAGCCGCTGCAGTGCCCCCTATTTAAACAGGACCCTAGTAGCTTTGCTGCCAGCCTGCGGGAGCTTGAGAAGTGTGGTTGGTACTGGGGTCCAATGAACTGGGAGGATGCAGAAATGAAGCTGAAGGCGAAACCAGACGGCTCCTTTCTGGTGCGAGATAGTTCAGACCCTCGGTACATTCTGAGTCTGAGTTTCCGATCACAGGGCATCACCCACCACACACGCATGGAGCACTATAGAGGCACATTCAGCCTCTGGTGCCACCCGAAGTTTGAGGATCGTTGTCAGTCGGTAGTGGAGTTTATTAAACGTGCCATCATGCACTCTAAGAATGGGAAGTTCCTGTATTTTCTTCGCTCGCGAGTACCAGGTCTCCCCCCTACCCCAGTTCAGCTTTTGTACCCCGTTTCCCGCTTCAGCAATGTGAAGTCCCTGCAGCACTTGTGCCGCTTTCGTATTCGGCAGCTGGTCCGGATCGACCACATTCCAGAGCTCCCACTACCCAAACCCCTCATCTCATACCTGCGCAAGTTCTATTATTACGACCCCCAGGAGGAGGTATACCTTTGTCTAAAGGAGGCGCGGCATCTGAACAAATTGGAGTCTGGGAGCGAGAGCTCCACGTAGCGAGGATTCCGCGCTTTCCCTCTTCATAGGCCGAACCAGGATGCAGAATGCTGAGCAAGAGAACAATGGATGACCCTGGGGATGCTTGAATTAGAGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATTGCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAAGGTCAGGGGAATTGGCATTCTGTTCTCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACGGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCACGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTTATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGGACTGATACCTTTCATCCATTTCACAGGACTAAAACAAA
                                                  Xt7.1-CHK-1008226046                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTATCGGGTGCTGAGCCGGTTGCTAGGCTGCGCTCCTGAGGCGGAGGACGCTGCAAGACCCCGGCTAATGGTGTTCCGGAACATGCTGAGAGGAGAGGAGGAGGGGGGAGAGGCCGCTCCGGAGCCCGAGGCTCTAGTGGAAGCGCTGCCTGCTGAAGGGAGCCCCCAGTCGGCGGAGCTGTGTAACCGGCACCGCAAGGCCGCGCAGCCCGGGCTGGGGCTGGAACTGCAACTGGGGGCCCTGGGACTGCGGGGGGCCGGCTGCCCCTGTGAGGAGACCAGCGATGCGCTGTTAGTGCTGGAAGCGCCGGAGGCCCGCCGGCTGGAGGAACAGGAGGAAGGGGAGGCAGCGGGACAGGCCCCGAGCAGGAGGGCCCAGAACAGGAAGGCCTCCCTGCGGAACCGACTCTCCAGGATCTTCCGCACCAAGAGCTGCGCCGGGCCCCCAGGAACTGCTGAGAGAGAGCTGGGGGGCTCCGGGGGGAGTCTGACTGACATGTCCCGGGACAGAGAGTTGGAGCTTGGCAGGAAGCCGCGATTGACCAGAACTCAAAGTGCCTTTTCTCCAGTCTCCTTCAGTCCGCTCTTCACTGGTGAAACGGTGTCGCTTGTGGACGTGGACATTTCACAGAGAGGATCCTCCTCTACACATCCTCCCACTCCCCCTCCGCCTCCCCGTAGGAGCCTCAGCCTTTTAGATGACATTGGTGGAATTCAACCAGCGTCTGTTCTAGTGGGACCCATGGGATCCTCTCTGCAGTCTTTCCCACTGCCCCCACCTCCTCCTCCACATGCCCCAGAACCTTTACCACGCTTGGTTCCGCTAAGACCAACTGAGTGTGTCCCAGTTCCACTGGTGCAGCCGCTGCAGTGCCCCCTATTTAAACAGGACCCTAGTAGCTTTGCTGCCAGCCTGCGGGAGCTTGAGAAGTGTGGTTGGTACTGGGGTCCAATGAACTGGGAGGATGCAGAAATGAAGCTGAAGGCGAAACCAGACGGCTCCTTTCTGGTGCGAGATAGTTCAGACCCTCGGTACATTCTGAGTCTGAGTTTCCGATCACAGGGCATCACCCACCACACACGCATGGAGCACTATAGAGGCACATTCAGCCTCTGGTGCCACCCGAAGTTTGAGGATCGTTGTCAGTCGGTAGTGGAGTTTATTAAACGTGCCATCATGCACTCTAAGAATGGGAAGTTCCTGTATTTTCTTCGCTCGCGAGTACCAGGTCTCCCCCCTACCCCAGTTCAGCTTTTGTACCCCGTTTCCCGCTTCAGCAATGTGAAGTCCCTGCAGCACTTGTGCCGCTTTCGTATTCGGCAGCTGGTCCGGATCGACCACATTCCAGAGCTCCCACTACCCAAACCCCTCATCTCATACCTGCGCAAGTTCTATTATTACGACCCCCAGGAGGAGGTATACCTTTGTCTAAAGGAGGCGCGGCATCTGAACAAATTGGAGTCTGGGAGCGAGAGCTCCACGTAGCGAGGATTCCGCGCTTTCCCTCTTCATAGGCCGAACCAGGATGCAGAATGCTGAGCAAGAGAACAATGGATGACCCTGGGGATGCTTGAATTAGAGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATTGCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAAGGTCAGGGGAATTGGCATTCTGTTCTCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACGGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCACGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTTATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGGACTGATACCTTTCATCCATTTCACAGGACTAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     4     4     4     4     4     4     4     4     5     5     5     5     5     5     6     6     6     6     5     5     6     6     6     7     6     7     6     7     7     8     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     9     9     9     9     9     9     8     9     8     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     6     7     6     7     6     7     6     7     6     7     5     6     6     7     6     7     6     7     5     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     6     5     6     5     6     5     6     5     6     5     6     5     6     4     5     5     6     5     6     5     6     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     5     5     5     5     5     5     5     5     5     6     5     6     5     6     7     7     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     8     9    11    11    15    15    16    17    18    19    17    19    18    19    18    20    19    20    19    20    20    21    20    21    21    21    23    23    23    23    24    24    24    24    24    24    26    26    25    25    25    25    25    25    24    25    24    25    24    25    24    25    23    25    24    25    25    26    25    26    24    26    25    28    26    28    25    28    24    27    23    27    23    27    24    27    24    27    24    27    24    27    24    27    25    27    25    27    25    27    25    27    24    26    24    26    24    25    24    25    24    25    24    25    24    25    24    25    24    25    25    26    25    26    25    26    25    26    25    26    24    26    23    25    22    24    22    23    19    21    20    20    19    19     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------A
                                               BLH MIN      41     106                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ce ---- 3e-013     NP_493574.2 F39B2.5 [Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 3e-039     NP_523390.2 Suppressor of Cytokine Signaling at 16D CG8146-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ci ---- 1e-040     BAE06703.1 suppressor of cytokine signaling [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Xl ---- 4e-040     AAH77367.1 Socs6-prov protein [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Xt ---- 4e-040     AAI35384.1 Unknown (protein for MGC:121385) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 2e-065     XP_001191193.1 PREDICTED: similar to SOCS7 protein [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Gg ---- 3e-139     XP_423895.2 PREDICTED: similar to SH2 domain containing SOCS box protein SOCS7 [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Dr ---- 7e-148     XP_684929.1 PREDICTED: similar to suppressor of cytokine signaling 7 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                     PREDICTED - ?? ---- 7e-148     XP_698923.1 PREDICTED: similar to suppressor of cytokine signaling 7 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Hs ---- 3e-177     XP_941665.2 PREDICTED: similar to Suppressor of cytokine signaling 7 (SOCS-7) (Nck, Ash and phospholipase C gamma-binding protein) (Nck-associated protein 4) (NAP-4) [Homo sapiens] ----------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 4e-180     NP_619598.1 Nck, Ash and phospholipase C binding protein; SH2 domain containing SOCS boxprotein SOCS7 [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABI11758.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------TGA---------------ATG---------ATG------------------------------TAG---------------------------------------------------------------------------------------------------------------------TAG------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------TAATGA---------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  5   1   2       chi Te1       in                         CBWN1087.b1                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTGGATTTGAATGGTCACCTCAAGTTAGAAAAAAAGCAAAGATTGGATTGGTTGCTATGGGCTACATAACAGGTGATGTGGGCTTGCACACTATAATAAATATGCCATTATTTCTTATCTTGGAACATAGTTGGTCTGTAAAATTTCATGGGCATTACCTGGATTCATACAAGAGAATTTCCGCAGGTGTTTGGGCAGCACTTCCATCCCTGTTCACAGCCTGTGTCCTCAGTACATTCCCTGCCACAAATTCCAAGGGTTCCATCTCTTACTTCGGGGCAGGAAGTGGCATTTCCTGGTCAGAGGGATGAAATAATGCCACACCTTATAGTTCAGACTGCTCGTAGGTAAACATGTCTAAATCTAATAAAGCTTGTCTGCACCACCACCCAGGGGGACTACTGTGGTCTCTAAGGAAGAACTGTTGACATTAAAAGGGTGGTTCACCTTTAAAGGACAACTATAACCCTAAACAATGTAGGTCTCTATAAAAATATATTGCATAAAGAAGCTCATATGTAAAACTCTGCTTCATTTAAATAAACCATTTTCATAAAAAAAAAAAAAAAGGGCGGCCGCGTCCTATCGGGTGCTGAGCCGGTTGCTAGGCTGCGCTCCTGAGGCGGAGGACGCTGCAAGACCCCGGCTAATGGTGTTCCGGAACATGCTGAGAGGAGAGGAGGAGGGGGGAGAGGCCGCT
  5   1   2       bld Gas8      in                          st70k12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGGCTCCGATGAGGGAGCTGCCAGGGATCGGGGAGCGGAGCTGGGAGAGGCCGAGGCTCGGGCCGGGGCCCGTAGAGCCACCGGGGACATGCGAGGGGCAGCGGCGGAGGAGGAGGCGGCCGCGTCCTATCGGGTGCTGAGCCGGTTGCTAGGCTGCGCTCCTGAGGCGGAGGACGCTGCAAGACCCCGGCTAATGGTGTTCCGGAACATGCTGAGAGGAGAGGAGGAGGGGGGAGAGGCCGCTCCGGAGCCCGAGGCTCTAGTGGAAGCGCTGCCTGCTGAAGGGAGCCCCCAGTCGGCGGAGCTGTGTAACCGGCACCGCAAGGCCGCGCAGCCCGGGCTGGGGCTGGAACTGCAACTGGGGGCCCTGGGACTGCGGGGGGCCGGCTGCCCCTGTGAGGAGACCAGCGATGCGCTGTTAGTGCTGGAAGCGCCGGAGGCCCGCCGGCTGGAGGAACAGGAGGAAGGGGAGGCAGCGGGACAGGCCCCGAGCAGGAGGGCCCAGAACAGGAAGGCCTCCCTGCGGAACCGACTCTCCAGGATCTTCCGCACCAAGAGCTGCGCCGGGCCCCCAGGAACTGCTGAGAGAGAGCTGGGGGGCTCCGGGGGGAGTCTGACTGACATGTCCCGGGACAGAAAGTTGGAGCTTGGCAGGAANCCNCGATTGACCANAACTCAAAGTGCCTTTTCTCCNTCTCCTTCANTCCGCTCTTCAC
  3  -1   2       bld Te5       out                        CAAO8384.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCCTATCGGGTGCTGAGCCGGTTGCTAGGCTGCGCTCCTGAGGCGGAGGACGCTGCAAGACCCCGGCTAATGGTGTTCCGGAACATGCTGAGAGGAGAGGAGGAGGGGGGAGAGGCCGCTCCGGAGCCCGAGGCTCTAGTGGAAGCGCTGCCTGCTGAAGGGAGCCCCCAGTCGGCGGAGCTGTGTAACCGGCACCGCAAGGCCGCGCAGCCCGGGCTGGGGCTGGAACTGCAACTGGGGGCCCTGGGACTGCGGGGGGCCGGCTGCCCCTGTGAGGAGACCAGCGATGCGCTGTTAGTGCTGGAAGCGCCGGAGGCCCGCCGGCTGGAGGAACAGGAGGAAGGGGAGGCAGCGGGACAGGCCCCGAGCAGGAGGGCCCAGAACAGGAAGGCCTCCCTGCGGAACCGACTCTCCAGGATCTTCCGCACCAAGAGCTGCGCCGGGCCCCCAGGAACTGCTGAGAGAGAGCTGGGGGGCTCCGGGGGGAGTCTGACTGACATGTCCCGGGACAGAGAGTTGGAGCTTGGCAGGAAGCCGCGATTGACCAGAACTCAAAGTGCCTTTTCTCCAGTCTCCTTCAGTCCGCTCTTCACTGGTGAAACGGTGTCGCTTGTGGACGTGGACATTTCACAGAGAGGATCCTCCTCTACACATCCTCCCACTCCCCCTCCGCCTCCCCGTAGGAGCCTCAGCCTTTTAGATGACATTGGTGGAATTCAACCAGCGTCTGTTCTAGTGGGACCCATGGGATCCTCTCTGCAGTCTTTCCCACTGCCCCCACCTCCTCCTCA
  3  -1   2       bld Eye       in                         CCAX4233.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCCTATCGGGTGCTGAGCCGGTTGCTAGGCTGCGCTCCTGAGGCGGAGGACGCTGCAAGACCCCGGCTAATGGTGTTCCGGAACATGCTGAGAGGAGAGGAGGAGGGGGGAGAGGCCGCTCCGGAGCCCGAGGCTCTAGTGGAAGCGCTGCCTGCTGAAGGGAGCCCCCAGTCGGCGGAGCTGTGTAACCGGCACCGCAAGGCCGCGCAGCCCGGGCTGGGGCTGGAACTGCAACTGGGGGCCCTGGGACTGCGGGGGGCCGGCTGCCCCTGTGAGGAGACCAGCGATGCGCTGTTAGTGCTGGAAGCGCCGGAGGCCCGCCGGCTGGAGGAACAGGAGGAAGGGGAGGCAGCGGGACAGGCCCCGAGCAGGAGGGCCCAGAACAGGAAGGCCTCCCTGCGGAACCGACTCTCCAGGATCTTCCGCACCAAGAGCTGCGCCGGGCCCCCAGGAACTGCTGAGAGAGAGCTGGGGGGCTCCGGGGGGAGTCTGACTGACATGTCCCGGGACAGAGAGTTGGAGCTTGGCAGGAAGCCGCGATTGACCAGAACTCAAAGTGCCTTTTCTCCAGTCTCCTTCAGTCCGCTCTTCACTGGTGAAACGGTGTCGCTTGTGGACGTGGACATTTCACAGAGAGGATCCTCCTCTACACATCCTCCCACTCCCCCTCCGCCTCCCC
  5   1   2       bld Te4       in                        CAAN11929.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCAAGACCCCGGCTAATGGTGTTCCGGAACATGCTGAGAGGAGAGGAGGAGGGGGGAGAGGCCGCTCCGGAGCCCGAGGCTCTAGTGGAAGCGCTGCCTGCTGAAGGGAGCCCCCAGTCGGCGGAGCTGTGTAACCGGCACCGCAAGGCCGCGCAGCCCGGGCTGGGGCTGGAACTGCAACTGGGGGCCCTGGGACTGCGGGGGGCCGGCTGCCCCTGTGAGGAGACCAGCGATGCGCTGTTAGTGCTGGAAGCGCCGGAGGCCCGCCGGCTGGAGGAACAGGAGGAAGGGGAGGCAGCGGGACAGGCCCCGAGCAGGAGGGCCCAGAACAGGAAGGCCTCCCTGCGGAACCGACTCTCCAGGATCTTCCGCACCAAGAGCTGCGCCGGGCCCCCAGGAACTGCTGAGAGAGAGCTGGGGGGCTCCGGGGGGAGTCTGACTGACATGTCCCGGGACAGAGAGTTGGAGCTTGGCAGGAAGCCGCGATTGACCAGAACTCAAAGTGCCTTTTCTCCAGTCTCCTTCAGTCCGCTCTTCACTGGTGAAACGGTGTCGCTTGTGGACGTGGACATTTCACAGAGAGGATCCTCCTCTACACATCCTCCCACTCCCCCTCCGCCTCCCCGTAGGAGCCTCAGCCTTTTAGATGACATTGGTGGAATTCAACCAGCGTCTGTTCTAGTGGGACCCATGGGATCCTCTCTGCAGTCTTTCCCACTGCCCCCACCTCCTCCTCCACATGCCCCA
  3  -1   2       bld Tail                                 CBSW9066.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAGGAGAGGAGGAGGGGGGAGAGGCCGCTCCGGAGCCGGAGGCTCTCGTGGAAGCGCTGCCTGCTGAAGGGAGCCCCCAGTCGGCGGAGCTGTGTAACCGGC
  5   1   2       bld Egg       in                   TEgg004g24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGCCCGAGGCTCTAGTGGAAGCGCTGCCTGCTGAAGGGAGCCCCCAGTCGGCGGAGCTGTGTAACCGGCACCGCAAGGCCGCGCAGCCCGGGCTGGGGCTGGAACTGCAACTGGGGGCCCTGGGACTGCGGGGGGCCGGCTGCCCCTGTGAGGAGACCAGCGATGCGCTGTTAGTGCTGGAAGCGCCGGAGGCCCGCCGGCTGGAGGAACAGGAGGAAGGGGAGGCAGCGGGACAGGCCCCGAGCAGGAGGGCCCAGAACAGGAAGGCCTCCCTGCGGAACCGACTCTCCAGGATCTTCCGCACCAAGAGCTGCGCCGGGCCCCCAGGAACTGCTGAGAGAGAGCTGGGGGGCTCCGGGGGGAGTCTGACTGACATGTCCCGGGACAGAGAGTTGGAGCTTGGCAGGAAGCCGCGATTGACCAGAACTCAAAGTGCCTTTTCTCCAGTCTCCTTCAGTCCGCTCTTCACTGGTGAAACGGTGTCGCTTGTGGACGTGGACATTTCACAGAGAGGATCCTCCTCTACACATCCTCCTACTCCCCCTCCGCCTCCCCGTAGGAGCCTCAGCCTTTTAGATGACATTGGTGGAATTCAACCAGCGTCTGTTCTAGTGGGACCCA
  5   1   2       bld Tad5      in                         XZT52234.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATGGCTAAGATTCCAGAAACACCACCAGCCCCTAATGAGTTTCATAGAATCTGATTTTGCTTTTTTGTCGGTTGGGTTTGGGTCAGGTTTAGCAGTACAGCAGCTCCCACTTGTGCAAAGTAATGATGTAATGAGAAGGAGTGTTCTGGGTGGCCAGGCACAGGGGGGTTGTTAAGCACTGCGTGGCTCAGATCTCCCCTAATATATCATTTTCTTTCATTTTGACTTTCCTGCTTAAGGTCATGAAGAGGATTTTGTAATTGTAACAATACAAACCACTAATCTGTGGATTTCTCTTGTTTCTGAAATTATTCTTTGTAAGCCAATGAGGTTGGGTTTTTTCCAAAACTCCTGCAGATTTAATATTGTTTTGTTTTTCTGTTTATTCTATAGGAAGCCGCGATTGACCAGAACTCAAAGTGCCTTTTCTCCAGTCTCCTTCAGTCCGCTCTTCACTGGTGAAACGGTGTCGCTTGTGGACGTGGACATTTCACAGAGAGGATCCTCCTCTACACATCCTCCCACTCCCCCTCCGCCTCCCCGTAGGAGCCTCAGCCTTTTAGATGACATTGGTGGAATTCAACCAGCGTCTGTTCTAGTGGGACCCATGGGATCCTCTCTGCAGTCTTTCCCACTGCCCCCACCTCCTCCTCCACATGCCCCAGAACCTTTACCACGCTTGGTTCCGCTAAGACCAACTGAGTGTGTCCCAGTTCCACTGGTGCAGCCGCTGCAGTGCCCCCTATTTAAACAGGACCCTAGTAGCTTTGCTGCCAGCCTGCGGGAGCTTGAGAAGTGTGGTTGGTACTGGGGTCCAATGAACTGGGAGGATGC
  5   1   2       bld Te4       in                         CAAN9379.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGAGCTGTGTAACCGGCACCGCAAGGCCGCGCAGCCCGGGCTGGGGCTGGAACTGCAACTGGGGGCCCTGGGACTGCGGGGGGCCGGCTGCCCCTGTGAGGAGACCAGCGATGCGCTGTTAGTGCTGGAAGCGCCGGAGGCCCGCCGGCTGGAGGAACAGGAGGAAGGGGAGGCAGCGGGACAGGCCCCGAGCAGGAGGGCCCAGAACAGGAAGGCCTCCCTGCGGAACCGACTCTCCAGGATCTTCCGCACCAAGAGCTGCGCCGGGCCCCCAGGAACTGCTGAGAGAGAGCTGGGGGGCTCCGGGGGGAGTCTGACTGACATGTCCCGGGACAGAGAGTTGGAGCTTGGCAGGAAGCCGCGATTGACCAGAACTCAAAGTGCCTTTTCTCCAGTCTCCTTCAGTCCGCTCTTCACTGGTGAGTTGATGGGAAGAAAGGGATTCTGGCTACATGTGCCCACAAGAAATGACAAAACGtatatagtgaataaagtacccccattgtaaaatataggttattataaggcacagaggagttccatgaccctataaatggatgaggctgaaggccaagtgcttttatacgggtcatggaactctgaggtgactcctaacatcctcatattttacaacagaaggtactttatttattatattatgcaagttttagtgaatcatgtgacagaaatgacatcactaagctccgattataactgatgaaatcaatactcgttgtttataaggatatCATTTATGGTTTGGTCCCATAGGGAAATGTCCAAACTGTATATTATGTGGTTATATACATTAGAGCGTTATAGCAAGGCTCTGCTTGCGTCTCAAG
  5   1   2       bld Brn4      in                        CAAL18332.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGACCAGCGATGCGCTGTTAGTGCTGGAAGCGCCGGAGGCCCGCCGGCTGGAGGAACAGGAGGAAGGGGAGGCAGCGGGACAGGCCCCGAGCAGGAGGGCCCAGAACAGGAAGGCCTCCCTGCGGAACCGACTCTCCAGGATCTTCCGCACCAAGAGCTGCGCCGGGCCCCCAGGAACTGCTGAGAGAGAGCTGGGGGGCTCCGGGGGGAGTCTGACTGACATGTCCCGGGACAGAGAGTTGGAGCTTGGCAGGAAGCCGCGATTGACCAGAACTCAAAGTGCCTTTTCTCCAGTCTCCTTCAGTCCGCTCTTCACTGGTGAAACGGTGTCGCTTGTGGACGTGGACATTTCACAGAGAGGATCCTCCTCTACACATCCTCCCACTCCCCCTCCGCCTCCCCGTAGGAGCCTCAGCCTTTTAGATGACATTGGTGGAATTCAACCAGCGTCTGTTCTAGTGGGACCCATGGGATCCTCTCTGCAGTCTTTCCCACTGCCCCCACCTCCTCCTCCACATGCCCCAGAACCTTTACCACGCTTGGTTCCGCTAAGACCAACTGAGTGTGTCCCAGTTCCACTGGTGCAGCCGCTGCAGTGCCCCCTATTTAAACAGGACCCTAGTAGCTTTGCTGCCAGCCTGCGGGAGCTTGAGAAGTGTGGTTGGTACTGGGGTCCAATGAACTGGGAGGATGCAGAAATGAAGCTGAAGGCGAAACCAGACGGCTCCTTTCTGGTGCGAGATAGTTC
  5   1   2       bld Ovi1      in                        CABI11758.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGGCCTCCCTGCGGAACCGACTCTCCAGGATCTTCCGCACCAAGAGCTGCGCCGGGCCCCCAGGAACTGCTGAGAGAGAGCTGGGGGGCTCCGGGGGGAGTCTGACTGACATGTCCCGGGACAGAGAGTTGGAGCTTGGCAGGAAGCCGCGATTGACCAGAACTCAAAGTGCCTTTTCTCCAGTCTCCTTCAGTCCGCTCTTCACTGGTGAAACGGTGTCGCTTGTGGACGTGGACATTTCACAGAGAGGATCCTCCTCTACACATCCTCCTACTCCCCCTCCGCCTCCCCGTAGGAGCCTCAGCCTTTTAGATGACATTGGTGGAATTCAACCAGCGTCTGTTCTAGTGGGACCCATGGGATCCTCTCTGCAGTCTTTCCCACTGCCCCCACCTCCTCCTCCACATGCCCCAGAACCTTTACCACGCTTGGTTCCGCTAAGACCAACTGAGTGTGTCCCAGTTCCACTGGTGCAGCCGCTGCAGTGCCCCCTATTTAAACAGGACCCTAGTAGCTTTGCTGCCAGCCTGCGGGAGCTTGAGAAGTGTGGTTGGTACTGGGGTCCAATGAACTGGGAGGATGCAGAAATGAAGCTGAAGGCGAAACCAGACGGCTCCTTTCTGGTGCGAGATAGTTCAGACCCTCGGTACATTCTGAGTCTGAGTTTCCGATCACAGGGCATCACCCACCACACACGCATGGAGCACTATAGAGGCACATTCAGCCTCTGGTGCCACCCGAAGTTTGAGGATCGTTGTCAGTCGGTAGTGGAGTTTATTAAACGTGCCATCATGCACTCTAAGAATGNGAAGTTCCTGTATTTTCTTCGCTCGCGAGTACCAGGTCTCCCCCCTACCCCAGTTCAGCTTTTGTACCCCGTTTTCCGCTTCAGCAAT
  5   1   2       bld Tad5      in                         XZT10721.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACCATGGGATCCTCTCTGCAGTCTTTCCCACTGCCCCCACCTCCTCCTCCACATGCCCCAGAACCTTTACCACGCTTGGTTCCGCTAAGACCAACTGAGTGTGTCCCAGTTCCACTGGTGCAGCCGCTGCAGTGCCCCCTATTTAAACAGGACCCTAGTAGCTTTGCTGCCAGCCTGCGGGAGCTTGAGAAGTGTGGTTGGTACTGGGGTCCAATGAACTGGGAGGATGCAGAAATGAAGCTGAAGGCGAAACCAGACGGCTCCTTTCTGGTGCGAGATAGTTCAGACCCTCGGTACATTCTTAGTCTGAGTTTCCGATCACAGGGCATCACCCACCACACACGCATGGAACACTATAGAGGCACATTCAGCCTCTGGTGCCACCCGAAGTTTGAGGATCGCTGTCAGTCGGTAGTGGAGTTTATTAAACGTGCCATCATGCACTCTAAGAATGGGAAGTTCCTGTATTTTCTTCGCTCGCGAGTACCAGGTCTCCCCCCTACCCCAGTTCAGCTTTTGTACCCCGTTTCCCGCTTCAGCAATGTGAAGTCCCTGCAGCACTTGTGCCGCTTTCGTATTCGGCAGCTGGTCCGGATCGACCACATTCCAGAGCTCCCACTACCCAAGCCCCTCATCTCATACCTGCGCAAGTTCTATTATTACGACCCCCAGGAGGAGGTATACCTTTGTCTAAAGGAGGCGCGGCATCTGAACAAATTGGAGTCTGGGAGCGAGAGCTCCACGTAGCGAGGATTCCGCGTTTTCCCTCTTCATAGGCCG
  5   1   2       bld Brn3      in                         CAAK5236.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGACGCGTGGGCTAGTAGCTTTGCTGCCAGCCTGCGGGAGCTTGAGAAGTGTGGTTGGTACTGGGGTCCAATGAACTGGGAGGATGCAGAAATGAAGCTGAAGGCGAAACCAGACGGCTCCTTTCTGGTGCGAGATAGTTCAGACCCTCGGTACATTCTGAGTCTGAGTTTCCGATCACAGGGCATCACCCACCACACACGCATGGAGCACTATAGAGGCACATTCAGCCTCTGGTGCCACCCGAAGTTTGAGGATCGTTGTCAGTCGGTAGTGGAGTTTATTAAACGTGCCATCATGCACTCTAAGAATGGGAAGTTCCTGTATTTTCTTCGCTCGCGAGTACCAGGTCTCCCCCCTACCCCAGTTCAGCTTTTGTACCCCGTTTCCCGCTTCAGCAATGTGAAGTCCCTGCAGCACTTGTGCCGCTTTCGTATTCGGCAGCTGGTCCGGATCGACCACATTCCAGAGCTCCCACTACCCAAACCCCTCATCTCATACCTGCGCAAGTTCTATTATTACGACCCCCAGGAGGAGGTATACCTTTGTCTAAAGGAGGCGCGGCATCTGAACAAATTGGAGTCTGGGAGCGAGAGCTCCACGTAGCGAGGATTCCGCGCTTTCCCTCTTCATAGGCCGAACCAGGATGCAGAATGCTGAGCAAGAGAACAATGGATGACCCTGGGGATGCTTGAATTAGAGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATTGCCCCCTTTTGTAGGAGTTGGAATACTCAAGCAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTG
  5   1   2       bld Gas6      in                         ANBT1745.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCTGAAGGCGAAACCAGACGGCTCCTTTCTGGTGCGAGATAGTTCAGACCCTCGGTACATTCTGAGTCTGAGTTTCCGATCACAGGGCATCACCCACCACACACGCATGGAGCACTATAGAGGCACATTCAGCCTCTGGTGCCACCCGAAGTTTGAGGATCGTTGTCAGTCGGTAGTGGAGTTTATTAAACGTGCCATCATGCACTCTAAGAATGGGAAGTTCCTGTATTTTCTTCGCTCGCGAGTACCAGGTCTCCCCCCTACCCCAGTTCAGCTTTTGTACCCCGTTTCCCGCTTCAGCAATGTGAAGTCCCTGCAGCACTTGTGCCGCTTTCGTATTCGGCAGCTGGTCCGGATCGACCACATTCCAGAGCTCCCACTACCCAAACCCCTCATCTCATACCTGCGCAAGTTCTATTATTACGACCCCCAGGAGGAGGTATACCTTTGTCTAAAGGAGGCGCGGCATCTGAACAAATTGGAGTCTGGGAGCGAGAGCTCCACGTAGCGAGGATTCCGCGCTTTCCCTCTTCATAGGCCGAACCAGGATGCAGAATGCTGAGCAAGAGAACAATGGATGACCCTGGGGATGCTTGAATTAGAGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATTGCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGA
  5   1   2       bld HeRe      in                     EC2CAA13CG04.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTCTTAGTCTGAGTTTCCGATCACAGGGCATCACCCACCACACACGCATGGAACACTATAGAGGCACATTCAGCCTCTGGTGCCACCCGAAGTTTGAGGATCGTTGTCAGTCGGTAGTGGAGTTTATTAAACGTGCCATCATGCACTCTAAGAATGGGAAGTTCCTGTATTTTCTTCGCTCGCGAGTACCAGGTCTCCCCCCTACCCCAGTTCAGCTTTTGTACCCCGTTTCCCGCTTCAGCAATGTGAAGTCCCTGCAGCACTTGTGCCGCTTTCGTATTCGGCAGCTGGTCCGGATCGACCACATTCCAGAGCTCCCACTACCCAAGCCCCTCATCTCATACCTGCGCAAGTTCTATTATTACGACCCCCAGGAGGAGGTATACCTTTGTCTAAAGGAGGCGCGGCATCTGAACAAATTGGAGTCTGGGAGCGAGAGCTCCACGTAGCGAGGATTCCGCGTTTTCCCTCTTCATAGGCCGAACCAGGATGCAGAATGCTGAGCAAGAGAACAATGGATGAACCTGGGGATGCTTGAATTAGAGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATTGCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATA
  5   1   2       bld Eye                                  CCAX4383.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCCCTGCAGCACTTGTGCCGCTTTCGTATTCGGCAGCTGGTCCGGATCGACCACATTCCAGAGCTCCCACTACCCAAACCCCTCATCTCATACCTGCGCAAGTTCTATTATTACGACCCCCAGGAGGAGGTATACCTTTGTCTAAAGGAGGCGCGGCATCTGAACAAATTGGAGTCTGGGAGCGAGAGCTCCACGTAGCGAGGATTCCGCGCTTTCCCTCTTCATAGGCCGAACCAGGATGCAGAATGCTGAGCAAGAGAACAATGGATGACCCTGGGGATGCTTGAATTAGAGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATTGCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAAGGTCAGGGGAATTGGCATTCTGTTCTCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACGGATGCTGAATATCCCCTTGA
  5   1   2       bld In54                            IMAGE:8945573.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTTAAATATCAGGGTTTGCAAGACCTATTCAAAATTCGTCCCCTCATACCTGCGCAAGTTCTATTATTACGACCCCCAGGAGGAGGTATACCTTTGTCTAAAGGAGGCGCGGCATCTGAACAAATTGGAGTCTGGGAGCGAGAGCTCCACGTAGCGAGGATTCCACACTTTCCCTCTTCATAGGCCGAACCAGGATGCAGAATGCTGAGCAAGAGAACAATGGATGACCCTGGGGATGCTTGAATTAGAGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATTGCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAGGGTCAGGGGAATTGGCATTCTGTTCCCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAAACAGGATACACTGAGCGTATTCATCTCACGGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCGCGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGTTTTTCAGTTTCTCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGACTCCGTATCCCAAACTCTTGTCTCTTCTAATACTCAAGATTCCTTTTCTCAAAGGTGTTAAACCGGTCTAACACTGGAGTCCGTTCACATGGAGAATCAGCCAACTCCTTTTAATGAACTGGTTGCCAAACAGCCGGCGTACTTGGAAGAGGGATCTGTGGGTTGGAAAGCCGAAGAAGCGCATAGTTG
  5   1   2       bld Eye                                  CCAX4230.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAACCCCTCATCTCATACCTGCGCAAGTTCTATTATTACGACCCCCAGGAGGAGGTATACCTTTGTCTAAAGGAGGCGCGGCATCTGAACAAATTGGAGTCTGGGAGCGAGAGCTCCACGTAGCGAGGATTCCGCGCTTTCCCTCTTCATAGGCCGAACCAGGATGCAGAATGCTGAGCAAGAGAACAATGGATGACCCTGGGGATGCTTGAATTAGAGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATTGCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAAGGTCAGGGGAATTGGCATTCTGTTCTCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACGGGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCACGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCT
  3   1   2       chi HeRe      in                     EC2CAA13CG04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATACCTGCGCAAGTTCTATTATTACGACCCCCAGGAGGAGGTATACCTTTGTCTAAAGGAGGCGCGGCATCTGAACAAATTGGAGTCTGGGAGCGAGAGCTCCACGTAGCGAGGATTCCGCGTTTTCCCTCTTCATAGGCCGAACCAGGATGCAGAATGCTGAGCAAGAGAACAATGGATGAACCTGGGGATGCTTGAATTAGAGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATTGCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAGGGTCAGGGGAATTGGCATTCTGTTCCCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACACTGAGCGTATTCATCTCACGGATGCTGAATATCCCCTTGAAGTGAAAGGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGG
  3   1   2       bld Ovi1      in                        CABI11758.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATCTGACCAAATGGGAGTCTGGGAGCGAGAGCTCCACGTAGCGAGGATTCCGCGCTTTCCCTCTTCATAGGCCGAACCAGGATGCAGAATGCTGAGCAAGAGAACAATGGATGACCCTGGGGATGCTTGAATTAGAGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATTGCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAAGGTCAGGGGAATTGGCATTCTGTTCTCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACAGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCGCGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTAATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGGACTGATACCTTTCATCCATTTCACAGGACTAAAAC
  3   1   2       bld Ova1      in                        CABE12511.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTCCCTCTTCATAGGCCGAACCAGGATGCAGAATGCTGAGCAAGAGAACAATGGATGACCCTGGGGATGCTTGAATTAGAGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATTGCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAAGGTCAGGGGAATTGGCATTCTGTTCTCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACAGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCGCGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTAATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGGACTGATACCTTTCATCCATTTCACAGGACTAAAAC
  5   1   2       bld Ova1      in                        CABE12511.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTCCCTCTTCATAGGCCGAACCAGGATGCAGAATGCTGAGCAAGAGAACAATGGATGACCCTGGGGATGCTTGAATTAGAGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATTGCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAAGGTCAGGGGAATTGGCATTCTGTTCTCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACAGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCGCGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTAATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGNGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCNGGGAGGACTGATACCTTTCATCCATTTCACAGGACTAAAACAAAA
  3   1   2       bld Tad5      in                         XZT52234.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCATAGGCCGAACCAGGATGCAGAATGCTGAGCAAGAGAACAATGGATGACCCTGGGGATGCTTGAATTAGAGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATTGCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAAGGTCAGGGGAATTGGCATTCTGTTCTCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACGGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCACGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTTATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGGACTGATACCTTTCATCCATTTCACAGGACT
  3   1   2       bld Int1      in                         CAAP7210.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATAGGCCGAACCAGGATGCAGAATGCTGAGCAAGAGAACAATGGATGACCCTGGGGATGCTTGAATTAGAGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATTGCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAAGGTCAGGGGAATTGGCATTCTGTTCTCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACGGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCACGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTTATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGT
  5   1   2       bld Int1      in                         CAAP7210.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATAGGCCGAACCAGGATGCAGAATGCTGAGCAAGAGAACAATGGATGACCCTGGGGATGCTTGAATTAGAGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATTGCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAAGGTCAGGGGAATTGGCATTCTGTTCTCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACGGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCACGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTTATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGT
  3   1   2      seed Brn3      in                         CAAK5236.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATAGGCCGAACCAGGATGCAGAATGCTGAGCAAGAGAACAATGGATGACCCTGGGGATGCTTGAATTAGAGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATTGCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAAGGTCAGGGGAATTGGCATTCTGTTCTCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACGGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCACGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTTATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGGACTGATACCTTTCATCCATTTCACAGGACTAAAAC
  3   1   2       bld Te5                                  CAAO6387.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATAGGCCGAACCAGGATGCAGAATGCTGAGCAAGAGAACAATGGATGACCCTGGGGATGCTTGAATTAGAGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATTGCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAAGGTCAGGGGAATTGGCATTCTGTTCTCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACGGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCACGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTTATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGGACTGATACCTTTCATCCATTTCACAGGACTAAAAC
  3   1   2       bld Gas8      in                          st70k12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGATGCAGAATGCTGAGCAAGAGAACAATGGATGACCCTGGGGATGCTTGAATTAGAGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATTGCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAAGGTCAGGGGAATTGGCATTCTGTTCTCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACAGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCGCGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTAATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTAGCGGAAG
  3   1   2       bld Gas6      in                         ANBT1745.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGCAGAATGCTGAGCAAGAGACCAATGGATGACCCTGGGGATGCTTGAATTAGAGGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATTGCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAAGGTCAGGGGAATTGGCATTCTGTTCTCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACAGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCGCGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTAATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGGACTGATACCTTTCATCCATTTCACAGGACT
  3   1   2       bld Te4       in                        CAAN11929.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGCAAGAGAACAATGGATGCCCCTGGGGATGCTTGAATTAGAGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATGCCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAAGGTCAGGGGAATTGGCATTCTGTTCTCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACGGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCACGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTTATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGGACTGATACCTTTCATCCATTTCACAGGACTAAAAC
  5  -1   2       bld Eye       in                         CCAX4233.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCAAGAGAACAATGGATGACCCTGGGGATGCTTGAATTAGAGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATTGCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAAGGTCAGGGGAATTGGCATTCTGTTCTCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACGGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCACGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTTATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGGACTGATACCTTTCATCCATTTCACA
  3   1   2       bld Brn4      in                        CAAL18332.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGCTTGAATTAGAGGCTGCAGTTCTGACTGGCTAGCGTGGTCCCTCTTACTCCGGTAGCCACATTGCCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAAGGTCAGGGGAATTGGCATTCTGTTCTCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACGGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCACGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTTATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGGACTGCTACCTTTCATCCATTTCACAGGACTAAAAC
  3   1   2       bld Te1       in                         CBWN1087.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTCTTACTCCGGTAGCCACATTGCCCCCTTTTGTAGGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAGGGTCAGGGGAATTGGCATTCTGTTCCCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACACTGAGCGTATTCATCTCACGGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCACGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACATAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTAATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGGACTGATACCTTTCATCCATTTCACAGGACTAAAACAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg004g24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAAGGTCAGGGGAATTGGCATTCTGTTCTCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACAGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCGCGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTAATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGGACTGATACCTTTCATCCATTTCACAGGACTAAAACAAAAAAAAAAAAAAAAAA
  5   1   2       bld Brn4      in                         CAAL5790.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGTTGGAATACCAAGCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAAGGTCAGGGGAATTGGCATTCTGTTCTCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACGGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCACGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTTATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGGACTGATACCTTTCATCCATTTCACAGGACTAAAACAAAAAAAAAAAAAACCAAGTTTCTTTTCCTCTCCAGCACAATTCTTTCCCCCATTTCCTCC
  5  -1   2       bld Neu                            TNeu006i16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAAGTTGTTTGGCACACCAAGCTTATCCACATTGGCACTGAGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTNTGGCCTATCCCTGAACTGGAAACCATCCCTCAAAGGTCAGGGGAATTGGCATTCTGTTCTNTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACGGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCACGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTTATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGGACTGATACCTTTCATCCATTTCACAGGACTAAAACAAAA
  3   1   2       bld BrSp      in                     EC2BBA17AF04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAGGGTCAGGGGAATTGGCATTCTGTTCCCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACACTGAGCGTATTCATCTCACGGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCACGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACATAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTAATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCTGCGTACTTGAAGAGGTTCGTGGGGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGGACTGATACCTT
  5   1   2       bld BrSp      in                     EC2BBA17AF04.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGGGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAGGGTCAGGGGAATTGGCATTCTGTTCCCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACACTGAGCGTATTCATCTCACGGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCACGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACATAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTAATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCTGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGGACTGATACCTTTCATCCATTTCACAGGACTAAAACAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg                            TEgg093c16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAGCTGAAGTTATATAGAGCCCTGCCTCCATCCTCGGTGTTCTGGCCTATCCCTGAACTGGAAACCATCCCTCAAAGGTCAGGGGAATTGGCATTCTGTTCTCTAGGCCGCTCCATCATCTGGGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACGGATGTTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCACGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTTATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGGACTGATACCTTTCATCCATTTCACAGGACTAAAAAAAAAAAAAAAAAAGCGGCCGCAA
  3   1   2       bld Tad5      in                         XZT10721.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTGAACTGGAAACCATCCATCAAGGGTCAGGGGAATTGGCATTCTGTTCCTTAGGCCGCTCCATCATCTGGGTTTCCACGGTTGTTCTACCGTTACTGTAACAGGATACACTGAGCGTATTCATCTCACGGATGCTGAATATCCCCTAGAAGTGAAAGGGTACAGCCAATGCCGCGCCTGTCCCTGGCCACACACACATGATACTACTGATGTTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTGCTGATTGGACTGGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTAATCTCAAGATTCCTTTCTCCACAGGTGTTAAAAC
  3   1   2       bld Te4       in                         CAAN9379.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTTTCCATGGTTGTTCTACCGATACTGTAACAGGATACAATGAGCGTATTCATCTCACGGATGCTGAATATCCCCTTGAAGTGAAAGGGTACAGCCAAGCCACGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTTATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGGACTGATACCTTTCATCCATTTCACAGGACTAAAAC
  5   1   2       bld Neu       in                   TNeu070a07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATACACTTGAGCGTATTCATCTCACGGATGCTGAATATCCCCTAGAAGTGAAAGGGTACAGCCAAGCCGCGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTAATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGTGGAGAGCGATGGTGAATATATCTGCTGCCCTTATCGGGAAGGACTGATACCTTTCATCCATTTCACAGGACTAAAAC
  3   1   2       bld Neu       in                    TNeu070a07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATACACTGAGCGTATTCATCTCACGGATGCTGAATATCCCCTAGAAGTGAAAGGGTACAGCCAAGCCGCGCCTGTCCCTGGCCACACACACATGATACTACTGATGCTTTTGTCTCCCCACTGGACGTGGGATCAGGTTTTTCAGTTTCTCCAGCGTTATACTACTGATTGGACTTGCTGTTACTTCTGCAACGTAGGGACTCCGTATCCCAAAACTCTTGTCTCTTCTAATCTCAAGATTCCTTTCTCCAAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGTGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGGACTGATACCTTTCATCCATTTCACAGGACTAAAACAAAAAAAAAAAAAAAAAA
  5  -1   0       chi Gas5                                   XZF268.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGTTTTATTATTACGACCCCCAGGAGGAGGTATACCTTTGTCTAAAGGAGGCGCGGCATCTGAACAAATTGGAGTCTGGGAGCGAGAGCTCCACGTAGCGAGGATTCCGCGCTTTCCCTCTTCATAGGCCGAACCAGGTGTTAAAACCGGTCTAAACACTGGAGTCCGTTCCCTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAACGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGG
  5   1   2       bld HdA                           THdA036o02.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAACCTGGAGTCCGTTCACTGGAGATCAAGCCAACTCCTTTAATGAACTGGTTGCCAGACAGCCGGCGTACTTGAAGAGGTTCGTGGGTGGAAAGCGGAGAGCGATGGTGAATATATCTGCTGCCCTTAGCGGGAAGGACTGATACCTTTCATCCATTTCACAGGACTAAAACAAAAAAAAAAAAAAAACCAAGTTTCTTTTCCTCTCCAGCACAATTCTTTCCCCCATTTCCTCCCTCCCTTTTATTCTTTTGTGTATATTTTGTTTCTTATGCGCTTAATTTATTGAACGATAGTCTGGGTGTAATTTATTTTCCCTTCCCTCGTTATTCCCCCGCTGCTTGTGGGTTTTTTGAATCTGTAACAAGGAAAACCGTAAAACATTGGCGGTTGTTTCGGGGGGTTCTGTCCTGTGCGTGTGTGCGGCTTCTGTGCCCGTATGGAGCCCCCCCCCCCCCCCCCGTGGCCNGTTTGACGTGTCCTTCNAGCTCTGTTTGTACATATTGTCTTTTAGGCATGACTGAGGCACATCGGTTCATTTCAAAAACATATATATATTTTTGACTCCCCCGAATATTCCTTTCTTTGCAGTGGTTGAATAGGAAAAAACTGCACATTTGTTTTTTGTGTCAGTGGTCTGTCTTTCTACTTTGT
  5   1   0       add Spl1      ?                          CABK1014.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGATCCATCGATTCGCTCTCCAGCACAATTCTTTCCCCCATTTCCTCCCTCCCTTTTATTCTTTTGTGTATATTTTGTTTCTTATGCGCTTAATTTATTGAACGATAGTCTGGGTGTAATTTATTTTCCCTTCCCTCGTTATTCCCCCGCTGCTTGTGGGTTTTTTGAATCTGTAACAAGGAAAACCGTAAAACATTGGCGGTTGTTTCGGGGGGTTCTGTCCTGTGCGTGTGTGCGGCTTCTGTGCCCGTATGGAGCCCCCCCCCCCCCCCCCGTGGCCAGTTTGACGTGTCCTTCAAGCTCTGTTTGTACATATTGGCTTTTAGGCATGACTGAGGCACATCGGTTCATTTCAAAAACATATATATATTTTTGACTCCCCCGAAAATTCCTTTCTTTGCAGGGGTTGAATAGGAAAAAACTGCACATTTGTTTTTTGGGGCAGGGGGCTGTCTTTCTACTTTGCTCC
  3   1   0       add Brn4      in                         CAAL5790.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGGAAAACCTTAAAACATGGGGGGTTTTTTTGGGGGGTTTCTCCCGTGGGGGGGGGGGGGGTTTTTGCCCCGAAGGGGCCCCCCCCCCCCCCCCCCCCCCCGGGGCCATTTTGAGGGGTCCTCCAAGCTTTGTTTGTACATTTTGTTTTTTAGGCAGGACTGGGGCACCTGGGTTCTTTTCAAAAACATATATATTTTTTTGCCTCCCCCGAATTTTCCTTTTTTTCCAGGGGTGGAATGGGAAAAAACTCCCCCTTTTTTTTTGGGGCCAGGGGTCGGTCTTTTTACTTGGTTTCCTGGGTTTCCCCCCCCCCCCTGACCCAGAGAAAAAAAAGCCTTCGCCCCCCCCCCCCCTTTTTCCTCCTCACATCCTCATGGTGCTTCGGGGTCTGCACTTTGCTGTTGGATTTTTCAAGAGGGGGCGGAGAGCGGGTTTAAAATAAACTGTTTGGAAATCCCCGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)