Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TGas141m18.3                         32 END     1           1        3                Unknown (protein for MGC:160673) [Xenopus laevis]
     2   2.0    0Xt7.1-CAAN5799.5                           10 END     9          10       90                PREDICTED: similar to insulin-degrading enzyme [Gallus gallus]
     3   0.0    0Xt7.1-XZG36716.5                            3 END     1           1       33                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012075020 Xt7.1-XZT52354.3.5 - 89 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-XZT52354.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGACAAGCAGCACATCTTGCTCAAGAAGATCATTGAGAAAATGGCTACCTTCGAAATAGATGAGAAAAGATTTGAAATTATTAAAGAAGCGTACATGCGATCTCTGAATAACTTCCGAGCAGAGCAGCCGCACCAGCACGCTATGTATTATCTCCGGTTGCTCATGACTGAAGTGGCTTGGACCAAGGATGAACTGAAAGAAGCTTTAGACGATGTCACCCTCCTGCGCCTGAAGGCCTTCATCCCTCAGCTGCTGTCTCGGCTGCACGTGGAAGCTCTTGTGCATGGAAACATCACAAAGCAGGCTGCCATGGGCATTATGCAGATGGTAGAGGACACCCTTATTGAACATGCCCACACTAAGCCTCTTCTTCCAAGTCAGCTGGTCCGATACCGAGAAGTACAGCTGCCAGACAGAGGCTGGTTTGTGTATCAGCAGAGGAACGAGGTCCATAATAACTGTGGCATTGAGATTTATTATCAGACGGACATGCAGAGCACATCGGAGAACATGCTGCTTGAACTTCTCTGCCAGATCATCTCCGAGCCTTGCTTCAACACGCTGCGCACCAAGGAGCAGTTAGGTTACATTGTGTTCAGCGGCCCCCGCAGGGCTAATGGCATCCAAGGTCTGAGATTTATTATCCAGTCCGAGAAGCCGCCTCATTATTTAGAGAGCCGCGTGGAGGCCTTCTTTAAAGACCACAGAGAAGTCCCTGGAAGACATGGCGGATGAGGCGTTCCAGAAGCACATCCAGGCGCTGGCGATACGCCGTCTAGACAAGCCAAAGAAACTCTCTGCCGAGTGTGCTAAGTACTGGGGGGAAATCATTTCCCAGCAGTATAACTTTGATAGAGACAACATTGAAGTCGCCTATCTGAAGACTCTGGTAAAGGAAGATATCATGAACTTTTACAAGAATATGTTGTCTGTGGACGCCCCTAGAAGACACAAAGTATCTGTGCACGTTCTTTCCAGAGAGATGGATTCCTGTCCTGTAGTGGGTGAATTTCCAAGTCAAAATGATGTTAACCTCGCTCCAGCTCCAGCCCTTCCTCAGCCTGAGGTGATTAGCAATATGACGGAGTTCAAGAGGAGCTTGCCTCTCTTCCCTCTCGTCAAACCCCACATCAACTTCATGACCGCGAAATTATGATCCGAGCTGCAAACAGGACAACGACCACTGAACCAGGTGCTGCTTAAGATGTGCCGTGGCTTGCAAGTGAGGAGTCATTCTGGTTGCAGTAGTAGGACTTTGCACATAGACATTTAGTAAAACTATAATCTCTGTAGTACCGAAATCTGGTTGGTGTTGATTTTACATTGTAACGCATGGGCTGCATCAGGTGTCCTGTTGTGGATTGGTTGGTTGGTGTCACCTGATGCACACGCTGGCATTGACTGGCAAAGGAAGGACAAGTAGACTTTTACGAGGAAAGAATTATATTACACATAATGCTGAAATGCTGTAAATTATTTATGAACGTAGGATTATTCTTAAGGAAAAACAAAACCTTGGCTAACTAGACTGTTAGGTTTAGCTACAGTGCCACGGGTTTGTGCTGTGAGGCGCCATCTTCCCCCTGCGCAGTGTTTGACGTGACTTCATTGTGTTGACATTTTTGTTTAAAAGGGACACGTACCACCTGTATGCAAGTCAGTCCTCTTTATTTCAGTATCATAAATTATAACTGGAGCACCCCCTGCTGTTCAGCAGGGGGGTTTATTTACTGATGCCAATAGAGTAGATATTATTTACTGATGTCATAGAGTAGATAAACGTCAGTAGACTCTTCCGGCATCGGTAACTTAAACTTTAGCTTTCTGTCCGCCCCCTGCCCAGACAGACCTGCAGGTGCTTCTATTACACATTCATATTAATTTGCAAAAGTGCTCTGGAGAGCAATTTTATATTGTTATGCGGGTGGGGGTATGTCCTTATTAAAAAGCCAATCAAGTGTGAGCTATTTAGAGAGAATGGCAAGCAGAGGCAGATACAGACTCTGTAACCCACCTCTGCGGGTGCTTTATCTCCACACAAGGTGCATGGCTGTAGCCCCCAGCAGGTAGCACTTTTGATGATAAGGTACAGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACTTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCGTGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACTGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATGA
                                                  Xt7.1-CHK-1008223561                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAGCACATCTTGCTCAAGAAGATCATTGAGAAAATGGCTACCTTCGAAATAGATGAGAAAAGATTTGAAATTATTAAAGAAGCGTACATGCGATCTCTGAATAACTTCCGAGCAGAGCAGCCGCACCAGCACGCTATGTATTATCTCCGGTTGCTCATGACTGAAGTGGCTTGGACCAAGGATGAACTGAAAGAAGCTTTAGACGATGTCACCCTCCTGCGCCTGAAGGCCTTCATCCCTCAGCTGCTGTCTCGGCTGCACGTGGAAGCTCTTGTGCATGGAAACATCACAAAGCAGGCTGCCATGGGCATTATGCAGATGGTAGAGGACACCCTTATTGAACATGCCCACACTAAGCCTCTTCTTCCAAGTCAGCTGGTCCGATACCGAGAAGTACAGCTGCCAGACAGAGGCTGGTTTGTGTATCAGCAGAGGAACGAGGTCCATAATAACTGTGGCATTGAGATTTATTATCAGACGGACATGCAGAGCACATCGGAGAACATGCTGCTTGAACTTCTCTGCCAGATCATCTCCGAGCCTTGCTTCAACACGCTGCGCACCAAGGAGCAGTTAGGTTACATTGTGTTCAGCGGCCCCCGCAGGGCTAATGGCATCCAAGGTCTGAGATTTATTATCCAGTCCGAGAAGCCGCCTCATTATTTAGAGAGCCGCGTGGAGGCCTTCTTxAAxxxCCACAGAGAAGTCCCTGGAAGACATGGCGGATGAGGCGTTCCAGAAGCACATCCAGGCGCTGGCGATACGCCGTCTAGACAAGCCAAAGAAACTCTCTGCCGAGTGTGCTAAGTACTGGGGGGAAATCATTTCCCAGCAGTATAACTTTGATAGAGACAACATTGAAGTCGCCTATCTGAAGACTCTGGTAAAGGAAGATATCATGAACTTTTACAAGAATATGTTGTCTGTGGACGCCCCTAGAAGACACAAAGTATCTGTGCACGTTCTTTCCAGAGAGATGGATTCCTGTCCTGTAGTGGGTGAATTTCCAAGTCAAAATGATGTTAACCTCGCTCCAGCTCCAGCCCTTCCTCAGCCTGAGGTGATTAGCAATATGACGGAGTTCAAGAGGAGCTTGCCTCTCTTCCCTCTCGTCAAACCCCACATCAACTTCATGACCGCGAAATTATGATCCGAGCTGCAAACAGGACAACGACCACTGAACCAGGTGCTGCTTAAGATGTGCCGTGGCTTGCAAGTGAGGAGTCATTCTGGTTGCAGTAGTAGGACTTTGCACATAGACATTTAGTAAAACTATAATCTCTGTAGTACCGAAATCTGGTTGGTGTTGATTTTACATTGTAACGCATGGGCTGCATCAGGTGTCCTGTTGTGGATTGGTTGGTTGGTGTCACCTGATGCACACGCTGGCATTGACTGGCAAAGGAAGGACAAGTAGACTTTTACGAGGAAAGAATTATATTACACATAATGCTGAAATGCTGTAAATTATTTATGAACGTAGGATTATTCTTAAGGAAAAACAAAACCTTGGCTAACTAGACTGTTAGGTTTAGCTACAGTGCCACGGGTTTGTGCTGTGAGGCxxCxxxTTCCCCxxxxxxAGTGTTTGACGTGACTTCATTGTGTTGACATTTTTGTTTAAAAGGGACxxxxxCCACCTGxxxxxxAGTCAGTCCTCTTTATTTCAGTATCATAAATTATAACTGGAGCACCCCCTGCTGTTCAGCxxGGGxGTTTATTTACTGxxxxxAAxAGxxxAxxxxTTATTTACTGATGTCATAGAGTAGATAAACGTCAGTAGACTCTTCCGGCATCGGTAACTTAAACTTTAGCTTTCTGTCCGCCCCCTGCCCAGACAGACCTGCAGGTGCTTCTATTACACATTCATATTAATTTGCAAAAGTGCTCTGGAGAGCAATTTTATATTGTTATGCGGGTGGGGGTATGTCCTTATTAAAAAGCCAATCAAGTGTGAGCTATTTAGAGAGAATGGCAAGCAGAGGCAGATACAGACTCTGTAACCCACCTCTGCGGGTGCTTTATCTCCACACAAGGTGCATGGCTGTAGCCCCCAGCAGGTAGCACTTTTGATGATAAGGTACAGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACTTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTxxxxxAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGxxxGxxGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTxAxxxxAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCGTGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACTGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATGAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     7     4     6     3     6     4     7     4     7     4     7     4     7     4     7     5     8     5     8     5     8     5     8     6     9     7     9     7     9     7     9     6     8     6     8     6     8     6     8     6     8     5     7     5     7     5     6     5     7     5     7     5     7     5     8     5     8     5     9     5     9     6     9     8    10     8    11     9    12     9    12     9    12     9    12     9    11     9    11     9    11     9    11     9    11     9    11    10    13    10    13    10    13    10    13     9    12     9    12     9    12     9    12     6     9     6     9     6     9     6     9     6     9     6     9     6     8     6     8     6     8     7     9     7     9     7     9     6     9     7    10     7    10     7    10     7    10     7    11     6    10     6    10     6    10     6    10     5    10     6    10     5    10     5    10     5    11     4    11     6     9     3     9     3     8     3     7     3     7     3     7     3     7     4     8     2     8     2     8     2     8     4     9     4     9     4     9     3     9     4    11     5    11     5    11     4    10     3     9     4     9     5    10     5    11     6    12     6    12     7    12     7    11     7    11     7    11     7    12     7    13     7    13     7    13     7    13     7    13     7    13     7    12     7    12     7    12     7    13     8    14     8    14     8    15     9    17     9    18     9    19     9    19     9    20     9    21     9    21     9    22     9    23     9    23     9    24    10    25    11    26    11    27    11    26    11    26    11    27    11    27    12    29    11    29    11    29    11    29    11    30    11    30    11    31    11    31    11    31    12    32    12    32    12    32    12    31    12    30    12    29    12    29    17    29    11    29    12    29    12    30    12    31    11    32    12    31    12    31    12    32    12    33    12    33    12    33    12    32    12    32    12    32    12    31    12    31    13    33    13    33    12    32    12    31    12    30    11    29    10    27    10    26    10    26    10    18    10    17    10    17    10    17    10    17    10    16    10    16    11    18    10    17    10    17     9    16     9    16     9    17     9    17     9    18     9    19    11    21    11    21    12    22    13    23    13    23    13    23    16    26    16    26    16    26    16    26    18    28    18    28    18    28    18    28    18    28    18    28    18    27    18    28    18    28    18    28    19    29    20    30    19    29    19    30    19    30    19    30    21    32    21    32    21    32    19    30    20    30    20    30    21    22    19    21    17    21    19    21    18    20    18    20    17    20    18    20    18    20    17    20    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    19    20    19    20    18    19    18    19    18    19    18    19    18    19    18    19    17    19    18    19    17    19    18    19    18    19    17    19    17    19    14    19     3     8
  5   1   2  SIG                                      Xt7.1-XZT52354.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGACAAGCAGCACATCTTGCTCAAGAAGATCATTGAGAAAATGGCTACCTTCGAAATAGATGAGAAAAGATTTGAAATTATTAAAGAAGCGTACATGCGATCTCTGAATAACTTCCGAGCAGAGCAGCCGCACCAGCACGCTATGTATTATCTCCGGTTGCTCATGACTGAAGTGGCTTGGACCAAGGATGAACTGAAAGAAGCTTTAGACGATGTCACCCTCCTGCGCCTGAAGGCCTTCATCCCTCAGCTGCTGTCTCGGCTGCACGTGGAAGCTCTTGTGCATGGAAACATCACAAAGCAGGCTGCCATGGGCATTATGCAGATGGTAGAGGACACCCTTATTGAACATGCCCACACTAAGCCTCTTCTTCCAAGTCAGCTGGTCCGATACCGAGAAGTACAGCTGCCAGACAGAGGCTGGTTTGTGTATCAGCAGAGGAACGAGGTCCATAATAACTGTGGCATTGAGATTTATTATCAGACGGACATGCAGAGCACATCGGAGAACATGCTGCTTGAACTTCTCTGCCAGATCATCTCCGAGCCTTGCTTCAACACGCTGCGCACCAAGGAGCAGTTAGGTTACATTGTGTTCAGCGGCCCCCGCAGGGCTAATGGCATCCAAGGTCTGAGATTTATTATCCAGTCCGAGAAGCCGCCTCATTATTTAGAGAGCCGCGTGGAGGCCTTCTTTAAAGACCACAGAGAAGTCCCTGGAAGACATGGCGGATGAGGCGTTCCAGAAGCACATCCAGGCGCTGGCGATACGCCGTCTAGACAAGCCAAAGAAACTCTCTGCCGAGTGTGCTAAGTACTGGGGGGAAATCATTTCCCAGCAGTATAACTTTGATAGAGACAACATTGAAGTCGCCTATCTGAAGACTCTGGTAAAGGAAGATATCATGAACTTTTACAAGAATATGTTGTCTGTGGACGCCCCTAGAAGACACAAAGTATCTGTGCACGTTCTTTCCAGAGAGATGGATTCCTGTCCTGTAGTGGGTGAATTTCCAAGTCAAAATGATGTTAACCTCGCTCCAGCTCCAGCCCTTCCTCAGCCTGAGGTGATTAGCAATATGACGGAGTTCAAGAGGAGCTTGCCTCTCTTCCCTCTCGTCAAACCCCACATCAACTTCATGACCGCGAAATTATGATCCGAGCTGCAAACAGGACAACGACCACTGAACCAGGTGCTGCTTAAGATGTGCCGTGGCTTGCAAGTGAGGAGTCATTCTGGTTGCAGTAGTAGGACTTTGCACATAGACATTTAGTAAAACTATAATCTCTGTAGTACCGAAATCTGGTTGGTGTTGATTTTACATTGTAACGCATGGGCTGCATCAGGTGTCCTGTTGTGGATTGGTTGGTTGGTGTCACCTGATGCACACGCTGGCATTGACTGGCAAAGGAAGGACAAGTAGACTTTTACGAGGAAAGAATTATATTACACATAATGCTGAAATGCTGTAAATTATTTATGAACGTAGGATTATTCTTAAGGAAAAACAAAACCTTGGCTAACTAGACTGTTAGGTTTAGCTACAGTGCCACGGGTTTGTGCTGTGAGGCCGCCATCTTCCCCTGCGCAGTGTTTGACGTGACTTCATTGTGTTGACATTTTTGTTTAAAAGGGACACGTACCCACCTGTATGCAGTCAGTCCTCTTTATTTCAGTATCATANATTATAACTGGAGCACCCCCTGCTGTTCAGCCAGGGCCGGCGGGGGCCGGATAGAACAGCCAAAGCTTTATTTACTGATGTCATAGAGTAGATAAACGTCAGTAGACTCTTCCGGCATCGGTAACTTAAACTTTAGCTTTCTGTCCGCCCCCTGCCCAGACAGACCTGCAGGTGCTTCTATTACACATTCATATTAATTTGCAAAAGTGCTCTGGAGAGCAATTTTATATTGTTATGCGGGTGGGGGTATGTCCTTATTAAAAAGCCAATCAAGTGTGAGCTATTTAGAGAGAATGGCAAGCAGAGGCAGATACAGACTCTGTAACCCACCTCTGCGGGTGCTTTATCTCCACACAAGGTGCATGGCTGTAGCCCCCAGCAGGTAGCACTTTTGATGATAAGGTACAGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACTTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTTGTGTATGCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGTGTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGTGTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCGTGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACTGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATGA
  5   1   2  SIG                                    Xt7.1-TGas141o18.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGAAGACACAAAGTATCTGTGCACGTTCTTTCCAGAGAGATGGATTCCTGTCCTGTAGTGGGTGAATTTCCAAGTCAAAATGATGTTAACCTCGCTCCAGCTCCAGCCCTTCCTCAGCCTGAGGTGATTAGCAATATGACGGAGTTCAAGAGGAGCTTGCCTCTCTTCCCTCTCGTCAAACCCCACATCAACTTCATGACCGCGAAATTATGATCCGAGCTGCAAACAGGACAACGACCACTGAACCAGGTGCTGCTTAAGATGTGCCGTGGCTTGCAAGTGAGGAGTCATTCTGGTTGCAGTAGTAGGACTTTGCACATAGACATTTAGTAAAACTATAATCTCTGTAGTACCGAAATCTGGTTGGTGTTGATTTTACATTGTAACGCATGGGCTGCATCAGGTGTCCTGTTGTGGATTGGTTGGTTGGTGTCACCTGATGCACACGCTGGCATTGACTGGCAAAGGAAGGACAAGTAGACTTTTACGAGGAAAGAATTATATTACACATAATGCTGAAATGCTGTAAATTATTTATGAACGTAGGATTATTCTTAAGGAAAAACAAAACCTTGGCTAACTAGACTGTTAGGTTTAGCTACAGTGCCACGGGTTTGTGCTGTGAGGCCGCCATCTTCCCCTGCGCAGTGTTTGACGTGACTTCATTGTGTTGACATTTTTGTTTAAAAGGGACACGTACCCACCTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGT
  5   1   2  SIG                                      Xt7.1-CABE5252.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGATTATTCTTAAGGAAAAACAAAACCTTGGCTAACTAGACTGTTAGGTTTAGCTACAGTGCCACGGGTTTGTGCTGTGAGGCCGCCATCTTCCCCTGCGCAGTGTTTGACGTGACTTCATTGTGTTGACATTTTTGTTTAAAAGGGACACGTACCCACCTGTATGCAGTCAGTCCTCTTTATTTCAGGATCATAAATTATAACTGGAGCACCCCCTGCTGTTCAGCCAGGGGGGTTTATTTACTGATGCCATAGAGGAGATAAACGTCAGTAGACTTCGGCATCGGTAACTTAAACTTTAGCTTTCTGTCCGCCCCCTGCCCAGACAGAACTGCAGGTGGTGCTTCTACTACACATTCATATTAATTTGCAAAAGTGCTCTGGAGAGCAATTTTATATTGTTATGCGGGTGGGGGTATGTCCTTATTAAAAAGCCAATCAAGTGTGAGCTATTTAGAGAGAATGGCAAGCAGAGGCAGATACAGACTCTGTAACCCACCTCTGCGGGTGCTTTATCTCCACACAAGGTGCATGGCTGTAGCCCCCAGCAGGTACCACTTTTGATGATAAGGTACAGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACGTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGTGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTAGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACCCACCTCTGCGGGTGCTTTAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCATGGCTGTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACCACTTTTGATGATAAGGTACAGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACGTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAACTGTATTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGAAACTGTGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTGTGTATCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTACAGAAACTATGCATCATTTGTGTATGCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGTGTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----T--A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------T-T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------C--
                                               BLH MIN     695      13                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       
                                                                       ...PROTEIN --- Sc ---- 5e-041     NP_013493.2 Metalloprotease involved, with homolog Axl1p, in N-terminal processing of pro-a-factor to the mature form; member of the insulin-degrading enzyme family [Saccharomyces cerevisiae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Sp ==== 3e-069     XP_779964.2 PREDICTED: similar to LOC523752 protein, partial [Strongylocentrotus purpuratus] ========================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 4e-052     NP_504514.2 insulinase-like peptidase, family M16 and Peptidase M16 inactive (115.4 kD) (5G254) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 3e-076     NP_524182.2 CG5517-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 2e-127     XP_421686.2 PREDICTED: similar to insulin-degrading enzyme [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 0          XP_684736.1 PREDICTED: similar to insulin-degrading enzyme isoform 1 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_112419.1 insulin degrading enzyme [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_004960.1 insulysin [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-XZT52354.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATG---------------------------------------------------ATG---------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------TAA------------------------------TAA---TGATAG---------TGA---------------------------------------------------------------------------TAG------------------------------------------------------------TGA---------------TGA---TAA------------------------------TGA------TAG------------------------------------------------------------------------------ATG---------------------------------------------TAA------------------------------------------TAGTAG------------------------------TAA------TAG---------------------------------TAA---ATG---------------------------------------------TGA---------------TGA------------------------------------------------------ATG---------------------ATG------------------------------------------TAG---------------------------------------------------------------------------------------TGA---------------------------------ATG------------------------------------------------------------------------------TGA------TAG------------------ATG---TAG------TAA---------------------------------------------------------------------------------------------------TAA---------------------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------ATG------------------TAG------TGATGATAA------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------TAA---------------------------TAG------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------ATG---------TAA---------------------------------------TGA------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------TAG------------------TGA------------------------TAG------------------------------------------------------------------------TAA---------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------ATG---------------------------------------TGA---------------------------------------ATGTAA---ATG---------------ATG---------------------------------------------------------------------------------------------------------------------------TAG------------------------ATG---------------------------------------------------------------------------------------------TAA------------------------------------ATG---------------------ATG------------------TAA---------------------------ATG------------------------------------------ATG------------------------------------------------------TAG------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  5   1   2  SIG                                      Xt7.1-XZT52354.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGACAAGCAGCACATCTTGCTCAAGAAGATCATTGAGAAAATGGCTACCTTCGAAATAGATGAGAAAAGATTTGAAATTATTAAAGAAGCGTACATGCGATCTCTGAATAACTTCCGAGCAGAGCAGCCGCACCAGCACGCTATGTATTATCTCCGGTTGCTCATGACTGAAGTGGCTTGGACCAAGGATGAACTGAAAGAAGCTTTAGACGATGTCACCCTCCTGCGCCTGAAGGCCTTCATCCCTCAGCTGCTGTCTCGGCTGCACGTGGAAGCTCTTGTGCATGGAAACATCACAAAGCAGGCTGCCATGGGCATTATGCAGATGGTAGAGGACACCCTTATTGAACATGCCCACACTAAGCCTCTTCTTCCAAGTCAGCTGGTCCGATACCGAGAAGTACAGCTGCCAGACAGAGGCTGGTTTGTGTATCAGCAGAGGAACGAGGTCCATAATAACTGTGGCATTGAGATTTATTATCAGACGGACATGCAGAGCACATCGGAGAACATGCTGCTTGAACTTCTCTGCCAGATCATCTCCGAGCCTTGCTTCAACACGCTGCGCACCAAGGAGCAGTTAGGTTACATTGTGTTCAGCGGCCCCCGCAGGGCTAATGGCATCCAAGGTCTGAGATTTATTATCCAGTCCGAGAAGCCGCCTCATTATTTAGAGAGCCGCGTGGAGGCCTTCTTTAAAGACCACAGAGAAGTCCCTGGAAGACATGGCGGATGAGGCGTTCCAGAAGCACATCCAGGCGCTGGCGATACGCCGTCTAGACAAGCCAAAGAAACTCTCTGCCGAGTGTGCTAAGTACTGGGGGGAAATCATTTCCCAGCAGTATAACTTTGATAGAGACAACATTGAAGTCGCCTATCTGAAGACTCTGGTAAAGGAAGATATCATGAACTTTTACAAGAATATGTTGTCTGTGGACGCCCCTAGAAGACACAAAGTATCTGTGCACGTTCTTTCCAGAGAGATGGATTCCTGTCCTGTAGTGGGTGAATTTCCAAGTCAAAATGATGTTAACCTCGCTCCAGCTCCAGCCCTTCCTCAGCCTGAGGTGATTAGCAATATGACGGAGTTCAAGAGGAGCTTGCCTCTCTTCCCTCTCGTCAAACCCCACATCAACTTCATGACCGCGAAATTATGATCCGAGCTGCAAACAGGACAACGACCACTGAACCAGGTGCTGCTTAAGATGTGCCGTGGCTTGCAAGTGAGGAGTCATTCTGGTTGCAGTAGTAGGACTTTGCACATAGACATTTAGTAAAACTATAATCTCTGTAGTACCGAAATCTGGTTGGTGTTGATTTTACATTGTAACGCATGGGCTGCATCAGGTGTCCTGTTGTGGATTGGTTGGTTGGTGTCACCTGATGCACACGCTGGCATTGACTGGCAAAGGAAGGACAAGTAGACTTTTACGAGGAAAGAATTATATTACACATAATGCTGAAATGCTGTAAATTATTTATGAACGTAGGATTATTCTTAAGGAAAAACAAAACCTTGGCTAACTAGACTGTTAGGTTTAGCTACAGTGCCACGGGTTTGTGCTGTGAGGCCGCCATCTTCCCCTGCGCAGTGTTTGACGTGACTTCATTGTGTTGACATTTTTGTTTAAAAGGGACACGTACCCACCTGTATGCAGTCAGTCCTCTTTATTTCAGTATCATANATTATAACTGGAGCACCCCCTGCTGTTCAGCCAGGGCCGGCGGGGGCCGGATAGAACAGCCAAAGCTTTATTTACTGATGTCATAGAGTAGATAAACGTCAGTAGACTCTTCCGGCATCGGTAACTTAAACTTTAGCTTTCTGTCCGCCCCCTGCCCAGACAGACCTGCAGGTGCTTCTATTACACATTCATATTAATTTGCAAAAGTGCTCTGGAGAGCAATTTTATATTGTTATGCGGGTGGGGGTATGTCCTTATTAAAAAGCCAATCAAGTGTGAGCTATTTAGAGAGAATGGCAAGCAGAGGCAGATACAGACTCTGTAACCCACCTCTGCGGGTGCTTTATCTCCACACAAGGTGCATGGCTGTAGCCCCCAGCAGGTAGCACTTTTGATGATAAGGTACAGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACTTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTTGTGTATGCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGTGTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGTGTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCGTGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACTGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATGA
                                                  Xt7.1-CHK-1008280792                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAGCACATCTTGCTCAAGAAGATCATTGAGAAAATGGCTACCTTCGAAATAGATGAGAAAAGATTTGAAATTATTAAAGAAGCGTACATGCGATCTCTGAATAACTTCCGAGCAGAGCAGCCGCACCAGCACGCTATGTATTATCTCCGGTTGCTCATGACTGAAGTGGCTTGGACCAAGGATGAACTGAAAGAAGCTTTAGACGATGTCACCCTCCTGCGCCTGAAGGCCTTCATCCCTCAGCTGCTGTCTCGGCTGCACGTGGAAGCTCTTGTGCATGGAAACATCACAAAGCAGGCTGCCATGGGCATTATGCAGATGGTAGAGGACACCCTTATTGAACATGCCCACACTAAGCCTCTTCTTCCAAGTCAGCTGGTCCGATACCGAGAAGTACAGCTGCCAGACAGAGGCTGGTTTGTGTATCAGCAGAGGAACGAGGTCCATAATAACTGTGGCATTGAGATTTATTATCAGACGGACATGCAGAGCACATCGGAGAACATGCTGCTTGAACTTCTCTGCCAGATCATCTCCGAGCCTTGCTTCAACACGCTGCGCACCAAGGAGCAGTTAGGTTACATTGTGTTCAGCGGCCCCCGCAGGGCTAATGGCATCCAAGGTCTGAGATTTATTATCCAGTCCGAGAAGCCGCCTCATTATTTAGAGAGCCGCGTGGAGGCCTTCTTxAAxxxCCACAGAGAAGTCCCTGGAAGACATGGCGGATGAGGCGTTCCAGAAGCACATCCAGGCGCTGGCGATACGCCGTCTAGACAAGCCAAAGAAACTCTCTGCCGAGTGTGCTAAGTACTGGGGGGAAATCATTTCCCAGCAGTATAACTTTGATAGAGACAACATTGAAGTCGCCTATCTGAAGACTCTGGTAAAGGAAGATATCATGAACTTTTACAAGAATATGTTGTCTGTGGACGCCCCTAGAAGACACAAAGTATCTGTGCACGTTCTTTCCAGAGAGATGGATTCCTGTCCTGTAGTGGGTGAATTTCCAAGTCAAAATGATGTTAACCTCGCTCCAGCTCCAGCCCTTCCTCAGCCTGAGGTGATTAGCAATATGACGGAGTTCAAGAGGAGCTTGCCTCTCTTCCCTCTCGTCAAACCCCACATCAACTTCATGACCGCGAAATTATGATCCGAGCTGCAAACAGGACAACGACCACTGAACCAGGTGCTGCTTAAGATGTGCCGTGGCTTGCAAGTGAGGAGTCATTCTGGTTGCAGTAGTAGGACTTTGCACATAGACATTTAGTAAAACTATAATCTCTGTAGTACCGAAATCTGGTTGGTGTTGATTTTACATTGTAACGCATGGGCTGCATCAGGTGTCCTGTTGTGGATTGGTTGGTTGGTGTCACCTGATGCACACGCTGGCATTGACTGGCAAAGGAAGGACAAGTAGACTTTTACGAGGAAAGAATTATATTACACATAATGCTGAAATGCTGTAAATTATTTATGAACGTAGGATTATTCTTAAGGAAAAACAAAACCTTGGCTAACTAGACTGTTAGGTTTAGCTACAGTGCCACGGGTTTGTGCTGTGAGGCCGCCATCTTCCCCTGCGCAGTGTTTGACGTGACTTCATTGTGTTGACATTTTTGTTTAAAAGGGACACGTACCCACCTGTATGCAGTCAGTCCTCTTTATTTCAGTATCATANATTATAACTGGAGCACCCCCTGCTGTTCAGCCAGGGCCGGCGGGGGCCGGATAGAACAGCCAAAGCTTTATTTACTGATGTCATAGAGTAGATAAACGTCAGTAGACTCTTCCGGCATCGGTAACTTAAACTTTAGCTTTCTGTCCGCCCCCTGCCCAGACAGACCTGCAGGTGCTTCTATTACACATTCATATTAATTTGCAAAAGTGCTCTGGAGAGCAATTTTATATTGTTATGCGGGTGGGGGTATGTCCTTATTAAAAAGCCAATCAAGTGTGAGCTATTTAGAGAGAATGGCAAGCAGAGGCAGATACAGACTCTGTAACCCACCTCTGCGGGTGCTTTATCTCCACACAAGGTGCATGGCTGTAGCCCCCAGCAGGTAGCACTTTTGATGATAAGGTACAGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACTTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTTGTGTATGCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGTGTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGTGTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCGTGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACTGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTT
  5   1   2       ext HdA       in                  THdA024e10.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAAGATTCCCTCAACGAGTATGCATATGCAGCAGAGCTAGCCGGGTTGAACTATGATCTGCAAAATACCATCTATGGGATGTATCTCTCTCTGAAAGGATACAGCGACAAGCAGCACATCTTGCTCAAGAAGATCATTGAGAAAATGGCTACCTTCGAAATAGATGAGAAAAGATTTGAAATTATTAAAGAAGCGTACATGCGATCTCTGAATAACTTCCGAGCAGAGCAGCCGCACCAGCACGCTATGTATTATCTCCGGTTGCTCATGACTGAAGTGGCTTGGACCAAGGATGAACTGAAAGAAGCTTTAGACGATGTCACCCTCCTGCGCCTGAAGGCCTTCATCCCTCAGCTGCTGTCTCGGCTGCACGTGGAAGCTCTTGTGCATGGAAACATCACAAAGCAGGCTGCCATGGGCATTATGCAGATGGTAGAGGACACCCTTATTGAACATGCCCACACTAAGCCTCTTCTTCCAAGTCAGCTGGTCCGATACCGAGAAGTACAGCTGCCAGACAGAGGCTGGTTTGTGTATCAGCAGAGGAACGAGGTCCATAATAACTGTGGCATTGAGATTTATTATCAGACGGACATGCAGAGCACATCGGAGAACATGCTGCTTGAACTTCTCTGCCAGATCATCTCCGAGCCTTGCTTCAACACGCTGCGCACCAAGGAGCAGTTAGGTTACATTGTGTTCAGCGGCCCCCGCAGGGCTAATGGCATCCAAGGTCTGAGATTTATTATCCAGTCCGAGAAGCCGCCTCATTATTTAGAGAGCCGCGTGGAGGCCTTC
  5   1   4      seed TbA       in                   TTbA002c13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGACAAGCAGCACATCTTGCTCAAGAAGATCATTGAGAAAATGGCTACCTTCGAAATAGATGAGAAAAGATTTGAAATTATTAAAGAAGCGTACATGCGATCTCTGAATAACTTCCGAGCAGAGCAGCCGCACCAGCACGCTATGTATTATCTCCGGTTGCTCATGACTGAAGTGGCTTGGACCAAGGATGAACTGAAAGAAGCTTTAGACGATGTCACCCTCCTGCGCCTGAAGGCCTTCATCCCTCAGCTGCTGTCTCGGCTGCACGTGGAAGCTCTTGTGCATGGAAACATCACAAAGCAGGCTGCCATGGGCATTATGCAGATGGTAGAGGACACCCTTATTGAACATGCCCACACTAAGCCTCTTCTTCCAAGTCAGCTGGTCCGATACCGGGAAGTACAGCTGCCAGACAGAGGCTGGTTTGTGTATCAGCAGAGGAACGAGGTCCATAATAACTGTGGCATTGAGATTTATTATCAGACGGACATGCAGAGCACATCGGAGAACATGCTGCTTGAACTTCTCTGCCAGATCATCTCCGAGCCCTGCTTCAACACGCTGCGCACCAAGGAGCAGTTAGGTTACATTGTGTTCAGCGGCCCCCGCAGGGCTAATGGCATCCAAGGTCTGAGATTTATTATCCAGTCCGAGAAGCCGCCTCATTATTTAGAGAGCCGCGTGGAGGCCTTCTTAAAGACCACAGAGAAGTCCCTGGAAGACATGGCGGATGAGGCGTTCCAGAAGCACATCCAGGCGCTGGCGATACGCCGTCTAGACAAGCCAAAGAAACTCTCTGCCGAGTGTGCTAAGTACTGGGGGGGAAATCATTTTCCAGCAGTATAACTTTGATAG
  5   1   3        nb Gas7                                  XZG5753.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATAGATGAGAAAAGATTTGAAATTATTAAAGAAGCGTACATGCGATCTCTGAATAACTTCCGAGCAGAGCAGCCGCACCAGCACGCTATGTATTATCTCCGGTTGCTCATGACTGAAGTGGCTTGGACCAAGGATGAACTGAAAGAAGCTTTAGACGATGTCACCCTCCTGCGCCTGAAGGCCTTCATCCCTCAGCTGCTGTCTCGGCTGCACGTGGAAGCTCTTGTGCATGGAAACATCACAAAGCAGGCTGCCATGGGCATTATGCAGATGGTAGAGGACACCCTTATTGAACATGCCCACACTAAGCCTCTTCTTCCAAGTCAGCTGGTCCGATACCGAGAAGTACAGCTGCCAGACAGAGGCTGGTTTGTGTATCAGCAGAGGAACGAGGTCCATAATAACTGTGGCATTGAGATTTATTATCAGACGGACATGCAGAGCACATCGGAGAACATGCTGCTTGAACTTCTCTGCCAGATCATCTCCGAGCCTTGCTTCAACACGCTGCGCACCAAGGAGCAGTTAGGTTACATTGTGTTCAGCGGCCCCCGCAGGGCTAATGGCATCCAAGGTCTGAGATTTATTATCCAGTCCGAGAAGCCGCCTCATTATTTAGAGAGCCGCGTGGAGGCCTTCTTAAAGACCACAGAGAAGTCCCTGGAAGACATGGCGGATGAGGCGTTCCAGAAGCACATCCAGGCGCTGGCGATACGCCGTCTAGACAAGCCAAAGAAACTCTCTGCCGAGTGTGCTAAGTACTGGGGGGAAATCATTTCCCAGCAGTATAACTTTGATAGAGACAACATTGAAGTCGCCTATCTGAAGACTCTGGTAAAGGAAGATATCATGAACTTTTACAAGAATATGTTGTCTGTGGATG
  3   1   3        nb Te4  5g3  out                        CAAN5799.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCAGATCATCTCCGAGCCTTGCTTCAACACGCTGCGCACCAAGGAGCAGTTAGGTTACATTGTGTTCAGCGGCCCCCGCAGGGCTAATGGCATCCAAGGTCTGAGATTTATTATCCAGTCCGAGAAGCCGCCTCATTATTTAGAGAGCCGCGTGGAGGCCTTCTTAAAGACCACAGAGAAGTCCCTGGAAGACATGGCGGATGAGGCGTTCCAGAAGCACATCCAGGCGCTGGCGATACGCCGTCTAGACAAGCCAAAGAAACTCTCTGCCGAGTGTGCTAAGTACTGGGGGGAAATCATTTCCCAGCAGTATAACTTTGATAGAGACAACATTGAAGTCGCCTATCTGAAGACTCTGGTAAAGGAAGATATCATGAACTTTTACAAGAATATGTTGTCTGTGGACGCCCCTAGAAGACACAAAGTATCTGTGCACGTTCTTTCCAGAGAGATGGATTCCTGTCCTGTAGTGGGTGAATTTCCAAGTCAAAATGATGTTAACCTCGCTCCAGCTCCAGCCCTTCCTCAGCCTGAGGTGATTAGCAATATGACGGAGTTCAAGAGGAGCTTGCCTCTCTTCCCTCTCGTCAAACCCCACATCAACTTCATGACCGCGAAATTATGATCCGAGCTGCAAACAGGACAACGACCACTGAACCAGGTGCTGCTTAAGATGTGCCGTGGCTTGCAAGTGAGGAGTCATTCTGGTTGCAGTAGTAGGACTTTGCACATAGACATTTAGTAAAACTATAATCTCTGT
  3   1   3        nb Te4  5g3  out                        CAAN2540.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGCCCTGCTTCAACACGCTGCGCANCAAGGAGCAGTTAGGTTACATTGTGTTCAGCGGCCCCCGCAGGGCTAATGGCATCCAAGGTCTGAGATTTATTATCCAGTCCGAGAAGCCGCCTCATTATTTAGAGAGCCGCGTGGAGGCCTTCTTAAAGACCACAGAGAAGTCCCTGGAAGACATGGCGGATGAGGCGTTCCAGAAGCACATCCAGGCGCTGGCGATACGCCGTCTAGACAAGCCAAAGAAACTCTCTGCCGAGTGTGCTAAGTACTGGGGGGAAATCATTTCCCAGCAGTATAACTTTGATAGAGACAACATTGAAGTCGCCTATCTGAAGACTCTGGTAAAGGAAGATATCATGAACTTTTACAAGAATATGTTGTCTGTGGACGCCCCTAGAAGACACAAAGTATCTGTGCACGTTCTTTCCAGAGAGATGGATTCCTGTCCTGTAGTGGGTGAATTTCCAAGTCAAAATGATGTTAACCTCGCTCCAGCTCCAGCCCTTCCTCAGCCTGAGGTGATTAGCAATATGACGGAGTTCAAGAGGAGCTTGCCTCTCTTCCCTCTCGTCAAACCCCACATCAACTTCATGACCGCGAAATTATGATCCGAGCTGCAAACAGGACAACGACCACTGAACCAGGTGCTGCTTAAGATGTGCCGTGGCTTGCAAGTGAGGAGTCATTCTGGTTGCAGTAGTAGGACTTTGCACATAGACATTTAGTAAAACTATAATCTCTGT
  5   1   0       chi HdA       out                  THdA053j16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCCGCCTCATTATTTATAGAGCCGCGTGGAGGCCTTCTTAAAGACCACAGAGAAGTCCCTGGAAGACATGGCGGATGAGGCGTTCCAGAAGCACATCCAGGCGCTGGCGATACGCCGTCTAGACAAGCCAAAGAAACTCTCTGCCGAGTGTGCTAAGTACTGGGGGGAAATCATTTCCCAGCAGTATAACTTTGATAGAGACAACATTGAAGTCGCCTATCTGAAGACTCTGGTAAAGGAAGATATCATGAACTTTTACAAGGTAACCAGCTGTCTTACTGTATGGGCCCAAAACAGTAATGATCCAGCCGCCCACATCAGGTCCCTGTCTTCTCATACTGTCAGACCATCTTGGGTGCCTGTCAGCTTATTGCTGTAGTTCAGTGGGATCTCTCTCTATACATCTGCTTGCAGAATGAACAGTTCCAGCGCTTATTTCATGATCACAGCTTTATTAGCACAAGTATGGAGACTTCACATTCAGGCAGACCATAAGGATAAGGGACTTGCGTCATCGCTAGGGTGTAAAATATTTTATAAAATAATCATTTTCAGTTCTAAATTTACATGCTTTGTCCTCAACACTGGTGAATGTGGGCTAGCAGCACCCCCAGGCGGCTCTCGGGCATGTTACCTAGCAACCTGACTGGCATTTGGACTGTCACAAGGGAATTAATTTGGTGACTAATCTTCTGTACTAGCAAAAAAAAAAAAAAGTCATTGACTTCTACAAAGGAAAATTGTTTGAAATAATCATAGACCATATTATGCAGTATGAACACCAGAACCCCAAGGAATAGGCCGCATATTATATTAAGTAGGAGTGCTTCCCAAAGTATGCATCATTTCATCTA
  3   1   3        nb Te4  5g3  out                       CAAN10340.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAAAGACCACAGAGAAGTCCCTGGAAGACATGGCGGATGAGGCGTTCCAGAAGCACATCCAGGCGCTGGCGATACGCCGTCTAGACAAGCCAAAGAAACTCTCTGCCGAGTGTGCTAAGTACTGGGGGGAAATCATTTCCCAGCAGTATAACTTTGATAGAGACAACATTGAAGTCGCCTATCTGAAGACTCTGGTAAAGGAAGATATCATGAACTTTTACAAGAATATGTTGTCTGTGGACGCCCCTAGAAGACACAAAGTATCTGTGCACGTTCTTTCCAGAGAGATGGATTCCTGTCCTGTAGTGGGTGAATTTCCAAGTCAAAATGATGTTAACCTCGCTCCAGCTCCAGCCCTTCCTCAGCCTGAGGTGATTAGCAATATGACGGAGTTCAAGAGGAGCTTGCCTCTTTTCCCTCTCGTCAAACCCCACATCAACTTCATGACCGCGAAATTATGATCCGAGCTGCAAACAGGACAACGACCACTGAACCAGGTGCTGCTTAAGATGTGCCGTGGCTTGCAAGTGAGGAGTCATTCTGGTTGCAGTAGTAGGACTTTGCACATAGACATTTAGTAAAACTATAATCTCGGT
  5   1   3        nb Gas7                                 XZG12451.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACATCCAGGCGCTGGCGATACGCCGTCTAGACAAGCCAAAGAAACTCTCTGCCGAGTGTGCTAAGTACTGGGGGGAAATCATTTCCCAGCAGTATAACTTTGATAGAGACAACATTGAAGTCGCCTATCTGAAGACTCTGGTAAAGGAAGATATCATGAACTTTTACAAGAATATGTTGTCTGTGGATGCCCCTAGAAGACACAAAGTATCTGTGCACGTTCTTTCCAGAGAGATGGATTCCTGTCCTGTAGTGGGTGAATTTCCAAGTCAAAATGATGTTAACCTCGCTCCAGCTCCAGCCCTTCCTCAGCCTGAGGTGATTAGCAATATGACGGAGTTCAAGAGGAGCTTGCCTCTCTTCCCTCTCGTCAAACCCCACATCAACTTCATGACCGCGAAATTATGATCCGAGCTGCAAACAGGACAACGACCACTGAACCAGGTGCTGCTTAAGATGTGCCGTGGCTTGCAAGTGAGGAGTCATTCTGGTTGCAGTAGTAGGACTTTGCACATAGACATTTAGTAAAACTATAATCTCTGTAGTACCGAAATCTGGTTGGTGTTGATTTTACATTGTAACGCATGGGCTGCATCAGGTGTCCTGTTGTGGATTGGTTGGTTGGTGTCACCTGATGCACACGCTGGCATTGACTGGCAAAGGAAGGACAAGTAGACTTTTACGAGGAAAGAATTATATTACACATAATGCTGAAATGCTGTAAATTATTTATGAACGTAGGATTATTCTTAA
  5   1   2       ext Gas7                                 XZG43604.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCTGCCGAGTGTGCTAAGTACTGGGGGGAAATCATTTCCCAGCAGTATAACTTTGATAGAGACAACATTGAAGTCGCCTATCTGAAGACTCTGGTAAAGGAAGATATCATGAACTTTTACAAGAATATGTTGTCTGTGGATGCCCCTAGAAGACACAAAGTATCTGTGCACGTTCTTTCCAGAGAGATGGATTCCTGTCCTGTAGTGGGTGAATTTCCAAGTCAAAATGATGTTAACCTCGCTCCAGCTCCAGCCCTTCCTCAGCCTGAGGTGATTAGCAATATGACGGAGTTCAAGAGGAGCTTGCCTCTCTTCCCTCTCGTCAAACCCCACATCAACTTCATGACCGCGAAATTATGATCCGAGCTGCAAACAGGACAACGACCACTGAACCAGGTGCTGCTTAAGATGTGCCGTGGCTTGCAAGTGAGGAGTCATTCTGGTTGCAGTAGTAGGACTTTGCACATAGACATTTAGTAAAACTATAATCTCTGTAGTACCGAAATCTGGTTGGTGTTGATTTTACATTGTAACGCATGGGCTGCATCAGGTGTCCTGTTGTGGATTGGTTGGTTGGTGTCACCTGATGCACACGCTGGCATTGACTGGCAAAGGAAGGACAAGTAGACTTTTACGAGGAAAGAATTATATTACACATAATGCTGAAATGCTGTAAATTATTTATGAACGTAGGATTATTCTTAAGGAAAAACAAAACCTTGGCTAACTAGACTGTTAGGTTTAGCTACAGTGCCACGGGTTTGTGCTGTGAGGCCGCCATCTTCCCCTGCGCAGTGTTTGACGTGACTTCATTTGTGTGACATTTTTGTT
  5   1   2       ext Te4       in                         CAAN9435.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGATTCCTGTCCTGTAGTGGGTGAATTTCCAAGTCAAAATGAGTGTTAACCTCGCTCCAGCTCCAGCCCTTCCTCAGCCTGAGGTGATTAGCAATATGACGGAGTTCAAGAGGAGCTTGCCTCTCTTCCCTCTCGTCAAACCCCACATCAACTTCATGACCGCGAAATTATGATCCGAGCTGCAAACAGGACAACGACCACTGAACCAGGTGCTGCTTAAGATGTGCCGTGGCTTGCAAGTGAGGAGTCATTCTGGTTGCAGTAGTAGGACTTTGCACATAGACATTTAGTAAAACTATAATCTCTGTAGTACCGAAATCTGGTTGGTGTTGATTTTACATTGTAACGCATGGGCTGCATCAGGTGTCCTGTTGTGGATTGGTTGGTTGGTGTCACCTGATGCACACGCTGGCATTGACTGGCAAAGGAAGGACAAGTAGACTTTTACGAGGAAAGAATTATATTACACATAATGCTGAAATGCTGTAAATTATTTATGAACGTAGGATTATTCTTAAGGAAAAACAAAACCTTGGCTAACTAGACTGTTAGGTTTAGCTACAGTGCCACAGGTTTGTGCTGTGAGGCCGCCATCTTCCCCTGCGCAGTGTTTGACGTGACTTCATTGTGTTGACATTTTTGTTTAAAAGGGACACGTACCCACCTGTATGCAGTCAGTCCTCTTTATTTCAGTATCATANATTATAACTGGAGCACCCCCTGCTGTTCAGCCAGGGCCGGCGGNNGCCGGATAGAACAGCCAAAGCTTTATTTACTGATGTCATAGAGTAGATAAACGTCAGTAGACTCTTCCGGCATCGGTAACTTAAACTTTAGCTTTCTGTCCGCCCCCT
  5   1   2       add In63                            IMAGE:8961898.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAGCTTTATTTATGAATGATTCATTAATTTTAAATCTCCCCTCCAGCCCTTCCTCAGCCTGAGGTGATTAGCAATATGACGGAGTTCAAGAGGAGCTTGCCTCTCTTCCCTCTCGTCAAACCCCACATCAACTTCATGACCGCGAAATTATGATCCGAGCTGCAAACAGGACAACGACCACTGAACCAGGTGCTGCTTAAGATGTGCCGTGGCTTGCAAGTGAGGAGTCATTCTGGTTGCAGTAGTAGGACTTTGCACATAGACATTTAGTAAAACTATAATCTCTGTAGTACCGAAATCTGGTTGGTGTTGATTTTACATTGTAACGCATGGGCTGCATCAGGTGTCCTGTTGTGGATTGGTTGGTTGGTGTCACCTGATGCACACGCTGGCATTGACTGGCAAAGGAAGGACAAGTAGACTTTTACGAAGAAAGAATTATATTACACATAATGCTGAAATGCTGTAAATTATTTATGAACGTAGGATTATTCTTAAGGAAAAACAAAACCTTGGCTAACTAGACTGTTAGGTTTAGCTACAGTGCCACGGGTTTGTGCTGTGAGGCGCCATCTTCCCCTGCGCAGTGTTTGACGTGACTTCATGTGTGACATTTTTGTTTAAACGGACACGTACCCACCTGTATGCAGTCAGTCCTCTTTATTTCAGTATCATAAATATACTGAGCACCCCTGCTGTCAGCAGGGGGTACTACTGATGCATAAGTAGATTACGTCAGTAGACTCGCATCGTAACTTAACCTAGCTTCGTCGCCCTGCTGACGACTGCAGTGGCTCATACATCATATGCAATGCTGAGCATATGTAGCGTGGATGTCTATCAGCATCAGTGGACAT
  5   1   3        nb Thy1                                CBST7600.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTCGCTCCAGCTCCAGCCCTTCCTCAGCCTGAGGTGATTAGCAATATGACGGAGTTCAAGAGGAGCTTGCCTCTCTTCCCTCTCGTCAAACCCCACATCAACTTCATGACCGCGAAATTATGATCCGAGCTGCAAACAGGACAACGACCACTGAACCAGGTGCTGCTTAAGATGTGCCGTGGCTTTGCAGTGAGGAGTCATTCTGGTTGCAGT
  3   1   3        nb Gas1 5g3  out                    NISC_mq14e02.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAGGTGATTAGCAATATGACGGAGTTCAAGAGGAGCTTGCCTCTCTTCCCTCTCGTCAAACCCCACATCAACTTCATGACCGCGAAATTATGATCCGAGCTGCAAACAGGACAACGACCACTGAACCAGGTGCTGCTTAAGATGTGCCGTGGCTTGCAAGTGAGGAGTCATTCTGGTTGCAGTAGTAGGACTTTGCACATAGACATTTAGTAAAACTATAATCTCTGTAGTACCGAAATCTGGTTGGTGTTGATTTTACATTGTAACGCATGGGCTGCATCAGGTGTCCTGTTGTGGATTGGTTGGTTGGTGTCACCTGATGCACACGCTGGCATTGACTGGCAAAGGAAGGACAAGTAGACTTTTACGAGGAAAGAATTATATTACACATAATGCTGAAATGCTGTAAATTATTTATGAACGTAGGATTATTCTTAAGGAAAAACAAAACCTTGGCTAACTAGACTGTTAGGTTTAGCTACAGTGCCACGGGTTTGTGCTGTGAGGCCGCCATCTTCCCCTGCGCAGTGTTTGACGTGACTTCATTGTGTTGACATTTTTGTTTAATAAAAAAAAAAAAAAAAG
  5   1   2       add Gas7      in                         XZG33391.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGACCACTGAACCAGGTGCTGCTTAAGATGTGCCGTGGCTTGCAAGTGAGGAGTCATTCTGGTTGCAGTAGTAGGACTTTGCACATAGACATTTAGTAAAACTATAATCTCTGTAGTACCGAAATCTGGTTGGTGTTGATTTTACATTGTAACGCATGGGCTGCATCAGGTGTCCTGTTGTGGATTGGTTGGTTGGTGTCACCTGATGCACACGCTGGCATTGACTGGCAAAGGAAGGACAAGTAGACTTTTACGAGGAAAGAATTATATTACACATAATGCTGAAATGCTGTAAATTATTTATGAACGTAGGATTATTCTTAAGGAAAAACAAAACCTTGGCTAACTAGACTGTTAGGTTTAGCTACAGTGCCACGGGTTTGTGCTGTGAGGCCGCCATCTTCCCCTGCGCAGTGTTTGACGTGACTTCATTGTGTTGACATTTTTGTTTAAAAGGGACACGTACCCACCTGTATGCAGTCAGTCCTCTTTATTTCAGTATCATAAATTATAACTGGAGCACCCCCTGCTGTTCAGCCAGGGGGGTTTATTTACTGATGCCATAGAGTAGATAAACGTCAGTAGACTTCGGCATCGGTAACTTAAACTTTAGCTTTCTGTCCGCCCCCTGCCCAGACAGAACTGCAGGTGGTGCTTCTACTACACATTCATATTAATTTGCAAAAGTGCTCTGGAGAGCAATTTTATATTGTTATGCGGGTGGGGGTATGTCCTTATTAAAAAGCCAATCAAAATCAAAACAAAAAAAAAAAAAAAAAAATTAAA
  3   1   2       add Gas7      in                         XZG33391.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTGGCATTGACTGGCAAAGGAAGGCCAAGTAGACTTTTCCGAGGAAAGAATTATATTCCCCATAATGCTGAAATGCTGTAAATTATTTATGAACGTAGGATTATTCTTAAGGAAAAACAAAACCTTGGCTAACTAGACTGTTAGGTTTAGCTACAGTCCCACGGGTTTGTGCTGTGAGGCCCCCATTTTCCCCTGCGCAGTGTTTGACGTGACTTCATTGTGTTGACATTTTTGTTTAAAAGGGACACGTACCCCCCTGTATGCAGTCAGTCCTCTTTATTTCAGTTTCATAAATTATAACTGGAGCCCCCCCTGCTGTTCACCCAGGGGGGTTTTTTTACTGATCCCATAGAGTAGATAAACGTCAGTAGACTTCGGCATCGGTAACTTAAACTTTAGCTTTCTGTCCCCCCCCTGCCCAGACAGAACTGCAGGGGGTGCTTTTACTACCCATTCATATTAATTTGCAAAAGTGCTCTGGAGAGCAATTTTATATTTTTATGCGGGGGGGGGTATGTCCTTTTTAAAAACCCATTCAAATTCAAACCAAAAAAAAAAAAAAAAAATT
  5   1   2       add In66                            IMAGE:8963050.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTGGAAGGCCGCCATCTTCCCCTGCGCAGTGTTTGACGTGACTTCATTGTGTTGACATTTTTGTTTAAAAGGGACACGTACCCACCTGTATGCAGTCAGTCCTCTTTATTTCAGTATCATAAATTATAACTGGAGCACCCCCTGCTGTTCAGCCAGGGGGGTTTATTTACTGATGCCATAGAGTAGATAAACGTCAGTAGACTTCGGCATCGGTAACTTAAACTTTAGCTTTCTGTCCGCCCCCTGCCCAGACAGAACTGCAGGTGGTGCTTCTACTACACATTCATATTAATTTGCAAAAGTGCTCTGGAGAGCAATTTTATATTGTTATGCGGGTGGGGGTATGTCCTTATTAAAAAGCCAATCAAGTGTGAGCTATTTAGAGAGAATGGCAAGCAGAGGCAGATACAGACTCTGTAACCCACCTCTGCGGGTGCTTTATCTCCACACAAGGTGCATGGCTGTAGCCCCCAGCAGGTACCACTTTTGATGATAAGGTACAGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACGTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGTGCATTTGTGTATCCATGGCACTGTATTGCAAACTGTGCGCATTTGTGTTATCATGCACTGATGCAGACTGGTGTGCACATTTGGTGTATCATGCAGTGATACAGAACTATGGCATCATAGGTATCATGCAAAGCTTGCATTGCGAACCTGCCACATTTGTGTGTATTC
  5  -1   0       add Te3       in                         CAAM8870.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGCCACTCCACATTCATATTAATTTGCAGTAGAAACACCACCTGCAGTTCTGTCTGGACAGGGGGCGGACAGAAAGCCAAAGCTTTATTTACTGATGTCATAGAGTAGATAAACGTCAGTAGACTCTTCCGGCATCGGTAACTTAAACTTTAGCTTTCTGTCCGCCCCCTGCCCAGACAGAACTGCAGGTGGTGCTTCTACTGCAAATTAATATGAATGTGTAG
  5   1   2       ext Tad5      in                         XZT17091.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACCCCCTGCTGTTCAGCCAGGGCCGGCGGGGGCCGGATAGAACAGCCAAAGCTTTATTTACTGATGTCATAGAGTAGATAAACGTCAGTAGACTCTTCCGGCATCGGTAACTTAAACTTTAGCTTTCTGTCCGCCCCCTGCCCAGACAGACCTGCAGGTGCTTCTATTACACATTCATATTAATTTGCAAAAGTGCTCTGGAGAGCAATTTTATATTGTTATGCGGGTGGGGGTATGTCCTTATTAAAAAGCCAATCAAGTGTGAGCTATTTAGAGAGAATGGCAAGCAGAGGCAGATACAGACTCTGTAACCCACCTCTGCGGGTGCTTTATCTCCACACAAGGTGCATGGCTGTAGCCCCCAGCAGGTAGCACTTTTGATGATAAGGTACAGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACTTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTTGTGTATGCATGGAAACTGCATTGGCGAAACTGCCCATTTGTGTAT
  3  -1   2       ext Ski1      in                         CABJ7016.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGGCATCGGTAACTTAAACTTTAGCTTTCTGTCCGCCCCCTGCCCAGACAGACCTGCAGGTGCTTCTATTACACATTCATATTAATTTGCAAAAGTGCTCTGGAGAGCAATTTTATATTGTTATGCGGGTGGGGGTATGTCCTTATTAAAAAGCCAATCAAGTGTGAGCTATTTAGAGAGAATGGCAAGCAGAGGCAGATACAGACTCTGTAACCCACCTCTGCGGGTGCTTTATCTCCACACAAGGTGCATGGCTGTAGCCCCCAGCAGGTAGCACTTTTGATGATAAGGTACAGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACTTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTTGTGTATGCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTAT
  5   1   2       ext Gas7 5g3  in                         XZG56182.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCACGCGTCCGAAACTTTAGCTTTCTGTCCGCCCCCTGCCCAGACAGACCTGCAGGTGCTTCTATTACACATTCATATTAATTTGCAAAAGTGCTCTGGAGAGCAATTTTATATTGTTATGCGGGTGGGGGTATGTCCTTATTAAAAAGCCAATCAAGTGTGAGCTATTTAGAGAGAATGGCAAGCAGAGGCAGATACAGACTCTGTAACCCACCTCTGCGGGTGCTTTATCTCCACACAAGGTGCATGGCTGTAGCCCCCAGCAGGTAGCACTTTTGATGATAAGGTACAGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACTTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTTGTGTATGCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATG
  5   1   3        nb AbdN 5x                            IMAGE:7023258                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCTTCTACTACACATTCATATTAATTTGCAAAAGTGGCTCTGGAGAGCAATTTTATATTGTTATGCGGGTGGGGGTATGTCCTTATTAAAAAGCCAATCAAGTGTGAGCTATTTAGAGAGAATGGCAAGCAGAGGCAGATACAGACTCTGTAACCCACCTCTGCGGGTGCTTTATCTCCACACAAGGTGCATGGCTGTAGCCCCCAGCAGGTACCACTTTTGATGATAAGGTACAGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACGTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGTGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTAGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACAT
  5   1   3        nb Eye                                  CCAX2937.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACACATTCATATTAATTTGCAAAAGTGCTCTGGAGAGCAATTTTATATTGTTATGCGGGTGGGGGTATGTCCTTATTAAAAAGCCAATCAAGTGTGAGCTATTTAGAGAGAATGGCAAGCAGAGGCAGATACAGACTCTGTAACCCACCTCTGCGGGTGCTTTATCTCCACACAAGGTGCATGGCTGTAGCCCCCAGCAGGTACCACTTTTGATGATAAGGTACAGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACGTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGTGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTAGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAAACTGTGTGCACATTTGTGTATCCATGGCAACTG
  5   1   3        nb Egg  5g                        TEgg141i05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTGCAAAGTGCTTCTTGGAGAGCAATTTTATATTGTTATTGCGGGTGGGGGTATGTCCTTATTAAAAAGCCAATCAAGTGTGAGCTATTTAGAGAGAATGGCAAGCAGAGGCAGATACAGACTCTGTAACCCACCTCTGCGGGTGCTTTATCTCCACACAAGGTGCATGGCTGTAGCCCCCAGCAGGTAGCACTTTTGATGATAAGGTACAGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACTTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTTGTGTATGCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCA
  5   1   3        nb Gas1 5x                            IMAGE:6987137                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGCTCTCGGAGAGCAATTTTATATTGTTATGCGGGTGGGGGTATGTCCTTATTAAAAAGCCAATCAAGTGTGAGCTATTTAGAGAGAATGGCAAGCAGAGGCAGATACAGACTCTGTAACCCACCTCTGCGGGTGCTTTATCTCCACACAAGGTGCATGGCTGTAGCCCCCAGCAGGTACCACTTTTGATGATAAGGTACAGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACGTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGTGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTAGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCAT
  5   1   2       ext Tad5      in                         XZT52354.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACTTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTTGTGTATGCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGTGTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTA
  5   1   3        nb Eye                                  CCAX3089.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACTTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTTGTGTATGCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGTGTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCA
  5   1   3        nb Neu  5g                        TNeu001c21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCACTGCTTCATGCCTTGGAGAGATTGTGGGGGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGTGCATTTGTGTATCCATGGCAACTGTGGTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTAGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGT
  5   1   3        nb Gas7      in                         XZG29196.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTGCACATTTGTGTATTCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTTGTGTATGCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGGAGTTGTGTTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCA
  5   1   3        nb Tad5      in                         XZT65868.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGACGCGTGGGGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTTGTGTATGCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGTGTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGTGTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGTATATTTGTGTATCCATGGCAACTGTATTACAAAAACTGGGTGCACATTTGTGTATCCATGGAAACTGTATTGCAAAAACTGTG
  5   1   3        nb Tad5                                 XZT15505.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTTGTGTATGCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGTGTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGTGTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCA
  5   1   2       ext Tad5      in                         XZT44203.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGTGTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGTGTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCGTGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACTGAGGGGCGCTTTACAGAAAACACTCAAATACCTCTT
  5   1   3        nb Eye       in                         CCAX4962.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGTGTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGTGTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCGTGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTATCCTATCCCTTAGTGTTTAC
  5   1   2       add Gas7                                  XZG8034.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGTGTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGTGTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCGTGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCANATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGA
  5   1   3        nb Gas                            TGas025h20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCCGGGNAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGTGTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGTGTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCGTGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACTGAGGGGCGCTTTACAGAAACCACTCAAATA
  5   1   2       add Gas7      in                         XZG50857.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCGTGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTT
  5  -1   2       ext Ski1      in                         CABJ7016.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCGTGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACTGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAAGTGTTTTATTTAAATGAAAAAAAAA
  3   1   2       ext Tad5      in                         XZT52354.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCGTGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACTGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATG
  3   1   2       add Te3       in                         CAAM8870.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATG
  3   1   3        nb Tad5      in                         XZT65868.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCGTGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACTGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTT
  3   1   2       ext Te4       in                         CAAN9435.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCGTGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACTGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATG
  3   1   4      seed TbA       in                    TTbA002c13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCGTGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACTGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAAGTGTTTTATTTAAATGAAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       ext Gas7 5g3  in                         XZG56182.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCGTGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACTGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATG
  3   1   2       ext Tad5      in                         XZT44203.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCGTGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACTGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTT
  3   1   3        nb Gas7      in                         XZG29196.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCGTGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATG
  3   1   3        nb Te3  5g3  out                        CAAM1633.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATCCGTGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCAGGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACTGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCGTTAGACTTTATAAATAAAAGTGTTTTATTTAAATG
  3   1   2       ext Tad5      in                         XZT17091.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGTGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACTGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAAGTGTTTTATTT
  3   1   2       add Te1  PIPE out                        CBWN5163.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGTGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAAAAAAAAAAAAAA
  3   1   3        nb Mus1      in                         CABH6949.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACTGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATGAACCTCTCGCCCTATAG
  5   1   3        nb Mus1      in                         CABH6949.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCCATGGCAGTTGTATTACAGAAAACTATGCACCGTTTGTGTATCCATGAAAACTGCATTGCCGAAGCTGTGTTTCTGTATCCATGGCAACTGTATTACAGAAACTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACTGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATGAA
  3   1   3        nb Tad5      in                         XZT35606.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACGCGTCCGGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACTGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATG
  5   1   3        nb Tad5      in                         XZT35606.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACTGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATGAAAAAAAAAAAAAAAAAGG
  3  -1   2       add Tad5      in                          XZT1210.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTTTATTTATAAAGTCTAAAGGGCAAAACCAGAGAAACCCTGAGAAAACAGACTGAGGGGCGCTTTACAGAAACCACTCAAATACCCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAAACTGGTTTTATTAAGGAACCTTTGAAGCTAGTGGTGACATATTTTGTATGCATGTGACGGAACCGGGGGGAATTTGGTCCCTGCAACGTACCGCACTGCGCTA
  3   1   2       add Gas7      in                         XZG50857.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGTCACTGCAACGTACCGCGCTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTT
  3   1   3        nb Eye       in                         CCAX4962.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAGCGAACACTGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGGTAATTTATTTTTTGATTAAGACTGTTTTTTTTAAGGAACCTTTGTAGCTAGG
  5  -1   2       add Tad5      in                          XZT1210.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAACACCGGGCTAATTTATTTTTGTTTAAAGACGGTTTGTCTTAAGGAACCTTTGTAGGTAGGGGGGACATATTTTGTATGCATGTCACGGGGCCGGGGGGAATTTGGTCACTGCAAAGTACCGCGTTGCGCTGAGCCTCAAAGCGCAACTCTACCGCCAAGCATTTCCGCAAGGTTTTAATCCTTCTAACGATCTGTTTGGAATTTTATAGCCGAGAGGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTTTCTGGCAACCATGGAGTTAAAGCCCCATCTCAGTCTGTTTTCCCAGGGTTTCTCTGGTTTTGCCCTTTAGGCTTTATAAATAAAAGTGTTTTTTTTTTTGGGAAAAAAAAAAACAAAC
  3   1   2       ext HdA       in                    THdA024e10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATGCAGACTCTGTAATATGCAGAAACTAATGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTTTGACAGGGAGTTCTCTTTGGCAACCATGGAGTTAAAGATCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTTCCAATGGAGAGCTTTATAAATAAAAGTGTTTTATTTAAATGAAAAAAAAAAAAAAAAAAAGC
  5   1   2  SIG                                    Xt7.1-TGas141o18.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGAAGACACAAAGTATCTGTGCACGTTCTTTCCAGAGAGATGGATTCCTGTCCTGTAGTGGGTGAATTTCCAAGTCAAAATGATGTTAACCTCGCTCCAGCTCCAGCCCTTCCTCAGCCTGAGGTGATTAGCAATATGACGGAGTTCAAGAGGAGCTTGCCTCTCTTCCCTCTCGTCAAACCCCACATCAACTTCATGACCGCGAAATTATGATCCGAGCTGCAAACAGGACAACGACCACTGAACCAGGTGCTGCTTAAGATGTGCCGTGGCTTGCAAGTGAGGAGTCATTCTGGTTGCAGTAGTAGGACTTTGCACATAGACATTTAGTAAAACTATAATCTCTGTAGTACCGAAATCTGGTTGGTGTTGATTTTACATTGTAACGCATGGGCTGCATCAGGTGTCCTGTTGTGGATTGGTTGGTTGGTGTCACCTGATGCACACGCTGGCATTGACTGGCAAAGGAAGGACAAGTAGACTTTTACGAGGAAAGAATTATATTACACATAATGCTGAAATGCTGTAAATTATTTATGAACGTAGGATTATTCTTAAGGAAAAACAAAACCTTGGCTAACTAGACTGTTAGGTTTAGCTACAGTGCCACGGGTTTGTGCTGTGAGGCCGCCATCTTCCCCTGCGCAGTGTTTGACGTGACTTCATTGTGTTGACATTTTTGTTTAAAAGGGACACGTACCCACCTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGT
                                                  Xt7.1-CHK-1008280794                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACACAAAGTATCTGTGCACGTTCTTTCCAGAGAGATGGATTCCTGTCCTGTAGTGGGTGAATTTCCAAGTCAAAATGATGTTAACCTCGCTCCAGCTCCAGCCCTTCCTCAGCCTGAGGTGATTAGCAATATGACGGAGTTCAAGAGGAGCTTGCCTCTCTTCCCTCTCGTCAAACCCCACATCAACTTCATGACCGCGAAATTATGATCCGAGCTGCAAACAGGACAACGACCACTGAACCAGGTGCTGCTTAAGATGTGCCGTGGCTTGCAAGTGAGGAGTCATTCTGGTTGCAGTAGTAGGACTTTGCACATAGACATTTAGTAAAACTATAATCTCTGTAGTACCGAAATCTGGTTGGTGTTGATTTTACATTGTAACGCATGGGCTGCATCAGGTGTCCTGTTGTGGATTGGTTGGTTGGTGTCACCTGATGCACACGCTGGCATTGACTGGCAAAGGAAGGACAAGTAGACTTTTACGAGGAAAGAATTATATTACACATAATGCTGAAATGCTGTAAATTATTTATGAACGTAGGATTATTCTTAAGGAAAAACAAAACCTTGGCTAACTAGACTGTTAGGTTTAGCTACAGTGCCACGGGTTTGTGCTGTGAGGCCGCCATCTTCCCCTGCGCAGTGTTTGACGTGACTTCATTGTGTTGACATTTTTGTTTAAAAGGGACACGTACCCACCTGTATGCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATT
  5   1   4      seed Gas7      in                         XZG17169.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACGCGATCCGAACATCACAAAGCAGGCTGCCATGGGCATTATGCAGATGGTAGAGGACACCCTTATTGAACATGCCCACACTAAGCCTCTTCTTCCAAGTCAGCTGGTCCGATACCGAGAAGTACAGCTGCCAGACAGAGGCTGGTTTGTGTATCAGCAGAGGAACGAGGTCCATAATAACTGTGGCATTGAGATTTATTATCAGACGGACATGCAGAGCACATCGGAGAACATGCTGCTTGAACTTCTCTGCCAGATCATCTCCGAGCCTTGCTTCAACACGCTGCGCACCAAGGAGCAGTTAGGTTACATTGTGTTCAGCGGCCCCCGCAGGGCTAATGGCATCCAAGGTCTGAGATTTATTATCCAGTCCGAGAAGCCGCCTCATTATTTAGAGAGCCGCGTGGAGGCCTTCTTAAAGACCACAGAGAAGTCCCTGGAAGACATGGCGGATGAGGCGTTCCAGAAGCACATCCAGGCGCTGGCGATACGCCGTCTAGACAAGCCAAAGAAACTCTCTGCCGAGTGTGCTAAGTACTGGGGGGAAATCATTTCCCAGCAGTATAACTTTGATAGAGACAACATTGAAGTCGCCTATCTGAAGACTCTGGTAAAGGAAGATATCATGAACTTTTACAAGAATATGTTGTCTGTGGACGCCCCTAGAAGACACAAAGTATCTGTGCACGTTCTTTCCAGAGAGATGGATTCCTGTCCTGTAGTGGGTGAATTTCCAAGTCAAAATGATGTTAACCTCGCTCCAGCTCCAGCCCTTCCTCAGCCTGAGGTGATTAGCAATATGACGGAGTTCAAGAGGAGCTTGCCTCTCTTTCCTCTCGTCAAACC
  5   1   2       ext Eye       in                         CCAX6983.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGAAGACACAAAGTATCTGTGCACGTTCTTTCCAGAGAGATGGATTCCTGTCCTGTAGTGGGTGAATTTCCAAGTCAAAATGATGTTAACCTCGCTCCAGCTCCAGCCCTTCCTCAGCCTGAGGTGATTAGCAATATGACGGAGTTCAAGAGGAGCTTGCCTCTCTTCCCTCTCGTCAAACCCCACATCAACTTCATGACCGCGAAATTATGATCCGAGCTGCAAACAGGACAACGACCACTGAACCAGGTGCTGCTTAAGATGTGCCGTGGCTTGCAAGTGAGGAGTCATTCTGGTTGCAGTAGTAGGACTTTGCACATAGACATTTAGTAAAACTATAATCTCTGTAGTACCGAAATCTGGTTGGTGTTGATTTTACATTGTAACGCATGGGCTGCATCAGGTGTCCTGTTGTGGATTGGTTGGTTGGTGTCACCTGATGCACACGCTGGCATTGACTGGCAAAGGAAGGACAAGTAGACTTTTACGAGGAAAGAATTATATTACACATAATGCTGAAATGCTGTAAATTATTTATGAACGTAGGATTATTCTTAAGGAAAAACAAAACCTTGGCTAACTAGACTGTTAGGTTTAGCTACAGTGCCACGGGTTTGTGCTGTGAGGCCGCCATCTTCCCCTGCGCAGTGTTTGACGTGACTTCATTGTGTTGACATTTTTGTTTAAAAGGGACACGTACCCACCTGTATGCAGTCAG
  5   1   3        nb Tad5      in                           XZT456.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCTTCCTCAGCCTGAGGTGATTAGCAATATGACGGAGTTCAAGAGGAGCTTGCCTCTCTTCCCTCTCGTCAAACCCCACATCAACTTCATGACCGCGAAATTATGATCCGAGCTGCAAACAGGACAACGACCACTGAACCAGGTGCTGCTTAAGATGTGCCGTGGCTTGCAAGTGAGGAGTCATTCTGGTTGCAGTAGTAGGACTTTGCACATAGACATTTAGTAAAACTATAATCTCTGTAGTACCGAAATCTGGTTGGTGTTGATTTTACATTGTAACGCATGGGCTGCATCAGGTGTCCTGTTGTGGATTGGTTGGTTGGTGTCACCTGATGCACACGCTGGCATTGACTGGCAAAGGAAGGACAAGTAGACTTTTACGAGGAAAGAATTATATTACACATAATGCTGAAATGCTGTAAATTATTTATGAACGTAGGATTATTCTTAAGGAAAAACAAAACCTTGGCTAACTAGACTGTTAGGTTTAGCTACAGTGCCACGGGTTTGTGCTGTGAGGCCGCCATCTTCCCCTGCGCAGTGTTTGACGTGACTTCATTGTGTTGACATTTTTGTT
  5   1   3        nb Eye       in                         CCAX4987.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGAACCAGGTGCTGCTTAAGATGTGCCGTGGCTTGCAAGTGAGGAGTCATTCTGGTTGCAGTAGTAGGACTTTGCACATAGACATTTAGTAAAACTATAATCTCTGTAGTACCGAAATCTGGTTGGTGTTGATTTTACATTGTAACGCATGGGCTGCATCAGGTGTCCTGTTG
  5   1   2       ext Thy1      in                        CBST8799.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTAGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACGCCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTC
  3   1   2       ext Thy1      in                        CBST8799.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACGCCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATG
  3  -1   3        nb Gas  5g   ?                     TGas141o18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTCCAGAAACTGCACATTTGTGTATCCNGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATG
  3   1   3        nb Eye       in                         CCAX4987.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATG
  3   1   3        nb Gas7                                 XZG47744.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCACGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCAGGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCAT
  3   1   2       ext Eye       in                         CCAX6983.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTTTGACAGGGAGTTCTTTTTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTTTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATG
  3   1   4      seed Gas7      in                         XZG17169.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACATTTGTGTATTCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTAACGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTCGCCTTTATAAATAAAAGTGTTTTATTT
  3   1   3        nb Tad5      in                           XZT456.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTTAGTGTTTACGATTATGTAAATGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCAAGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCAGGTTTTGCCCTTTAGAC
  3  -1   2       add Te3                                  CAAM2069.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATTTAAATAAAACACCTTTTATTTATAAAGTCTAAAGGGCAAAACCAGAGAAACCCCTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGCTTTATTTCAATGAACAA
  5  -1   2       ext Gas       out                  TGas141a14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATGAAAAAAAAAAAAAAAA
  5   1   3        nb Gas                            TGas014k04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTTATTATTACGTTCTGGAAAAAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATG
  3   1   3        nb Te3  5g3  out                        CAAM3778.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATG
  5   1   2  SIG                                      Xt7.1-CABE5252.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGATTATTCTTAAGGAAAAACAAAACCTTGGCTAACTAGACTGTTAGGTTTAGCTACAGTGCCACGGGTTTGTGCTGTGAGGCCGCCATCTTCCCCTGCGCAGTGTTTGACGTGACTTCATTGTGTTGACATTTTTGTTTAAAAGGGACACGTACCCACCTGTATGCAGTCAGTCCTCTTTATTTCAGGATCATAAATTATAACTGGAGCACCCCCTGCTGTTCAGCCAGGGGGGTTTATTTACTGATGCCATAGAGGAGATAAACGTCAGTAGACTTCGGCATCGGTAACTTAAACTTTAGCTTTCTGTCCGCCCCCTGCCCAGACAGAACTGCAGGTGGTGCTTCTACTACACATTCATATTAATTTGCAAAAGTGCTCTGGAGAGCAATTTTATATTGTTATGCGGGTGGGGGTATGTCCTTATTAAAAAGCCAATCAAGTGTGAGCTATTTAGAGAGAATGGCAAGCAGAGGCAGATACAGACTCTGTAACCCACCTCTGCGGGTGCTTTATCTCCACACAAGGTGCATGGCTGTAGCCCCCAGCAGGTACCACTTTTGATGATAAGGTACAGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACGTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGTGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTAGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTAT
                                                  Xt7.1-CHK-1008280796                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCTTAAGGAAAAACAAAACCTTGGCTAACTAGACTGTTAGGTTTAGCTACAGTGCCACGGGTTTGTGCTGTGAGGCCGCCATCTTCCCCTGCGCAGTGTTTGACGTGACTTCATTGTGTTGACATTTTTGTTTAAAAGGGACACGTACCCACCTGTATGCAGTCAGTCCTCTTTATTTCAGGATCATAAATTATAACTGGAGCACCCCCTGCTGTTCAGCCAGGGGGGTTTATTTACTGATGCCATAGAGGAGATAAACGTCAGTAGACTTCGGCATCGGTAACTTAAACTTTAGCTTTCTGTCCGCCCCCTGCCCAGACAGAACTGCAGGTGGTGCTTCTACTACACATTCATATTAATTTGCAAAAGTGCTCTGGAGAGCAATTTTATATTGTTATGCGGGTGGGGGTATGTCCTTATTAAAAAGCCAATCAAGTGTGAGCTATTTAGAGAGAATGGCAAGCAGAGGCAGATACAGACTCTGTAACCCACCTCTGCGGGTGCTTTATCTCCACACAAGGTGCATGGCTGTAGCCCCCAGCAGGTACCACTTTTGATGATAAGGTACAGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACGTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGTGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTAGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAAT
  0   1   1           Brn2 FLt5                       CAAJ16239.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATTAACCTTAAACGTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGTGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTAGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATGAAAAAAAAAAAAAAA
  5   1   2       ext Egg                            TEgg086m13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAAGAATTATATTACGATAATGCTGAAATGCTGTAAATTATTTATGAACGTAGGATTATTCTTAAGGAAAAACAAAACCTTGGCTAACTAGACTGTTAGGTTTAGCTACAGTGCCACGGGTTTGTGCTGTGAGGCCGCCATCTTCCCCTGCGCAGTGTTTGACGTGACTTCATTGTGTTGACATTTTTGTTTAAAAGGGACACGTACCCACCTGTATGCAGTCAGTCCTCTTTATTTCAGGATCATAAATTATAACTGGAGCACCCCCTGCTGTTCAGCCAGGGGGGTTTATTTACTGATGCCATAGAGGAGATAAACGTCAGTAGACTTCGGCATCGGTAACTTAAACTTTAACTTTCTGTCCGCCCCCTGCCCAGACAGAACTGCAAGTGGTGCTTCTACTACACATTCATATTAATTTGCAAAAGTGCTCTGGAGAGCAATTTTATATTGTTATGCGGGTGGGGGCATGTCCTTATTAAGAAGCCAATCAAGTGTGAGCTATTTAGAGATAATGGCAAGCAGAGGCAGATACAGACTCTGTAACCCACCTCTGCGGGTGCTTTATCTCCACACAAAGTGCATGGCTGTAGCCCCCAGCAAGTACCACTTTTGATGAT
  5   1   2   12  ext Tad5 5g3  in                         XZT30595.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGATTATTCTTAAGGAAAAACAAAACCTTGGCTAACTAGACTGTTAGGTTTAGCTACAGTGCCACGGGTTTGTGCTGTGAGGCCGCCATCTTCCCCTGCGCAGTGTTTGACGTGACTTCATTGTGTTGACATTTTTGTTTAAAAGGGACACGTACCCACCTGTATGCAGTCAGTCCTCTTTATTTCAGTATCATAAATTATAACTGGAGCACCCCCTGCTGTTCAGCCAGGGGGGTTTATTTACTGATGCCATAGAGTAGATAAACGTCAGTAGACTTCGGCATCGGTAACTTAAACTTTAGCTTTCTGTCCGCCCCCTGCCCAGACAGAACTGCAGGTGGTGCTTCTACTACACATTCATATTAATTTGCAAAAGTGCTCTGGAGAGCAATTTTATATTGTTATGCGGGTGGGGGTATGTCCTTATTAAAAAGCCAATCAAGTGTGAGCTATTTAGAGAGAATGGCAAGCAGAGGCAGATACAGACTCTGTAACCCACCTCTGCGGGTGCTTTATCTCCACACAAGGTGCATGGCTGTAGCCCCCAGCAGGTACCACTTTTGATGATAAGGTACAGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACGTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCCACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACT
  5   1   2   13  ext Gas7 5g3  in                          XZG5444.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAGTGTGAGCTATTTAGAGAGAATGGCAAGCAGAGGCAGATACAGACTCTGTAACCCACCTCTGCGGGTGCTTTATCTCCACACAAGGTGCATGGCTGTAGCCCCCAGCAGGTACCACTTTTGATGATAAGGTACAGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACGTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTAGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAACT
  5   1   2       ext Gas  5g3  in                   TGas071e19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGATCAGACTCTGTAACCCACCTCTGCGGGTGCTTTATCTCCACACAAGGTGCATGGCTGTAGCCCCCAGCAGGTACCACCTTTTGATGATAAGGTACAGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACGTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGTGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTAGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTA
  5   1   2   10  ext Ova1 5g3  in                         CABE5252.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGACTCTGTAACCCACCTCTGCGGGTGCTTTATCTCCACACAAGGTGCATGGCTGTAGCCCCCAGCAGGTACCACTTTTGATGATAAGGTACAGTTGGTCGGATTGATGAAGGAAATGCCAAGCTTTGGGCAAGAAGCTCGCCATGGAACGCCAACCTGTACCTCATTAACCTTAAACGTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGTGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTAGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTAT
  5   1   2   14  ext Brn2 FLt5 in                        CAAJ16239.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATTAACCTTAAACGTTACATTAGGGTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGTGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTAGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACT
  5   1   2       add Egg  5g3  in                   TEgg001a08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCACTGCTTCATGCCTTGGAGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGTGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTAGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGT
  5   1   3        nb Liv1      in                         CAAR2167.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAGATTGTGTGCGCTGTTTGTATATCCATGGCAACTGCATTGCCGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGTGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGCGCATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAACTATGCATCATTAGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCGTGGCAACTGTGTTACAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGGCCCTCTCCAATGCCGCTAGCG
  3   1   3        nb Te3  5g3  out                        CAAM6954.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCATGGCAACTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATG
  3   1   2       ext Gas  5g3  in                    TGas071e19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAAAGTGTTTTATTTAAATGAAAAAAAAAAAAAAAAAA
  3   1   2       ext Ova1 5g3  in                         CABE5252.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGTATGGCAGAAACTGTGCACATTTGTGTATCCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATG
  3   1   2       ext Brn2 FLt5 in                        CAAJ16239.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCATGGCAGTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATG
  3   1   3        nb Brn2 5g3  out                       CAAJ14079.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTGTATTACAGAAAACTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATG
  3   1   3        nb Liv1      in                         CAAR2167.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTATGCATCATTTGTGTATCCATGGAAACTGCATTGCCGAAACTGCACATTTGTGTATCCATGGCAACTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATG
  3   1   2       ext Tad5 5g3  in                         XZT30595.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATCCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATGGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATG
  3   1   2       ext Gas7 5g3  in                          XZG5444.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGTGGCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTATCCCTTAGTGTTTACGATTATGTAATTGATGTCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGTAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATT
  3   1   0       chi Egg  5g3  in                    TEgg001a08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAGTTGTATTACAGAAACTGCACATTTGTGTATCCGTGGCAACTGTATTACAAAAACTGTGTGCACATTTGTGTATCCATGGCAACTGTATTGCAGAAACTGTGTGCACATTTGTGTATCCATGAAAGGCAGCTGGGTTACCCTGGTCCCTCTCCAATGCCGCTAGCGAACACCGAGGGGCGCTTTACAGAAACCACTCAAATACCTCTTTATTATTACGTTCTGGAAAACAACAGGCTAATTTATTTTTTGATTAAGACTTTGTTTTTATTAAGGAACCTTTGTAGCTAGTGGTGACATATTTTGTATGCATGTCACGGAGCCGGGGGGAATTTGGCCACTGCAGCGTACCGCGCCGCGCCTCAAAGCGCAACTCTACCGCCAAGCATCTCCGCATGGTTTTAATCTTTCTATCGATCTGTTTGGAATTTTATAGCCGAGATGGTAGAATGCAGACTCTGGAATATGCAGAAACTATTGGTTTGGTAACGTGTAATAAATGCTGAACTTTTTGGGATGCCAGAAGCTCTCTCCTCTGACAGGGAGTTCTCTCTGGCAACCATGGAGTTAAAGCTCCATCTCAGTCTGTTTTCTCAGGGTTTCTCTGGTTTTGCCCTTTAGACTTTATAAATAAAAGTGTTTTATTTAAATGAAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)