Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 92%

 1012075026 Xt7.1-TGas113o10.3.5 - 70 ESTs
                                                                       ....-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TGas113o10.3.5                                                                                                                                                                                         AGAAGGCATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATCAAAGAGGAGAGACTAAAGGAAATTGATGTGGGAAGGTGCTTAGGAGGCTGCTCATCAGGAAGCCATTGTCTACTCAGGGATTCACGTAACAGAGATCACTGTATAGTCTGGGCAGAAGGCTCAGGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGGACTATTCTGTGGGAGGACTTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATATTTTGTCTTATAATTCAACTGTACTTGCACGGAGACGTTCCAGGAGTTTAAAAGCACAATATGAAAGAAACAGTATCGATTGGACAGAGAAATTACAAACTATGAATAGATTGAATCTGGAACTTTGCATTTGACTGAATATTGAATGCTTAAAAAAAAATCTGGCCAAAATACAAACCCTGATTTGCATTTACAAACATCATCTTCTGAGAATTTCAAAGATTTCTGTTGACCAGTTCTACAAGGGCTCTGGCAGAAGTCCTATTCCAAAGCAAAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTGAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATATGTCACAGAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008224369                                                                                                                                                                                               CATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATCAAAGAGGAGAGACTAAAGGAAATTGATGTGGGAAGGTGCTTAGGAGGCTGCTCATCAGGAAGCCATTGTCTACTCAGGGATTCACGTAACAGAGATCACTGTATAGTCTGGGCAGAAGGCTCAGGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGGACTATTCTGTGGGAGGACTTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATATTTTGTCTTATAATTCAACTGTACTxxxxxGGAGACGTTCCAGGAGTTTAAAAGCACAATATGAAAGAAACAGTATCGATTGGACAGAGAAATTACAAACTATGAATAGATTGAATCTGGAACTTTGCATTTGACTGAATATTGAATGCTTAAAAAAAAATCTGGCCAAAATACAAACCCTGATTTGCATTTACAAACATCATCTTCTGAGAATTTCAAAGATTTCTGTTGACCAGTTCTACAAGGGCTCTGGCAGAAGTCCTATTCCAAAGCAAAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTGAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATAxxTxAxAxAxAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                              5     7    10    10    11    12    12    13    13    13    13    13    13    13    14    14    14    14    14    14    15    15    15    15    15    15    15    15    15    15    15    16    17    17    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    19    19    19    19    19    19    19    19    19    19    19    20    19    20    19    20    20    20    21    21    20    21    21    21    21    21    20    20    18    19    18    19    17    18    16    18    17    18    15    16    15    16    15    16    15    16    15    16    13    15    14    15    13    14    13    14    12    14    11    13    12    15    11    14    11    14    10    13    10    13    10    13    13    16    12    15    12    15    12    15    12    13    12    13    12    13    13    14    13    13    13    13    13    13    13    13    11    11    11    11    10    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    12    11    12    11    12    11    12    11    12    11    12    10    12     9    11     9    11     7    11     7    12     8    11     5    11     5    10     5    10     4     8     4     8     4     7     5     8     4     8     4     8     4     8     5     8     5     8     5     7     5     7     5     7     7     7     5     7     5     7     4     6     4     7     4     7     5     6     5     7     6     7     7    11     7    13     7    13     7    13     7    13     7    13     7    14     7    14     8    14     8    13    13    18    14    19    14    19    14    19    14    20    15    20    16    21    16    21    17    22    19    24    21    26    22    27    22    27    22    27    22    28    22    28    22    28    21    28    22    28    22    28    22    29    22    31    21    31    20    31    21    31    21    32    21    32    22    33    22    34    21    34    21    34    21    34    22    34    21    34    22    34    22    34    21    34    21    34    20    34    20    34    20    34    23    32    25    32    21    31    21    31    23    31    21    29    20    29    19    28    20    28    21    28    20    28    20    27    18    27    20    27    18    27    18    27    17    27    17    27    19    26    19    26    19    26    16    26    19    26    15    25    17    25    13    24    14    24    10    23     3     9     2     4
  5   1   2  SIG                                 Xt7.1-IMAGE:6994144.5                                                                                                                                                                                TTCAACAGGAGAAGGCATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCATGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAANACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATTCAAGGAGGAGAGACTAAAGGAAATTGAATGTGGGAAGGGTGCTTAAGAGGCTGCTCATCAAGGAAGCCATTGTTCTACTCCGGGGATTCACGGTAAACAGAAGATTCACTGGTATAAGTCCTGGGGCAAGAAAGGTTCAAGGGCA------------------------------------ACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGGACTATTCTGTGGGAGGACTTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATGTTTTGTCTTATAATTCAACTGTACTTGCACTGGAGACGTTCCAGGAGTTTAAAAGCACAATATGAAAGAAACAGTATCGATTGGACAGAGAAATTACAAACTATGAATAGATTGAATCTGGAACTTTGCATTTGACTGAATATTGAATGCTTAAAAAAAAATCTGGCCAAAATACAAACCCTGATTTGCATTTACAAACATCATCTTCTGAGAATTTCAAAGATTTCTGTTGACCAGTTCTACAAGGGCTCTGGCAGAAGTCCTATTCCAAAGCAAAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATTTGAAAATTATTTGTAAATTTAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATACCAATAACTTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCC
  5   1   2  SIG                                      Xt7.1-XZG35631.5                                                                                                                                                                                  AAACAGGAGAAGGCATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCATGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATCAAAGAGGAGAGACTAAAGGAAATTGATGTGGGAAGGTGCTTAGGAGGCTGCTCATCAGGAAAGCATTGTCTACTCAGGGATTCACGTAACAGAGATCACTGTATAGTCTGGGCAGAAGGCTCAGGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGGACTATTCTGTGGGAGGACTTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATGTTTTGTCTTATAATTCAACTGTACTTGCACTGGAGACGTTCCAGGAGTTTAAAAGCACAATATGAAAGAAACAGTATCGATTGGACAGAGAAATTACAAACTATGAATAGATTGAATCTGGAACTTTGCATTTGACTGAATATTGAATGCTTAAAAAAAAATCTGGCCAAAATACAAACCCTGATTTGCATTTACAAACATCATCTTCTGAGAATTTCAAAGATTTC------------------------------------------------AAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTTAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATACCAATAACTTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTTCTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCCCCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATAT------------AAAAANCAAAACCCAANAAAAAAC
  5   1   2  SIG                                    Xt7.1-TGas113o10.3                                                                                                                                                                                            AGGCATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATCAAAGAGGAGAGACTAAAGGAAATTGATGTGGGAAGGTGCTTAGGAGGCTGCTCATCAGGAAGCCATTGTCTACTCAGGGATTCACGTAACAGAGATCACTGTATAGTCTGGGCAGAAGGCTCAGGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGGACTATTCTGTGGGAGGACTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATATTTTGTCTTATAATTCAACTGTACTTGCACTGGAGACGTTCCAGGAGTTTAAAAGCACAATATGAAAGAAACAGTATCGATTGGACAGAGAAATTACAAACTATGAATAGATTGAATCTGGAACTTTGCATTTGACTGAATATTGAATGCTTAAAAAAAAATCTGGCCAAAATACAAACCCTGATTTGCATTTACAAACATCATCTTCTGAGAATTTCAAAGATTTCTGTTGACCAGTTCTACAAGGGCTCTGGCAGAAGTCCTATTCCAAAGCAAAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTGAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATATGTCACAGAAAAAAAAAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATACCAATAACTTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAACCAAAGTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTT
                                                                   SNP                                                                                                                                                                                                                                                                             --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----G--G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------C
                                               BLH ATG      14     665                                                                                                                                                                                         
                                               BLH MIN      14      40                                                                                                                                                                                         
                                               BLH MPR      14      40                                                                                                                                                                                         
                                               BLH OVR      14       8                                                                                                                                                                                         
                                               EST CLI      -9      16                                                                                                                                                                                         
                                               ORF LNG      14       2                                                                                                                                                                                         
                                                                                                                                                                                                                                                                             PREDICTED = Dr ==== 4e-087     NP_991150.1 hypothetical protein LOC402846 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 0          AAQ65245.1 pinhead [Silurana tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TGas113o10.3.5                                                                                                                                                                                                       ATG------------------------------------ATG---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTAG---------------------------------------TGA------TGA------TAA------TAA------------ATG---------------------------------TGAATG---------------------------------------------------------------TAA------------------ATGTAG------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGTGA---------------------------------------------------TGA------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------ATG------------------------------------------------------------------------------ATG---------------------------------------ATG---------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATGA------------------------TAG------------------------TAA---------------------------------------TAA------------------------------TAA---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  5   1   2  SIG                                 Xt7.1-IMAGE:6994144.5                                                                                                                                                                                TTCAACAGGAGAAGGCATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCATGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAANACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATTCAAGGAGGAGAGACTAAAGGAAATTGAATGTGGGAAGGGTGCTTAAGAGGCTGCTCATCAAGGAAGCCATTGTTCTACTCCGGGGATTCACGGTAAACAGAAGATTCACTGGTATAAGTCCTGGGGCAAGAAAGGTTCAAGGGCA------------------------------------ACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGGACTATTCTGTGGGAGGACTTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATGTTTTGTCTTATAATTCAACTGTACTTGCACTGGAGACGTTCCAGGAGTTTAAAAGCACAATATGAAAGAAACAGTATCGATTGGACAGAGAAATTACAAACTATGAATAGATTGAATCTGGAACTTTGCATTTGACTGAATATTGAATGCTTAAAAAAAAATCTGGCCAAAATACAAACCCTGATTTGCATTTACAAACATCATCTTCTGAGAATTTCAAAGATTTCTGTTGACCAGTTCTACAAGGGCTCTGGCAGAAGTCCTATTCCAAAGCAAAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATTTGAAAATTATTTGTAAATTTAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATACCAATAACTTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCC
                                                  Xt7.1-CHK-1008284040                                                                                                                                                                                      AGGAGAAGGCATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCATGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAANACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATTCAAGGAGGAGAGACTAAAGGAAATTGAATGTGGGAAGGGTGCTTAAGAGGCTGCTCATCAAGGAAGCCATTGTTCTACTCCGGGGATTCACGGTAAACAGAAGATTCACTGGTATAAGTCCTGGGGCAAGAAAGGTTCA------------------------------------ATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGGACTATTCTGTGGGAGGACTTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATGTTTTGTCTTATAATTCAACTGTACTTGCACTGGAGACGTTCCAGGAGTTTAAAAGCACAATATGAAAGAAACAGTATCGATTGGACAGAGAAATTACAAACTATGAATAGATTGAATCTGGAACTTTGCATTTGACTGAATATTGAATGCTTAAAAAAAAATCTGGCCAAAATACAAACCCTGATTTGCATTTACAAACATCATCTTCTGAGAATTTCAAAGATTTCTGTTGACCAGTTCTACAAGGGCTCTGGCAGAAGTCCTATTCCAAAGCAAAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATTTGAAAATTATTTGTAAATTTAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATACCAATAACTTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCA
  5   1   4   12 seed Gas7 5g3  in                         XZG20741.5p ...............................................................................................................................................................................TTCAACAGGAGAAGGCATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCATGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACCCTGTGGTGGTTGAAAGCCCAAT
  5   1   2       ext Neu0 5g                            IMAGE:6994144                                                                                                                                                                                    ACAGGAGAAGGCATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAANACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATTCAAGGAGGAGAGACTAAAGGAAATTGAATGTGGGAAGGGTGCTTAAGAGGCTGCTCATCAAGGAAGCCATTGTTCTACTCCGGGGATTCACGGTAAACAGAAGATTCACTGGTATAAGTCCTGGGGCAAGAAAGGTTCAAGGGCAGGCGC
  5   1   2       ext Gas7      in                         XZG25114.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGGACTATTCTGTGGGAGGACTTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATGTTTTGTCTTATAATTCAACTGTACTTGCACTGGAGACGTTCCAGGAGTTTAAAAGCACAATATGAAAGAAACAGTATCGATTGGACAGAGAAATTACAAACTATGAATAGATTGAATCTGGAACTTTGCATTTGACTGAATATTGAATGCTTAAAAAAAAATCTGGCCAAAATACAAACCCTGATTTGCATTTACAAACATCATCTTCTGAGAATTTCAAAGATTTCTGTTGACCAGTTCTACAAGGGCTCTGGCAGAAGTCCTATTCCAAAGCAAAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACT
  3   1   2       ext Gas7      in                         XZG25114.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGCAGAAGTCCTATTCCAAAGCAAAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATTTGAAAATTATTTGTAAATTTAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATACCAATAACTTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAAAAAAAAAAAAAAAGG
  3   1   4      seed Gas7 5g3  in                         XZG20741.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCAGAAGTCCTATTCCAAAGCAAAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATTTGAAAATTATTTGTAAATTTAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATACCAATAACTTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAGGTTT
  5   1   2  SIG                                      Xt7.1-XZG35631.5                                                                                                                                                                                  AAACAGGAGAAGGCATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCATGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATCAAAGAGGAGAGACTAAAGGAAATTGATGTGGGAAGGTGCTTAGGAGGCTGCTCATCAGGAAAGCATTGTCTACTCAGGGATTCACGTAACAGAGATCACTGTATAGTCTGGGCAGAAGGCTCAGGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGGACTATTCTGTGGGAGGACTTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATGTTTTGTCTTATAATTCAACTGTACTTGCACTGGAGACGTTCCAGGAGTTTAAAAGCACAATATGAAAGAAACAGTATCGATTGGACAGAGAAATTACAAACTATGAATAGATTGAATCTGGAACTTTGCATTTGACTGAATATTGAATGCTTAAAAAAAAATCTGGCCAAAATACAAACCCTGATTTGCATTTACAAACATCATCTTCTGAGAATTTCAAAGATTTC------------------------------------------------AAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTTAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATACCAATAACTTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTTCTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCCCCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATAT------------AAAAANCAAAACCCAANAAAAAAC
                                                  Xt7.1-CHK-1008284044                                                                                                                                                                                        GAGAAGGCATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCATGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATCAAAGAGGAGAGACTAAAGGAAATTGATGTGGGAAGGTGCTTAGGAGGCTGCTCATCAGGAAAGCATTGTCTACTCAGGGATTCACGTAACAGAGATCACTGTATAGTCTGGGCAGAAGGCTCAGGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGGACTATTCTGTGGGAGGACTTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATGTTTTGTCTTATAATTCAACTGTACTTGCACTGGAGACGTTCCAGGAGTTTAAAAGCACAATATGAAAGAAACAGTATCGATTGGACAGAGAAATTACAAACTATGAATAGATTGAATCTGGAACTTTGCATTTGACTGAATATTGAATGCTTAAAAAAAAATCTGGCCAAAATACAAACCCTGATTTGCATTTACAAACATCATCTTCTGAGAATTTCAAA------------------------------------------------------------TCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTTAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATACCAATAACTTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTTCTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCCCCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATATGTCA------------CAAAACCCAANA
  5   1   4   12 seed Gas7 5g3  in                         XZG35631.5p .................................................................................................................................................................................AAACAGGAGAAGGCATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCATGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATCAAAGAGGAGAGACTAAAGGAAATTGATGTGGGAAGGTGCTTAGGAGGCTGCTCATCAGGAAAGCATTGTCTACTCAGGGATTCACGTAACAGAGATCACTGTATAGTCTGGGCAGAAAGCTCAGGC
  5   1   2       ext Gas7      in                          XZG6230.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAATTGATGTGGGAAGGTGCTTAGGAGGCTGCTCATCAGGAAGCCATTGTCTACTCAGGGATTCACGTAACAGAGATCACTGTATAGTCTGGGCAGAAGGCTCAGGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGGACTATTCTGTGGGAGGACTTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATGTTTTGTCTTATAATTCAACTGTACTTGCACTGGAGACGTTCCAGGAGTTTAAAAGCACAATATGAAAGAAACAGTATCGATTGGACAGAGAAATTACAAACTATGAATAGATTGAATCTGGAACTTTGCATTTGACTGAATATTGAATGCTTAAAAAAAAATCTGGCCAAAATACAAACCCTGATTTGCATTTACAAACATCATCTTCTGAGAATTTCAAAGATTTCTG
  5   1   2       ext Gas7                                 XZG20026.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGCAAAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTTAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATACCAATAACTTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGGTAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGG
  5   1   3        nb Gas7      in                         XZG26554.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGCAAAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTTAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATACCAATAACTTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATTGNGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCAATCCAATATCCT
  3   1   3        nb Gas7      in                         XZG26554.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTGTAAATTTAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATACCAATAACTTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATATGTCACAG
  3   1   2       ext Gas7      in                          XZG6230.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATACCAATAACTTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTTCTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATATG
  3   1   4      seed Gas7 5g3  in                         XZG35631.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATATTTTAGTGAGAAGCAGCAGTGTTTGGAAATAGCAAAGCCCCCCCCCATTCTGTTTTACAATGTAATGAATTTCCAGTAATATTTTCTGAATTTACAAATACCAATAACTTCCAATCCCTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTTCTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTTTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATTTACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAAGAGTTTTTTAAAACACAGGCCCCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGGCTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTTTCTGTCAAGATTTTTGAAAATAAAATATATGTCCCGG
  3  -1   2       ext Gas8                                 st107l03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTCTGCCTTCAGGCATCCCATTCCAATATCCTAAGAAAAAAAANATGAGGNNGTCTTTTGTATAANGTTGNNNAATAGAAAGAANTATATNCNGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCCCCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCNCNGNCAAGATTTTTGAAAATAAAATATATGNCNCAGANAAAAAANCAAAACCCAANAAAAAACCNNAAAAAAAAAAAAAAAAGNGNC
  5   1   2  SIG                                    Xt7.1-TGas113o10.3                                                                                                                                                                                            AGGCATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATCAAAGAGGAGAGACTAAAGGAAATTGATGTGGGAAGGTGCTTAGGAGGCTGCTCATCAGGAAGCCATTGTCTACTCAGGGATTCACGTAACAGAGATCACTGTATAGTCTGGGCAGAAGGCTCAGGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGGACTATTCTGTGGGAGGACTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATATTTTGTCTTATAATTCAACTGTACTTGCACTGGAGACGTTCCAGGAGTTTAAAAGCACAATATGAAAGAAACAGTATCGATTGGACAGAGAAATTACAAACTATGAATAGATTGAATCTGGAACTTTGCATTTGACTGAATATTGAATGCTTAAAAAAAAATCTGGCCAAAATACAAACCCTGATTTGCATTTACAAACATCATCTTCTGAGAATTTCAAAGATTTCTGTTGACCAGTTCTACAAGGGCTCTGGCAGAAGTCCTATTCCAAAGCAAAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTGAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATATGTCACAGAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008284046                                                                                                                                                                                                  CAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATCAAAGAGGAGAGACTAAAGGAAATTGATGTGGGAAGGTGCTTAGGAGGCTGCTCATCAGGAAGCCATTGTCTACTCAGGGATTCACGTAACAGAGATCACTGTATAGTCTGGGCAGAAGGCTCAGGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGGACTATTCTGTGGGAGGACTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATATTTTGTCTTATAATTCAACTGTACTTGCACTGGAGACGTTCCAGGAGTTTAAAAGCACAATATGAAAGAAACAGTATCGATTGGACAGAGAAATTACAAACTATGAATAGATTGAATCTGGAACTTTGCATTTGACTGAATATTGAATGCTTAAAAAAAAATCTGGCCAAAATACAAACCCTGATTTGCATTTACAAACATCATCTTCTGAGAATTTCAAAGATTTCTGTTGACCAGTTCTACAAGGGCTCTGGCAGAAGTCCTATTCCAAAGCAAAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTGAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATATGTCxCAGxxxAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Gas  FL                     TGas114c03.FL-Sanger                                                                                                                                                                                           AAGGCATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATCAAAGAGGAGAGACTAAAGGAAATTGATGTGGGAAGGTGCTTAGGAGGCTGCTCATCAGGAAGCCATTGTCTACTCAGGGATTCACGTAACAGAGATCACTGTATAGTCTGGGCAGAAGGCTCAGGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGGACTATTCTGTGGGAGGACTTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATATTTTGTCTTATAATTCAACTGTACTTGCACTGGAGACGTTCCAGGAGTTTAAAAGCACAATATGAAAGAAACAGTATCGATTGGACAGAGAAATTACAAACTATGAATAGATTGAATCTGGAACTTTGCATTTGACTGAATATTGAATGCTTAAAAAAAAATCTGGCCAAAATACAAACCCTGATTTGCATTTACAAACATCATCTTCTGAGAATTTCAAAGATTTCTGTTGACCAGTTCTACAAGGGCTCTGGCAGAAGTCCTATTCCAAAGCAAAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTTAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATATGTCACGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   0       chi Gas                            TGas046h20.p1kSP6 ACAGGAGAAGGCATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTGTAAGTATTCTAATTCCAAAACCTTATATATATATTTATAATTCCATGTGGATATAAGCATGACTTGCCGTCAACTGCAAACATAACTAGTGTAATTTGCTTTTCTAGTTAGATACATGTGCCAATATAATGTGATGCAAAGTATGAAAAATGAGCTTTTACCTTATTTTGTCTTTTAGATGATAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCT
  5   1   4   12 seed Gas7 5g3  in                         XZG50992.5p ............................................................................................................................................................................GCTTTCAACACGAGAAGGCATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATCAAAGAGGAGAGACT
  5   1   3        nb Gas  5g3  in                   TGas076k09.p1kSP6                                                                                                                                                                                CTCGGGGGGAGAAGGCATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAATTTGACACTGGTGGTGGTTGAAAGCCCAAATGGAGC
  5   1   3        nb Gas  5g                        TGas001a11.p1kSP6                                                                                                                                                                                     CAGGGAGAAGCATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAA
  5   1   3        nb Neu  5g                        TNeu022g07.p1kSP6                                                                                                                                                                                         GAGAAGCATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACC
  5   1   3   12   nb Gas7 5g3  in                         XZG62190.5p .........................................................................................................................................................................................GAAGGCATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATCAAAGAGGAGAGACTAAAGGAAATTGATGTGGGAAGGTGCTTAGGAGGCTGCTCATCANGA
  5   1   3   22   nb Gas7 5g                              XZG10345.5p ..........................................................................................................................................................................................GAGGCATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCATGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATCAAAGAGGAGAGACTAAAGGAATTGATGTGGGAAGGTGCTTAGGAGGCTGCTCATCAGGAAGCCATTGTCTACTCAGGGATTCACGTAACAGAGATCACTGTATAGTCTGGGCAGAAAGCTCAAGCAGCGGATGTGTCCCCCAGATTA
  5   1   2       ext Gas  FL   in                   TGas114c03.p1kSP6                                                                                                                                                                                             GGCATCAGACATGGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAAATCACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACT
  5   1   3        nb Gas7                                  XZG1220.5p                                                                                                                                                                                                         GGAACATCTTTTCTTGGTTCTACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCN
  5   1   3        nb Gas7      in                         XZG13165.5p                                                                                                                                                                                                              AATCTTTTCTTGGTTCACTGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAANACTGTGANATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATCAAAGAGGAGAGACTAAAGGAAATTGATGTGGGAAAGTGCTT
  5   1   3        nb Gas0      in                         dad21e09.y1                                                                                                                                                                                                                        GGTTCTACCGTATCTCTGTAGCATGTTCAGCTCACATTTTGCTGCCTATGATAGCGTGATGAACAGGCAGAATGACAGGCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGT
  5   1   2       ext Gas7      in                         XZG34214.5p                                                                                                                                                                                                                                                                                                      GCGCAATCTATTTGCAGAGAGAGGCTGCTGTAAAAGACAAAGCAATTTTGTTTATATTGGACAAGATATTTCTGGCAGTCCAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATCAAAGAGGAGAGACTAAAGGAAATTGATGTGGGAAGGTGCTTAGGAGGCTGCTCATCAGGAAGCCATTGTCTACTCAGGGATTCACGTAACAGAGATCACTGTATAGTCTGGGCAGAAGGCTCAGGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTAT
  5   1   3        nb HdA                            THdA023p09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                          CCCGGGGCCCGGGGGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCGCACAGGTCTCCTGTGTTCCACAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGATATTGTGCAGACTGTGTAAAACTGTCAAATGAAGGAAAAGTGCTACCCAATCACCTACCTGTAATATTACTATGAAGTACCGTACAATTCTAATGGCATCAAACAGGAGAGACTAAAGGAAATTGATGTGGGAAGGTGCTTAGGAGGCTGCTCATCAGGAAGCCATTGTCTACTCAGGGATTCACGTAACAGAGATCACTGTATAGTCTGGGCAGAAGGCTCAGGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGC
  5   1   3        nb Gas                            TGas033o18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                      CAGTAAGTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATCAAAGAGGAGAGACTAAAGGAAATTGATGTGGGAAGGTGCTTANGAGGCTGCTCATCAGGAAGCCATTGTCTACTCAGGGATTCACGTAACAGAGATCACTGTATAGTCTGGGC
  5   1   3        nb Gas7                                 XZG57160.5p                                                                                                                                                                                                                                                                                                                                                                                            GTGTAGATGTCGGCTTGTGCAGGTCTCATTGTGGTATTCCCCAAAGAATTAATTCGTACAATCAGGCGTTGCCTGCACTTGCAAAGCATTCTTCCATGCTGGATATCCTGAAAAATAAAAAGCTGCGTGAAAGGGTTCCAGACCCACATCCTTCTTCTGGATCAGAACCTTCTTGTCCCCAGGAGTCTACCTGTCAGCCTACCAAAGTTGGGATTGAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATCAAAGAGGAGAGACTAAAGGAAATTGATGTGGGAAGGTGCTTAGGAGGCTGCTCATCAGGAAGCCATTGTCTACTCAGGGATTCACGTAACAGAGATCACTGTATAGTCTGGGCAGAAGGCTCAGGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTC
  5   1   3        nb Gas7                                 XZG57315.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATTTAAAGAGTCCTGCTTTTCCAGGGTATCCAAGAAGTGGAGGTGATAGAGGATTGCCAGTGCAGCCTGACACCGCATGATTGCATTCGAATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATCAAAGAGGAGAGACTAAAGGAAATTGATGTGGGAAGGTGCTTAGGAGGCTGCTCATCAGGAAGCCATTGTCTACTCAGGGATTCACGTAACAGAGATCACTGTATAGTCTGGGCAGAAGGCTCAGGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAAT
  5   1   2       ext Gas       in                   TGas127a04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCAGTGCAGCCTGACACCGCATGATTGACATTCATGCCATTTCTGAAGACATTTTTTCCAGACACTCCATTTTAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTA
  5   1   2       ext Gas7      in                         XZG41206.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTTCTGAAGACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATCAAAGAGGAGAGACTAAAGGAAATTGATGTGGGAAGGTGCTTAGGAGGCTGCTCATCAGGAAGCCATTGTCTACTCAGGGATTCACGTAACAGAGATCACTGTATAGTCTGGGCAGAAGGCTCAGGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGGACTATTCTGTGGGAGGACTTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATATTTTGT
  5   1   2       add Gas7      in                         XZG65356.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACATTTTTTCCAGACACTCCATTTGAATCAACAGTGGATGTTGGAAAGTGTTCTAGTCCTAAAACCAGCACAGGTCTCCTGTGTTCCCCAACTAAATTTGACACTGTGGTGGTTGAAAGCCCAAATGGAGCAGAGATTGTGCAGACTGTGGAAAACTGTGAAATGAAGGAGAACTGCTACCGAATCAGCTACCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATCAAAGAGGAGAGACTAAAGGAAATTGATGTGGGAAGGTGCTTAGGAGGCTGCTCATCAGGAAGCCATTGTCTACTCAGGGATTCACGTAACAGAGATCACTGTATAGTCTGGGCAGAAGGCTCAGGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGGATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGGACTATTCTGTGGGAGGACTTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATATTTTGTCTTAT
  5   1   2       add Gas       in                   TGas056c09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGAATCAGCTACCCTGGAATATTACTATGAAGTAGCGTACAATTCTAATGGCATCAAAGAGGAGAGACTAAAGGAAATTGATGTGGGAAGGTGCTTAGGAGGCTGCTCATCAGGAAGCCATTGTCTACTCAGGGATTCACGTAACAGAGATCACTGTATAGTCTGGGCAGAAGGCTCATGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGACTATTCTGTGGGATGACTTTTTTTTTTACTGTCAAATCTTGAACTC
  3   1   2       ext Gas7      in                         XZG34214.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAGGAAATTGATGTGGGAAGGTGCTTAGGAGGCTGCTCATCAGGAAGCCATTGTCTACTCAGGGATTCACGTAACAGAGATCACTGTATAGTCTGGGCAGAAGGCTCAGGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGGACTATTCTGTGGGAGGACTTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATATTTTGTCTTATAATTCAACTGTACTTGCACTGGAGACGTTCCAGGAGTTTAAAAGCACAATATGAAAGAAACAGTATCGATTGGACAGAGAAATTACAAACTATGAATAGATTGAATCTGGAACTTTGCATTTGACTGAATATTGAATGCTTAAAAAAAAATCTGGCCAAAATACAAACCCTGATTTGCATTTAC
  5   1   2       ext Gas       in                   TGas087f10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAACAGAGATCACTGTATAGTCTGGGCAGAAGGCTCAGGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGGACTATTCTGTGGGAGGACTTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATATTTTGTCTTATAATTCAACTGTACTTGCACT
  5   1   3        nb Gas       in                   TGas113o09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAGATCACTGTATAGTCTGGGCAGAAGGCTCAGGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAACGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGCTTTTATGTTAAGATCTAGACTATTCTGTGGGAGGACTT
  5   1   2       ext Gas       in                   TGas113o10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAGATCACTGTATAGTCTGGGCAGAAGGCTCAGGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGGACTATTCTGTGGGAGGACTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATATTTTGTCTTATAATTCAACTGTACTTGCACTGGAGACGTTCCAGGAGTTTAAAGCACAATATGAAAGAAACAGTATCGATTGGACAGAGAAATTACAAACTATGAATAGATTGAATC
  5   1   3        nb Gas7      in                         XZG20819.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGGCTCAGGCAGCGGATGTGTCCCCCAAGATTACGAGACACACACATTTAGAAGCAGAAATGGGCACATACGTTCTGTGTTTGCGATCAAGACCTGCAAATGCCAAATGTAGAGAAAATCCTCTTCTTATCACCTGGAATTTTCTATCTACTGAATAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGGACTATTCTGTGGGAGGACTTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATATTTTGTCTTATAATTCAACTGTACTTGCACTGGAGACGTTCCAGGAGTTTAAAAGCACAATATGAAAGAAACAGTATCGATTGGACAGAGAATTACAAACTATGAATAGATTGAATCTGGAACTTTGCATTTGACTGAATATTGAATGC
  5   1   3        nb Gas7      in                         XZG49752.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGAAGAATATGAAATTGCTAAATTATTTAAGCACTGTCATCAATGGTACTGAGCTGCTCACACTCAGCTACTTTTTGGTGAATGAAGAAAAGGGCACTTTTATTTCCTAAAAATTTGCCTACAGAACTGTTGAACTGGCACAAGGATTAAATACCCCTACATAAATGGATGTAGATTGAAAAAATAACACACAGTTATCATAATGGTGTTGTTTTTATGTTAAGATCTAGGACTATTCGTGGGAGGACTTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATATTTTGTCTTATAATTCAACTGTACTTGCACTGGAGACGTTCCAGGAGTTTAAAAGCACAATATGAAAGAAACAGTATCGATTGGACAGAGAAATTACAAACTATGAATAGATTGAATCTGGAACTTTGCATTTGACTGAATATTGAATGCTTAAAAAAAAATCTGGCCAAAATACAAACCCTGATTTGCATTTACAAACATCATCTTCTGAGAATTTCAAAGATTTCTGTTGACCAGTTCTACAAGGGCTCTGGCAGAAGTCCTATTCCAAAGCAAAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTGAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCAT
  5   1   3        nb Gas                            TGas003k14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACTATTCTGTGGGAGGACTTTTTTTTTACTGTCAAATCTTGAACTCAGTTGACCATATTTTGTCTTATAATTCAACTGTACTTGCACTGGAGACGTTCCAGGAGTTTAAAAGCACAATATGAAAGAAACAGTATCGATTGGACAGAGAAATTACAAACTATGAATAGATTGAATCTGGAACTTTGCATTTGACTGAATATTGAATGCTTAAAAAAAAATCTGGCCAAAATACAAACCCTGATTTGCATTTACAAACATCATCTTCTGAGAATTTCAAAGATTTCTGTTGACCAGTTCTACAAGGGCTCTGGCAGAAGTCCTATTCCAAAGCAAAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTGAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCT
  5   1   2       ext Gas7      in                         XZG60230.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTCCAGGAGTTTAAAAGCACAATATGAAAGAAACAGTATCGATTGGACAGAGAAATTACAAACTATGAATAGATTGAATCTGGAACTTTGCATTTGACTGAATATTGAATGCTTAAAAAAAAATCTGGCCAAAATACAAACCCTGATTTGCATTTACAAACATCATCTTCTGAGAATTTCAAAGATTTCTGTTGACCAGTTCTACAAGGGCTCTGGCAGAAGTCCTATTCCAAAGCAAAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTGAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAAAACAAAGTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGG
  5   1   3        nb Gas7      in                         XZG60314.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAATATTGAATGCTTAAAAAAAAATCTGGCCAAAATACAAACCCTGATTTGCATTTACAAACATCATCTTCTGAGAATTTCAAAGATTTCTGTTGACCAGTTCTACAAGGGCTCTGGCAGAAGTCCTATTCCAAAGCAAAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTGAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGNGGTTTACTAACAATACAGCAGAACCAAAGTTCTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTG
  5   1   3        nb Gas7                                 XZG10784.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTACAACATCATCTTCTGAGAATTTAAAGATTTCTGTTGACCAGTTCTACAAGGGCTCTGGCAGAAGTCCTATTCCAAAGCAAAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTGAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTGGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGNGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGA
  5   1   3        nb Neu                            TNeu047e12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCTGTTGACCAGTTCTACAGGGCTCTGGCAGAAGTCCTATTCCAAAGCAAAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTGAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTTCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTT
  3   1   3        nb Gas7 5g3  in                         XZG62190.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGAAGTCCTATTCCAAAGCAAAGCATTCCCATCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTGAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAAAAAAAAAAAAAAGG
  3  -1   3        nb Gas8                                  st42m14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTATTCCAAAGCNNAGCATTCCCGTCTTTTTCTGTCATTTCTTGGGCATTGTGACCCCTGCTGGAGCTTAGTGACAGCCCAAATGCCACACAACAAGTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATCAGTTTGAAAATTATTTGTAAATTGAATAGTGTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACNAGAAAGCATGTACCATTAAAATATTGCATTAGTCCGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGNAGATTGTTGTCATTGTCCATCTTCANCTGTATGAATCACAGAACATGCAA
  3   1   3        nb Neu                             TNeu089j05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGACAGCCCAAATGCCACACAACAAGNTATTATATTTTTCATACTAAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTTAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTGAAAATAAAATATAGTCACAGGAGAA
  3   1   2       ext Gas7      in                         XZG41206.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTCATACTAAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTGAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGATGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAAT
  3   1   3        nb Gas7      in                         XZG13165.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTAAAGGCAAATTGAATTCTAATTAATCTTCATTTGAAAATTATTTGTAAATTGAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTAGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAGCAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGAATTAGCTGAATCCTACATTATATTCG
  3   1   2       ext Gas       in                    TGas113o10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTGAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATATGTCACAGAAGGGAAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas       in                    TGas127a04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGGCAAATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTGAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCAGTCAAGATTTTGAAAATAAAATATATGTCACAGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas       in                    TGas113o09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGCAAATGAAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTGAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATATGTCACAGAAGTGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas0      in                         dad21e09.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTGAATTCTAATTAATCATCATTTGAAAATTATTTGTAAATTGAATAGTTATTCAATTTAGCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGG
  5   1   2       ext Gas7      in                         XZG56394.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAGTATGACTGTGTTTTCCTAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATATGTCACAGAAA
  3   1   3        nb Gas7                                 XZG60197.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGTCTCTCCACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTCCAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATATGTCACAGAAGTGGAAAAAAAAAAAAAAAAGG
  3   1   4      seed Gas7 5g3  in                         XZG50992.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTGCTCCTTCTGACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATATGTC
  3   1   2       ext Gas7      in                         XZG56394.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCTCCTTCTGACTAGAAAGCATGTACCATAAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATATGTCAC
  3   1   3        nb Gas  5g3  in                    TGas076k09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATATGTCACAGAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG49752.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACTAGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATATGTCAC
  3   1   2       ext Gas  FL   in                    TGas114c03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAAAGCATGTACCATTAAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTTTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATATGTCCCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas7      in                         XZG60230.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAATATTGCATTAGTCAGCTCTACTCTAGACAAGATTCCATTTTCCACAGTGCCTTGCAGATTGTTGTCATTGTCCATCTTCATCTGTATTAATCACAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTC
  3   1   2       ext Gas       in                    TGas087f10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAATCCCAGAACATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTTTTGGCTACTACAATATTTTAGTGAGAAGCACCCGGGTTTGGAAATAGCAAAGCCCAGCCCCCTCCTGTTTTTCAATGTAAAGAATTTCCCGTAAAATTTTCTGAATTTACAAATTCCAATCCCTAAAAAAAACTGTTTTGAAAAGTTGCTTAGAATTAAATTTGCTGTCATTGAGAAAAAATTGGGGTTTTTTAACAATACAGCGGAACCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGGGGGGGGGTTTAGGTGAATCCTACATTATATTTTGCCTTCAAGGCATCCCATTCCAATTTCCTAAGAAAAAAAAAAGATGATGTTTTTTGTTTAAAGTTGTAAAAAAGAAAAAAAAATATTCTGTAAAGCAAAAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTTTTAAAACACAGGCCCCAAAAGAAAAGTTTTCATTTAATTCCAATATTTATATAGGGGGGGGAATACAATATAAAACCTTGTAAAAAAAAAATACGTTTTTTTTGTCAAGATTTTTGAAAATAAAATATATGTCCCAGGGGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   3        nb Gas7      in                         XZG60314.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCATGCAAGGAACTGTGGGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTCCAATTTTTTAGTGAGAAGCACCAGTGTTTGGAAATAGCAAAGCCCAGCCCCATACTGTTTTCCAATGTAAGGAATTTCCAGTAATATTTACGGAATTTCCAAATTCCAATCCCTAAAAATAACTGTTTTGAAAAGTTGCTTAGAATTATTTTTGCTGTCATTGAGAATATATGGGGGTTTTCTACCAATCCAGCGGACCCAAAGTTCTTTTTTTTTGGTTTTTTTTAAAGCAAAGGGGGGGGATTTAGCGGAATCCTCCATTATTTTCTGCCTTCAAGGCATCCCTTTCCAATTTCCTAAGAAAAAAAAAGGAGGATGTCTTTTGTATAAAGTTGTAAAATGGAAAGAAATTTTTCCTGTAAAGCAATAAGTTGTCCATTTGTATATAAGCCGGTATATAATATTTTCTTAAAACCCGGGCCCCAATAGAAATGTTTTCATTTAATTCCAATATTTATATGGGGGGCGGAATCCAATATAAACCCTTGTAAATAAAATATACGTTTTTTCTGTCAAGATTTTGGAAAATAAAATTTTTGTCCCC
  5   1   3        nb Neu       in                   TNeu081l18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTATTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTGTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTGTTGAAAAGTTGCTTATAATTATATTTGCGGTGGGTGAGAATATATTGGGGTGTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGGGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCGTCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTGTAAAGTTGTAAAATAGAAAGAAATATATACTGTGAAGCAATAAGTTGTGCATTTGTATATAAGACTGTGTATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTGTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTGAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATATGTGACAG
  5   1   3        nb Neu                            TNeu015c09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAACTGCAGTTTTTGGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATATGTCACAG
  3   1   3        nb Neu       in                    TNeu081l18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCTTGAGGGGGTCTTGGCTACTACAATATTTTAGTGAGAAGCAGCAGTGTATGGAAATAGCAAAGCACAGACACATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTACTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATATGTCACAGAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG20819.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGGAAATAGCAAAGCCCAGCCCCCTCCTGTTTTACAATGTAAGGAATTTCCGGTAATTTTTCCGGAATTTCCAAATTCCAACCCCTAAAAATAACTGTTTTGAAAAGTTGCTTAGAATTATTTTTGCTGCCATGGGGAATATATGGGGGTTTTTTACCAATCCGGCGGACCCAAAGTTTTTTTTTTTTGTTTTTTTTAAAGCAAAGGGGGGGGATTTAGCGGAATCCTCCATTATTTTCTGCCTTCAGGGCATCCCATTCCAATTTCTTAAGAAAAAAAAAGGAGGATGTCTTTTGTTTAAAGTTGTAAAATGGAAAGAAATTTTTCCTGTAAAGCAATAAGTTGTCCATTGGTATATAAGCCGGTATATAATTTTTTCTTAAAACCCGGGCCCCAATAGAAATGTTTTCATTTAATTCCAATTTTTATATGGGGGCCGGAATCCAATATAAACCCTTGTAAATAAAATATACGTTTTTTCTGCCAAGATTTTGGAAAATAAAATTTTTGTCCC
  3   1   2       add Gas7      in                         XZG65356.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCATACTGTTTTACAATGTAATGAATTTCCAGTAATATTTACTGAATTTACAAATACCAATAACTTCCAATCACTAAAAATAACTGTATTGAAAAGTTGCTTAGAATTATATTTGCTGTCATTGAGAATATATTGGGGTTTTCTAACAATACAGCAGAACCAAAGTTTTTTTTTTTTTTTTTTTTAAAGCAAAGTGGTGGGATTTAGCTGAATCCTACATTATATTCTGCCTTCAAGGCATCCCATTCCAATATCCTAAGAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGACTGTATATAAGAGTTTCTTAAAACACAGGCCCCAATAGAAATGTTTTCATTTAATTCCAATATTTATATAGAGGACTGAATACAATATAAAACCTTGTAAATAAAATATACGTTTTCTCTGTCAAGATTTTTGAAAATAAAATATATGTCCCCG
  5   1   3        nb Neu                            TNeu062h15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTAAGAAAAAAAAATGGATGATGTCTTTTGTATAAAAGTTGTAAAATAGAAAGAAATATATACTGTAAAGCAATAAGTTGTACATTTGTATATAAGAACTGTATAATAATATTTTCTTAAAACACAGGCACCAATAGAAATGTTTTCATTTAATTCCAATATTTATAATTAGAGGAACTGAATACAATATAAAACCTTGTAAATAAAATATAACGTTTTCTCTGTCAAGATTTTTGAAAATAAAAATATATGTCACAAG
  3   1   2       add Gas       in                    TGas056c09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAAAAAAAATGATGATGTCTTTTGTATAAAGTTGTAAAATAGAAAGAAATATATACTNNGTAAAGCAATAAGTGTNGTACANTTTGTATATAAGACGTGTATATAATNATTTTTCTTAAAACCACAGCGCACCCAATAGGAAAGTGTTTCTCATTNNTAATCTCCAATANNNTTTATATAGGAGGGACGTGAATACCAATATAAAACCCTCTTGTAAATTAAAATATAGCTGTTTTCTTCTGTCAAGGATTTTTGAAAATAAAATANNTATGTCACAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)