Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012075099 Xt7.1-TNeu120o03.3 - 76 ESTs
                                                                       ..0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TNeu120o03.3   CGGACGCGTGGGCGGACACTGGACACAGAACTGTCCCCTCCGGACATTGGTACCTGCTGTGCAGAAGTGACTGGTCCGGATAGCAGAGAGCGCTCTATTCACTACTGGAGTGTGTGTGGCGCAGTGTTGCCTGTTGGCACAAGGGAAGGGTACATAGCACATGTACCGGGGATGTGACCCAGAGAGCCAGAGACAAGTAACAGTTTGCTGGGTATAGTGCAGGGCATATACACTAAACGGTCACTATACAATCCTCAACTCTTTGGACTCACTGAGCTTGCTCGGGGCTACCACAAAAATGCTTTGTTCCCCCATCTTACTTCTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCTCGCCCAAAGGTTTTCCTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCTAAGACACCAGCAGGTTGTACGTTTGGTGGAAAATTTTACTCTCTGGAGGATTCATGGCATCCAGATCTTGGGGATCCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAGCCGCAGCGAAGTCGCCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTTCTAACCCTGTCCTGCTTTCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGATGGATTCGAATATTTTCATGGGAAGGATGATGATCTTTATAATGATCGCTCTTACCTTAGTTCTGATGATGTCACTGTGGAGGAGAATCGTTCAGAATATGTTGCATTATTAACAGCACCCAGCCACGTGTGGCCCCCAGTTACCAGTGGAGTAGCCAAGGCTCGATTCAATCTGCAGCGCTCCAGTTTGCTCTTCTCAATCACCTATAAATGGATAGACAGACTTTCCCGAATCCGCTTCTCCGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCCCACGAGGTGACACTATCTGTGGTATTTGGAGGTCTCTAAATCGCTCAACTCTACGTCTTCTCCGCATGGGTCACATTCTGGTATCTTTGGTGACCACAACACTTTCAGAGCCTGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGTCCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGCTTACACTAAGTGACGTGGATGACAATCTGCACTTTATCCTTATGCTCAGAGGTCTTCGTGGTGGAGAAAGAGATCAGATTCAAATACTTGTGCAAATCTTGCATCAGAACCATGTGATACGGGAGCTTTACGCTAACATCTCTGCACAGGAACAAGACTTTGCAGAGGTGTTGCCAGACCTCTCAAGCCGTGAGATGCAGTGGCTGGCCCAAGGTCAGCTGGAGATTTCAGTGCAGACAGAAGGGAGACGTGGGCAACGCATGTCAGGCATCATCACAGTCAGAAAATCATGTGACACACTGCAGAGTGTGTTGTCTGGTGGTGACGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGCATCACACTGCATGAAAATGGAACCATGGAATATCAGATTCAAATTGCTGGTACCACAAGTGCTGTGACAGCAGTGACACTGGAGACAAAACCTCGCAGAAAAACAAAGAGAAATATACTGCATGATATGACCAAGGACTACCAAGATGGAAGGGTCTGGGGATACTGGATAGATGCTAATGCACGAGACCTACATATGCTGTTGCAAAGTGAGCTCTTCCTTAATGTAGCAACAAAGGATTTCCAGGAAGGGGAACTTAGAGGTCAAATAACCCCTCTGCTATACAGCGGCCTTTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCCATCAGGACAGGCTCAGCAGGTCACGCATGGGTTTCACTGGATGAGCACTGCCATCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGATGCTGCACTGAATGCTCATCTCCATGGTTTTGCTGAGCTTGGTGAAGTCGGTGAGAGTACCCCTGGGCACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCCCAGGGTAGTGTAAAAGACCTTGATCTTGAACTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAACCCTCGTGGTGAAATTCGAGGACAAGTGCACATACCTAACAACTGTGAATCTGGAGGAGTCTCTCTAACTCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGAGACCCAGAAGATCTTCGGAAAGATCCTAGAGCATGCTTTTTTGAAGGTCAACTAAGAGCCCATGGTTCACGATGGGCTCCAGATTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGTCAGATCAGTGTTGTCCTGTGTGCGAAGAAAAAAAAGAAATTAGAGAGGTAAAAAAAACCGAGAGAGCTCGCACAGCAAATGAAGGCTGCTTCTTTGATGGAGATCGCTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCTATTTGCACCTGCAAGGGTTCCACTGGAGAAGTGCATTGTGAGAAGGTGACCTGTCCACGACTTTCCTGTACCAACCCAATTCGTGCTAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGAAGTCCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGACCGCGATCATGCAAATTTGGGCGTCACTGGTACCCTAATAATGAGCGCTGGCATCCAACTGTGACACCCTTTGGAGAGATGAAGTGTGTTACATGTGCTTGTGTGGAGGGAGTTACACAGTGTCGGAGACAGGAGTGTACAGGAAATACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAAGCAAGATGAAGATGAAAAGGTGAAATCAGAGGAGACAAGGACTCCGTGGAGTTTCTAGAACGGAGTGCAACTGGGGCAATGGGACTGATTATCAAGGCTCATACAGGCAAGCCCCCAAGCCAAAACAACTGCCAGGACTCATGGATGGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTACTGGATTATCTCCTTTTGTTTCATTTGCTGCCATGAAGCAGTGGGATTCTAGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCTTTCAAACACCCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTAGAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAAAAGTGCCCTGTGGCTTTCTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAACTGAAGAAATTTTCCCAGTAATTGTTTTTCTATATTTTATTGGACATGGATAGAGAAGAAGGAAGTGTATATAAGAGGGAACTGGTAGGGGGGATGTCCTGAGTAATGCAAAGTCGTTCATTAATGGGCACATTCTACATTAAATGGCCAATATCCTGTCTGTGTTTTTAATTCATAAATTAAGAGGGATGCTGCAAATTCAGGATTCAGTTTAGGATTTGACCAAATCCTTAAAATATTTGCAGTATTTGGAAAAATATTTACGGTTTGGATTTAGTTCAGTTGAATGCTTAAAGTCATGTGACTTTAAAGCTCTGAACAACTGAATAAAATTAT
                                                  Xt7.1-CHK-1008224117         CGTGGGCGGACACxxxxxACAGAACTGTCCCCTCCGGACATTGGTACCTGCTGTGCAGAAGTGACTGGTCCGGATAGCAGAGAGCGCTCTATTCACTACTGGAGTGTGTGTGGCGCAGTGTTGCCTGTTGGCACAAGGGAAGGGTACATAGCACATGTACCGGGGATGTGACCCAGAGAGCCAGAGACAAGTAACAGTTTGCTGGGTATAGTGCAGGGCATATACACTAAACGGTCACTATACAATCCTCAACTCTTTGGACTCACTGAGCTTGCTCGGGGCTACCACAAAAATGCTTTGTTCCCCCATCTTACTTCTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCTCGCCCAAAGGTTTTCCTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCTAAGACACCAGCAGGTTGTACGTTTGGTGGAAAATTTTACTCTCTGGAGGATTCATGGCATCCAGATCTTGGGGATCCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAGCCGCAGCGAAGTCGCCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTTCTAACCCTGTCCTGCTTTCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGATGGATTCGAATATTTTCATGGGAAGGATGATGATCTTTATAATGATCGCTCTTACCTTAGTTCTGATGATGTCACTGTGGAGGAGAATCGTTCAGAATATGTTGCATTATTAACAGCACCCAGCCACGTGTGGCCCCCAGTTACCAGTGGAGTAGCCAAGGCTCGATTCAATCTGCAGCGCTCCAGTTTGCTCTTCTCAATCACCTATAAATGGATAGACAGACTTTCCCGAATCCGCTTCTCCGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCCCACGAGGTGACACTATCTGTGGTATTTGGAGGTCTCTAAATCGCTCAACTCTACGTCTTCTCCGCATGGGTCACATTCTGGTATCTTTGGTGACCACAACACTTTCAGAGCCTGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGTCCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGCTTACACTAAGTGACGTGGATGACAATCTGCACTTTATCCTTATGCTCAGAGGTCTTCGTGGTGGAGAAAGAGATCAGATTCAAATACTTGTGCAAATCTTGCATCAGAACCATGTGATACGGGAGCTTTACGCTAACATCTCTGCACAGGAACAAGACTTTGCAGAGGTGTTGCCAGACCTCTCAAGCCGTGAGATGCAGTGGCTGGCCCAAGGTCAGCTGGAGATTTCAGTGCAGACAGAAGGGAGACGTGGGCAACGCATGTCAGGCATCATCACAGTCAGAAAATCATGTGACACACTGCAGAGTGTGTTGTCTGGTGGTGACGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGCATCACACTGCATGAAAATGGAACCATGGAATATCAGATTCAAATTGCTGGTACCACAAGTGCTGTGACAGCAGTGACACTGGAGACAAAACCTCGCAGAAAAACAAAGAGAAATATACTGCATGATATGACCAAGGACTACCAAGATGGAAGGGTCTGGGGATACTGGATAGATGCTAATGCACGAGACCTACATATGCTGTTGCAAAGTGAGCTCTTCCTTAATGTAGCAACAAAGGATTTCCAGGAAGGGGAACTTAGAGGTCAAATAACCCCTCTGCTATACAGCGGCCTTTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCCATCAGGACAGGCTCAGCAGGTCACGCATGGGTTTCACTGGATGAGCACTGCCATCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGATGCTGCACTGAATGCTCATCTCCATGGTTTTGCTGAGCTTGGTGAAGTCGGTGAGAGTACCCCTGGGCACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCCCAGGGTAGTGTAAAAGACCTTGATCTTGAACTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAACCCTCGTGGTGAAATTCGAGGACAAGTGCACATACCTAACAACTGTGAATCTGGAGGAGTCTCTCTAACTCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGAGACCCAGAAGATCTTCGGAAAGATCCTAGAGCATGCTTTTTTGAAGGTCAACTAAGAGCCCATGGTTCACGATGGGCTCCAGATTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGTCAGATCAGTGTTGTCCTGTGTGCGAAGAAAAAAAAGAAATTAGAGAGGTAAAAAAAACCGAGAGAGCTCGCACAGCAAATGAAGGCTGCTTCTTTGATGGAGATCGCTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCTATTTGCACCTGCAAGGGTTCCACTGGAGAAGTGCATTGTGAGAAGGTGACCTGTCCACGACTTTCCTGTACCAACCCAATTCGTGCTAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGAAGTCCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGACCGCGATCATGCAAATTTGGGCGTCACTGGTACCCTAATAATGAGCGCTGGCATCCAACTGTGACACCCTTTGGAGAGATGAAGTGTGTTACATGTGCTTGTGTGGAGGGAGTTACACAGTGTCGGAGACAGGAGTGTACAGGAAATACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAAGCAAGATGAAGATGAAAAGGTGAAATCAGAGGAGACAAGGACTCCGTGGAGTTTCTAGAACGGAGTGCAACTGGGGCAATGGGACTGATTATCAAGGCTCATACAGGCAAGCCCCCAAGCCAAAACAACTGCCAGGACTCATGGATGGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTACTGGATTATCTCCTTTTGTTTCATTTGCTGCCATGAAGCAGTGGGATTCTAGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCTTTCAAACACCCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTAGAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAAAAGTGCCCTGTGGCTTTCTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAACTGAAGAAATTTTCCCAGTAATTGTTTTTCTATATTTTATTGGACATGGATAGAGAAGAAGGAAGTGTATATAAGAGGGAACTGGTAGGGGGGATGTCCTGAGTAATGCAAAGTCGTTCATTAATGGGCACATTCTACATTAAATGGCCAATATCCTGTCTGTGTTTTTAATTCATAAATTAAGAGGGATGCTGCAAATTCAGGATTCAGTTTAGGATTTGACCAAATCCTTAAAATATTTGCAGTATTTGGAAAAATATTTACGGTTTGGATTTAGTTCAGTTGAATGTTTAAAGTCATGTGACTTTAAAGCTCTGAACAACTGAATAAAATTATTTTTTG
                                                      consensus depths        2     2     2     3     7    12     7    12     7    12     7    12     7    12    12    12     7    12    12    12     7    12     7    12     7    12     7    12     7    12     8    13     8    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    12    13    12    13    12    13    12    13    13    14    13    14    13    14    13    14    12    14    12    14    12    14    12    14    12    14    12    14    12    14    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    11     8     9     6     7     5     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     8     5     6     5     6     5     6     5     6     4     5     4     5     4     5     4     5     5     6     5     6     4     6     3     5     3     4     3     4     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     6     6     6     6     5     6     4     5     4     5     4     5     4     5     5     6     6     7     6     7     6     7     6     7     7     8     7     8     7     7     6     6     6     6     7     7     8     8     7     8     9     9    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    14    13    14    13    14    13    14    12    14    13    14    13    14    13    14    14    15    15    16    15    16    15    16    15    16    15    16    15    16    15    17    15    17    17    19    17    19    17    19    17    18    17    18    17    18    17    18    17    18    17    19    17    19    17    19    16    18    15    17    13    17    15    17    14    17    14    17    15    18    16    18    16    18    16    17    16    16    15    16    15    16    16    16    16    16    15    16    16    16    16    16    15    17    17    17    17    17    17    18    17    18    17    18    17    19    17    19    17    19    17    19    17    19    15    17    13    17     7    11     6     9     6     9     8     9     8     9    10    10    11    11    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    11    11    11    11    11    11    11    11    11    11    11    11    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    14    15    14    15    15    16    15    16    16    18    16    16    15    15    16    16    15    15    16    16    16    16    14    14    14    14    15    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    17    17    17    17    17    17    18    18    18    18    18    18    18    18    18    18    18    18    19    19    20    20    20    20    19    19    18    19    20    20    20    20    21    22    21    21    22    22    21    21    21    21    21    21    20    21    20    21    21    22    22    22    23    23    23    23    23    23    22    22    22    22    22    22    22    22    23    23    23    23    23    23    22    22    22    22    22    22    22    22    20    22    22    22    22    22    21    22    22    22    21    22    15    16     6     8     5     7     5     7     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     5     3     5     3     5     4     5
                                                                   SNP                                                                                       -------T--A-
                                                                   SNP                                                                                                               --------GC--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------G-----
                                               BLH ATG     298    1240   
                                               BLH MIN     298     264   
                                               BLH MPR     121     264   
                                               BLH OVR     298     100   
                                               CDS MIN     298     264   
                                               EST CLI      16      75   
                                               ORF LNG     298      28   
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ce ---- 5e-015     NP_741617.1 Von Willebrand factor type C domain and Antistasin family family member[Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 4e-043     NP_001016257.1 chordin [Xenopus tropicalis] ===============================================================================================================================================================
                                                                                                                                                                                                  PROTEIN --- Dm ---- 2e-088     NP_476736.1 CG9224-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 1e-131     XP_001181182.1 PREDICTED: similar to chordin [Strongylocentrotus purpuratus] ------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ci ---- 5e-163     BAE06347.1 chordin [Ciona intestinalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Bf ---- 0          ABG66525.1 chordin [Branchiostoma floridae] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Mm ---- 0          NP_034023.1 chordin [Mus musculus] ---------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Hs ---- 0          NP_003732.2 chordin isoform a [Homo sapiens] -----------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dr ==== 0          NP_571048.1 chordin [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Gg ==== 0          NP_990311.1 chordin [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 0          AAC42222.1 chordin [Xenopus laevis]  ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === ?? ==== 0          NP_001081778.1 chordin [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TNeu120o03.3                                                                      TGA------------------------------------------------------------------------------------TAG---ATG---------------------------------------------------TAG---------------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------TGA------------------------------------------------------------------------------------TGATGA---------------------------------------------------------TAG---------------------------------------------------------------------TGA------------TAA---------------------------TAA------------------ATG---------------------------------------------------------------------------------------------------TGA------------------------------------------------------TGAATG---------ATGATG------TGA------ATG------------------------------------------------------------------------------------------------TAA---------------------------TGA------------TGA---------------------------------------------------------------------------------TAG---------------TAA---------------TAA---------------------------------------------------TAA------------------------------------------------------------------------------------------------TAG------TGAATG---------ATGTGA---TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  0   1   1           Gas  FLsh                   TGas143n13.FL-Sanger CCCGGGGATTCCCCGGGGGACACTGGACAGAACTGTCCCCTCCGGACATTGGTACCTGCTGTGCAGAAGTGACTGGTCCGGATAGCAGAGAGCGCTCTATTCACTACTGGAGTGTGTGTGGCGCAGTGTTGCCTGTTGGCACAAGGGAAGGGTACATAGCACATGTACCGGGGATGTGACCCAGAGAGCCAGAGACAAGTAACAGTTTGCTGGGTATAGTGCAGGGCATATACACTAAACGGTCACTATACAATCCTCAACTCTTTGGACTCACTGAGCTTGCTCGGGGCTACCACAAAAATGCTTTGTTCCCCCATCTTACTTCTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCTCGCCCAAAGGTTTTCCTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCTAAGACACCAGCAGGTTGTACGTTTGGAGGGGCTACCACAAAAATGCTTTGTTCCCCCATCTTACTTCTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCTCGCCCAAAGGTTTTCCTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCTAAGACACCAGCAGGTTGTACGTTTGGTGGAAAATTTTACTCTCTGGAGGATTCATGGCATCCAGATCTTGGGGATCCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAGCCGGTAAGAAGGGATATAAGGGCCAAACACACACATGCAAATATAATTTAAAAGCAAATAAAGGTGGTGCTGGTATAATACTAACGGGGGAGGGTGGTAAGTGAAATATAAGAAAACAAAGAGATTGCAGGTAGCTGGAAAGGTCTTTTAGACGGGTGCATTTAAAAAGGAACCAGACAATAAAATAGGCTTCACATAAGAATTGAAGTAAGTAAGGAGGAGACAGATTTGGCTGCTATTAATTGCTAATTACTAGATACATAATGAGTTAGCTAGGCAGTATTACTGACCACTAATGAGTGAAGAGGAAGTTCTGGATTTGTGTATTGGATAGCTTTTGTGCTAGCCCATGCTATCAACAAAAATAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7      out                        XZG47128.5p   CGGACGCGTGGGCGGACACTGGACAGAACTGTCCCCTCCGGACATTGATACCTGCTGTGCAGAAGTGACTGGTCCGGATAGCAGAGAGCGCTCTATTCACTACTGGAGTGTGTGTGGCGCAGTGTTGCCTGTTGGCACAAGGGAAGGGTACATAACACATGTACCGGGGATGTGACCCAGAGAGCCAGAGACAAGTAACATAGTTTGCTGGGTATAGTGCAGGGCATATACACTAAACGGTCACTATACAATCCTCAACTCTTTGGACTCACTGAGCTTGCTCGGGGCTACCACAAAAATGCTTTGTTCCCCCATCTTACTTCTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCTCGCCCAAAGGTTTTCCTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCTAAGACACCAGCAGGTTGTACGTTTGGTGGAAAATTTTACTCTCTGGAGGATTCATGGCATCCAGATCTTGGGGATCCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAGCCGCAGCGAAGTCGCCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTTCTAACCCTGTCCTGCTTTCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGATGGATTCGAATATTTTCATGGGAAGGATGATGATCTTTATAATGATCGCTCTTACCTTAGTTCTGATGATGTCACTGTGGA
  5   1   2   12  bld Gas7 5g3  in                         XZG64003.5p ..CGGACGCGTGGGCGGACACTGGACAGAACTGTCCCCTCCGGACATTGATACCTGCTGTGCAGAAGTGACTGGTCCGGATAGCAGAGAGCGCTCTATTCACTACTGGAGTGTGTGTGGCGCAGTGTTGCCTGTTGGCACAAGGGAAGGGTACATAACACATGTACCGGGGATGTGACCCAGAGAGCCAGAGACAAGTAACATAGTTTGCTGGGTATAGTGCAGGGCATATACACTAAACGGTCACTATACAATCCTCAACTCTTTGGACTCACTGAGCTTGCTCGGGGCTACCACAAAAATGCTTTGTTCCCCCATCTTACTTCTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCTCGCCCAAAGGTTTTCCTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCTAAGACACCAGCAGGTTGTACGTTTGGTGGAAAATTTTACTCTCTGGAGGATTCATGGCATCCAGATCTTGGGGATCCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAGCCGCAGCGAAGTCGCCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTTCTAACCCTGTCCTGCTTTCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGATGGATTCGAATATTTTCATGGGAAGGATGATGATCTTTATAATGATCGCTCTTACCTTAGTTCTGATGATGTCACTGTGGAGGAGAATCGTTCAGAATATGTTGCATTATTAACAGCACCCAGCCACGTGTGG
  5   1   2       bld Gas  5g                        TGas033j13.p1kSP6          CCCGGGGCGGACACTGGACAGAACTGTCCCCTCCGGACATTGGTACCTGCTGTGCAGAAGTGACTGGTCCGGATAGCAGAGAGCGCTCTATTCACTACTGGAGTGTGTGTGGCGCAGTGTTGCCTGTTGGCACAAGGGAAGGGTACATAGCACATGTACCGGGGATGTGACCCAGAGAGCCAGAGACAAGTAACAGTTTGCTGGGTATAGTGCAGGGCATATACACTAAACGGTCACTATACAATCCTCAACTCTTTGGACTCACTGAGCTTGCTCGGGGCTACCACAAAAATGCTTTGTTCCCCCATCTTACTTCTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCTCGCCCAAAGGTTTTCCTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCTAAGACACCAGCAGGTTGTACGTTTGGTGGAAAATTTTACTCTCTGGAGGATTCATGGCATCCAGATCTTGGGGATCCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAGCCGCAGCGAAGTCGCCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTNCTGTTCTAACCCTGTCCTGCTTTCTGGACATTGCTGCAAGACTTGTCCCAA
  5   1   2   22  bld Gas7 PIPE                            XZG42036.5p ...............GGACACTGGACAGAACTGTCCCCTCCGGACATTGATACCTGCTGTGCAGAAGTGACTGGTCCGGATAGCAGAGAGCGCTCTATTCACTACTGGAGTGTGTGTGGCGCAGTGTTGCCTGTTGGCACAAGGGAAGGGTACATAACACATGTACCGGGGATGTGACCCAGAGAGCCAGAGACAAGTAACATAGTTTGCTGGGTATAGTGCAGGGCATATACACTAAACGGTCACTATACAATCCTCAACTCTTTGGACTCACTGAGCTTGCTCGGGGCTACCACAAAAATGCTTTGTTCCCCCATCTTACTTCTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCTCGCCCAAAGGTTTTCCTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCTAAGACACCAGCAGGTTGTACGTTTGGTGGAAAATTTTACTCTCTGGAGGATTCATGGCATCCAGATCTTGGGGATCCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAGCCGCAGCGAAGTCGCCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTTCTAACCCTGTCCTGCTTTCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGATGGATTCGAGTATTTTCATGGGAAGGATGATGATCTTTATAATGATCGCTCTTACCTTAGTTCTGATGATGTCACTGTGGA
  5   1   2   12  bld Gas7 5g3  in                         XZG61427.5p ................CGGACACTGGACAGAACTGTCCCCTCCGGACATTGGTACCTGCTGTGCAGAAGTGACTGGTCCGGATAGCAGAGAGCGCTCTATTCACTACTGGAGTGTGTGTGGCGCAGTGTTGCCTGTTGGCACAAGGGAAGGGTACATAACACATGTACCGGGGATGTGACCCAGAGAGCCAGAGACAAGTAACAGTTTGCTGGGTATAGTGCAGGGCATATACACTAAACGGTCACTATACAATCCTCAACTCTTTGGACTCACTGAGCTTGCTCGGGGCTACCACAAAAATGCTTTGTTCCCCCATCTTACTTCTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCTCGCCCAAAGGTTTTCCTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCTAAGACACCAGCAGGTTGTACGTTTGGTGGAAAATTTTACTCTCTGGAGGATTCATGGCATCCAGATCTTGGGGATCCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAGCCGCAGCGAAGTCGCCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTTCTAACCCTGTCCTGCTTTCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGATGGATTCGAGTATTTTCATGGGAAGGATGATGATCTTTATAATGATCGCTCTTACCTTAGTTCTGATGATGTCACTGTGGAGGAGAATCGTTCAGAATATGTTGCATTATTAACAGCACCCAGCCACGTGTGGCCCCCAGTTACCAGTGGAGTAGCCCAGGCTCGATTCAATCTGCAGCGCTCCAGTTTGCTCTTCTCAATCCACTATAAAT
  5   1   2       bld Gas       in                   TGas105c02.p1kSP6                  GGACACTGGACAGAACTGTCCCCTCCGGACATTGGTACCTGCTGTGCAGAAGTGACTGGTCCGGATAGCAGAGAGCGCTCTATTCACTACTGGAGTGTGTGTGGCGCAGTGTTGCCTGTTGGCACAAGGGAAGGGTACATAGCACATGTACCGGGGATGTGACCCAGAGAGCCAGAGACAAGTAACAGTTTGCTGGGTATAGTGCAGGGCATATACACTAAACGGTCACTATACAATCCTCAACTCTTTGGACTCACTGAGCTTGCTCGGGGCTACCACAAAAATGCTTTGTTCCCCCATCTTACTTCTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCTCGCCCAAAGGTTTTCCTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCTAAGACACCAGCAGGTTGTACGTTTGGTGGAAAATTTTACTCTCTGGAGGATTCATGGCATCCAGATCTTGGGGATCCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAGCCGCAGCGAAGTCGCCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTTCTAACCCTGTCCTGCTTTCTGGACATTGCTGC
  5   1   2       chi Gas  FLsh in                   TGas143n13.p1kSP6                   GACACTGGACAGAACTGTCCCCTCCGGACATTGGTACCTGCTGTGCAGAAGTGACTGGTCCGGATAGCAGAGAGCGCTCTATTCACTACTGGAGTGTGTGTGGCGCAGTGTTGCCTGTTGGCACAAGGGAAGGGTACATAGCACATGTACCGGGGATGTGACCCAGAGAGCCAGAGACAAGTAACAGTTTGCTGGGTATAGTGCAGGGCATATACACTAAACGGTCACTATACAATCCTCAACTCTTTGGACTCACTGAGCTTGCTCGGGGCTACCACAAAAATGCTTTGTTCCCCCATCTTACTTCTGTGGACCTGTGGATTATGCTGTGGATTGCTCTCGCCCAAAGGTTTTCCCTGCCATTCAGCCTGAACAGGAGCCCCTCCAATCTAAGACACCAGCAGGTTGTACGTTTTGGAGGGGCTACCACAAAATGCTTTGTTCCCCCATCTTACTTCTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCTCGCCCAAGTTTTCCTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCTAAGACACCAGCAGGTTGTACGTTTGGTGGAAAATTTTACTCTCTGGAGGATTCATGGCATCCAGATCTTGGGGA
  5   1   2       bld Neu  5g                        TNeu140e03.p1cSP6                   GACACTGGACAGAACTGTCCCCTCCGGACATTGGTACCTGCTGTGCAGAAGTGACTGGTCCGGATAGCAGAGAGCGCTCTATTCACTACTGGAGTGTGTGTGGCGCAGTGTTGCCTGTTGGCACAAGGGAAGGGTACATAGCACATGTACCGGGGATGTGACCCAGAGAGCCAGAGACAAGTAACAGTTTGCTGGGTATAGTGCAGGGCATATACACTAAACGGTCACTATACAATCCTCAACTCTTTGGACTCACTGAGCTTGCTCGGGGCTACCACAAAAATGCTTTGTTCCCCCATCTTACTTCTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCTCGCCCAAAGGTTTTCCTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCTAAGACACCAGCAGGTTGTACGTTTGGTGGAAAATTTTACTCTCTGGAGGATTCATGGCATCCAGATCTTGGGGATCCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAGCCGC
  5   1   2       bld Neu0 5g3  in                     NISC_ng20d11.y1                   GACACTGGACAGAACTGTCCCCTCCGGACATTGGTACCTGCTGTGCAGAAGTGACTGGTCCGGATAGCAGAGAGCGCTCTATTCACTACTGGAGTGTGTGTGGCGCAGTGTTGCCTGTTGGCACAAGGGAAGGGTACATAGCACATGTACCGGGGATGTGACCCAGAGAGCCAGAGACAAGTAACAGTTTGCTGGGTATAGTGCAGGGCATATACACTAAACGGTCACTATACAATCCTCAACTCTTTGGACTCACTGAGCTTGCTCGGGGCTACCACAAAAATGCTTTGTTCCCCCATCTTACTTCTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCTCGCCCAAAGGTTTTCCTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCTAAGACACCAGCAGGTTGTACGTTTGGTGGAAAATTTTACTCTCTGGAGGATTCATGGCATCCAGATCTTGGGGATCCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAGCCGCAGCGAAGTCGCCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTTCTAACCCTGTCCTGCTTTCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTCCTCCTA
  5   1   2       bld Neu  5g                        TNeu033c04.p1kSP6                   GACACTGGACAGAACTGTCCCCTCCGGACATTGGTACCTGCTGTGCAGAAGTGACTGGTCCGGATAGCAGAGAGCGCTCTATTCACTACTGGAGTGTGTGTGGCGCAGTGTTGCCTGTTGGCACAAGGGAAGGGTACATAGCACATGTACCGGGGATGTGACCCAGAGAGCCAGAGACAAGTAACAGTTTGCTGGGTATAGTGCAGGGCATATACACTAAACGGTCACTATACAATCCTCAACTCTTTGGACTCACTGAGCTTGCTCGGGGCTACCACAAAAATGCTTTGTTCCCCCATCTTACTTCTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCTCGCCCAAAGGTTTTCCTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCTAAAACACCACCAGGTTGTACGTTTGGTGGAAAATTTTACTCTCTGGAGGATTCATGGCATCCAGATCTTGGGGATCCATTCCGAGTTATGCACTGTGTATTATGCTATTGTGA
  5   1   2       bld Neu  5g                        TNeu011c22.p1kSP6                        GACAGAACTGTCCCCTCCGGACATTGATACCTGCTGTGCAGAAGTGACTGGTCCGGATAGCAGAGAGCGCTCTATTCACTACTGGAGTGTGTGTGGCGCAGTGTTGCCTGTTGGCACAAGGGAAGGGTACATAACACATGTACCGGGGATGTGACCCAGAGAGCCAGAGACAAGTAACATAGTTTGCTGGGTATAGTGCAGGGCATATACACTAAACGGTCACTATACAATCCTCAACTCTTTGGACTCACTGAGCTTGCTCGGGGCTACCACAAAAATGCTTTGTTCCCCCATCTTACTTCTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCTCGCCCAAAGGTTTTCCTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCTAAGACACCAGCAGGTTGTACGTTTGGTGGAAAATTTTACTCTCTGGAGGATTCATGGCATCCAGATCTTGGGGATCCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAGCCGCAGCGAAGTCGCCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTTCTAACCCTGTCCTGCTTTCTGGACATTGCTGC
  5   1   2       bld Neu  5g                        TNeu140p12.p1cSP6                         ACAGAACTGTCCCCTCCGGACATTGATACCTGCTGTGCAGAAGTGACTGGTCCGGATAGCAGAGAGCGCTCTATTCACTACTGGAGTGTGTGTGGCGCAGTGTTGCCTGTTGGCACAAGGGAAGGGTACATAACACATGTACCGGGGATGTGACCCAGAGAGCCAGAGACAAGTAACATAGTTTGCTGGGTATAGTGCAGGGCATATACACTAAACGGTCACTATACAATCCTCAACTCTTTGGACTCACTGAGCTTGCTCGGGGCTACCACAAAAATGCTTTGTTCCCCCATCTTACTTCTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCTCGCCCAAAGGTTTTCCTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCTAAGACACCAGCAGGTTGTACGTTTGGTGGAAAATTTTACTCTCTGGAGGATTCATGGCATCCAGATCTTGGGGATCCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAGCCGCAGCGAAGTCGCCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTTCTAACCCTGTCCTGCTTTCTGGACATTGCTGCAAGACTTGTCCC
  3   1   2       chi Gas  FLsh in                    TGas143n13.q1kT7                                                                                                                                                                                       AGAGAGCCAGAGACAAGTAACAGTTTGCTGGGTATAGTGCAGGGCATATACACTAAACGGTCACTATACAATCCTCAACTCTTTGGACTCACTGAGCTTGCTCGGGGCTACCACAAAAATGCTTTGTTCCCCCATCTTACTTCTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCTCGCCCAAAGGTTTTCCTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCTAAGACACCAGCAGGTTGTACGTTTGGAGGGGCTACCACAAAAATGCTTTGTTCCCCCATCTTACTTCTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCTCGCCCAAAGGTTTTCCTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATTTAAGACACCAGCAGGTTGTACGTTTGGTGGAAAATTTTACTCTCTGGAGGATTCATGGCATCCAGATCTTGGGGATCCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAGCCGGTAAGAAGGGATATAAGGGCCAAACACACACATGCAAATATAATTTAAAAGCAAATAAAGGTGGTGCTGGTATAATACTAACGGGGGAGGGTGGTAAGTGAAATATAAGAAAACAAAGAGATTGCAGGTAGCTGGAAAGGTCTTTTAGACGGGTGCATTTAAAAAGGAACCAGACAATAAAATAGGCTTCACATAAGAATTGAAGTAAGTAAGGAGGAGACAGATTTGGCTGCTATTAATTGCTAATTACTAGATACATAATGAGTTAGCTAGGCAGTATTACTGACCACTAATGAGTGAAGAGGAAGTTCTGGATTTGTGTATTGGATAGCTTTTGTGCTAGCCCATGCTATCAACAAAAATAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu       in                   TNeu080l20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                           CCCATTCAGCCTGAACAGGAGCCCCTCCAATCTAAGACACCAGCAGGTTGTACGTTTGGTGGAAAATTTTACTCTCTGGAGGATTCATGGCATCCAGATCTTGGGGATCCATTCGGAGTTATGCACTGTGTATTATGCTATTGTGAGCCGCAGCGAAGTCGCCGGGGAAAACCATCTGGCAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTTCTAACCCTGTCCTGCTTTCTGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGATGGATTCGAATATTTTCATGGGAAGGATGATGATCTTTATAATGATCGCTCTTACCTTAGTTCTGATGATGTCACTGTGGAGGAGAATCGTTCAGAATATGTTGCATTATTAACAGCACCCAGCCACGTGTGGCCCCCAGTTACCAGTGGAGTAGCCAAGGCTCGATTCAATCTGCAGCGCTCCAGTTTGCTCTTCTCAACACCTATAAATGGATAGACAGAC
  5   1   2       bld Gas1      in                     NISC_mq14b08.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATAAAGAAATCAGACTTTGTTTTTGATGGATTCGAGTATTTTCATGGGAAGGATGATGATCTTTATAATGATCGCTCTTACCTTAGTTCTGATGATGTCACTGTGGAGGAGAATCGTTCAGAATATGTTGCATTATTAACAGCACCCAGCCACGTGTGGCCCCCAGTTACCAGTGGAGTAGCCAAGGCTCGATTCAATCTGCAGCGCTCCAGTTTGCTCTTCTCAATCACCTATAAATGGATAGACAGACTTTCCCGAATCCGCTTCTCCGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCCCACGAGGTGACACTATCTGTGGTATTTGGAGGTCTCTAAATCGCTCAACTCTACGTCTTCTCCGCATGGGTCACATTCTGGTATCTTTGGTGACCACAACACTTTCAGAGCCTGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGTCCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGCTTACACTAAGTGACGTGGATGACAATCTGCACTTTATCCTTATGCTCAGAGGTCTTCGTGGTGGAGAAAGAGATCA
  3  -1   2       bld Gas       in                    TGas062k18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTAGTTCTGATGATGTCACTGTGGAGGAGAATCGTTCAGAATATGTTGCATTATTAACAGCACCCAGCCACGTGTGGCCCCCAGTTACCAGTGGAGTAGCCAAGGCTCGATTCAATCTGCAGCGCTCCAGTTTGCTCTTCTCAATCACCTATAAATGGATAGACAGACTTTCCCGAATCCGCTTCTCCGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCCCACGAGGTGACACTATCTGTGGTATTTGGAGGTCTCTAAATCGCTCAACTCTACGTCTTCTCCGCATGGGTCACATTCTGGTATCTTTGGTGACCACAACACTTTCAGAGCCTGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGTCCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGCTTACACTAAGTGACGTGGATGACAATCTGCACTTTATCCTTATGCTCAGAGGTCTTCGTGGTGGAGAAAGAGATCAGATTCAAATACTTGTGCAAATCTTGCATCAGAACCATGTGATACGGGAGCTTTACGCTAACATCTCTGCACAGGAACAAGACTTTGCAGAGGTGTTGCCAGACCTTTCAAGCCGTGAGATGCAGTGGCTGGCCCAAGGTCAGCTGGAGATTTCAGTGCAGACAGAAGGGAGACGTGGGCAACGCATGTCAGGCATCATCACAGTCAGAAAATCATGTGACACACTGCAGAGTGTGTTNGTCTGGTGGTGACGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGNCAGCATCACACTGCATGAAAATGGAACCATGGAATATCAGAATTCAATTGCTGGTACCCACAGTGCTGTGACAGCAGTGACACT
  5   1   2       bld Gas                            TGas133k05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCGATTCAATCTGCAGCGCTCCAGTTTGCTCTTCTCAATCACCTATAAATGGATAGACAGACTTTCCCGAATCCGCTTCTCCGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCCCACGAGGTGACACTATCTGTGGTATTTGGAGGTCTCTAAATCGCTCAACTCTACGTCTTCTCCGCATGGGTCACATTCTGGTATCTTTGGTGACCACAACACTTTCAGAGCCTGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGTCCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGCTTACACTAAGTGACGTGGATGACAATCTGCACTTTATCCTTATGCTCAGAGGTCTTCGTGGTGGAGAAAGAGATCAGATTCAAATACTTGTGCAAATCTTGCATCAGAACCATGTGATACGGGAGCTTTACGCTAACATCTCTGCACAGGAACAAGACTTTGCAGAGGTGTTGCCAGACCTCTCAAGCCGTGAGATGCAGTGGCTGGCCCAAGGTCAGCTGGAGATTTCAGTGCAGACAGAAGGGAGACGTGGGCAACGCATGTCAGGCATCATCAC
  5   1   2       bld Gas7      in                         XZG20660.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCCGATCTTGAAGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCCCACGAGGTGACACTATCTGTGGTATTTGGAGGTCTCTAAATCGCTCAACTCTACGTCTTCTCCGCATGGGTCACATTCTGGTATCTTTGGTGACCACAACACTTTCAGAGCCTGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGTCCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGCTTACACTAAGTGACGTGGATGACAATCTGCACTTTATCCTTATGCTCAGAGGTCTTCGTGGTGGAGAAAGAGATCAGATTCAAATACTTGTGCAAATCTTGCATCAGAACCATGTGATACGGGAGCTTTACGCTAACATCTCTGCACAGGAACAAGACTTTGCAGAGGTGTTGCCAGACCTCTCAAGCCGTGAGATGCAGTGGCTGGCCCAAGGTCAGCTGGAGATTTCAGTGCAGACAGAAGGGAGACGTGGGCAACGCATGTCAGGCATCATCACAGTCAGAAAATCATGTGACACACTGCAGAGTGTGTTGTCTGGTGGTGACGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGCATCACACTGCATGAAAATGGAACCATGGAATATCAGATTCAAATTGCTGGTACCACAAGTGCTGTGACAGCAGTGACACTGGAGACAAAAC
  5   1   2       bld Gas       in                   TGas102f08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATCCCCACGAGGTGACACTATCTGTGGTATTTGGAGGTCTCTAAATCGCTCAACTCTACGTCTTCTCCGCATGGGTCACATTCTGGTATCTTTGGTGACCACAACACTTTCAGAGCCTGAAATATCAGGCAAGATTGTCAAACACAAAGCCCTGTTTTCAGAGTCCTTCAGTGCACTTCTTACCCCAGAAGACTCTGATGTAACAGGAGGTGGAGGACTCGCAATGCTTACACTAAGTGACGTGGATGACAATCTGCACTTTATCCTTATGCTCAGAGGTCTTCGTGGTGGAGAAAGAGATCAGATTCAAATACTTGTGCAAATCTTGCATCAGAACCATGTGATACGGGAGCTTTACGCTAACATCTCTGCACAGGAACAAGACTTTGCAGAGGTGTTGCCAGACCTTTCAAGCCGTGAGATGCAGTGGCTGGCCCAAAGTCAGCTGGAGATTTCAGTGCAGACAGAAAGGAGACGTGGGCAACGCATGTCAGGCGTCATCACAGTCAGAAAATCATGTGACACACTGCAAGTGTGTTGTCT
  5   1   2       bld Gas7      in                          XZG7253.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATCGGGAGCTTTACGCTAACATCTCTGCACAGGAACAAGACTTTGCAGAGGTGTTGCCAGACCTCTCAAGCCGTGAGATGCAGTGGCTGGCCCAAGGTCAGCTGGAGATTTCAGTGCAGACAGAAGGGAGACGTGGGCAACGCATGTCAGGCATCATCACAGTCAGAAAATCATGTGACACACTGCAGAGTGTGTTGTCTGGTGGTGACGCTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGCATCACACTGCATGAAAATGGAACCATGGAATATCAGATTCAAATTGCTGGTACCACAAGTGCTGTGACAGCAGTGACACTGGAGACAAAACCTCGCAGAAAAACAAAGAGAAATATACTGCATGATATGACCAAGGACTACCAAGATGGAAGGGTCTGGGGATACTGGATAGATGCTAATGCACGAGACCTACATATGCTGTTGCAAAGTGAGCTCTTCCTTAATGTAGCAACAAAGGATTTCCAGGAAGGGGAACTTAGAGGTCAAATAACCCCTCTGCTATACAGCGGCCTTTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCCATCAGGACAGGCTCAGCAGGTCACGCATGGGTTTCACTGGATGAGCACTGCCATCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGATGCTGCACTGAATGCTCATCTCCATGGTTTTGCTGAGCTTGGTGAAGTCGGTGAGAGTACCCCTGGGCACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCCCAGGGTAGTGTAAAAGACCTTGATCTTGAAACTTTGGGACATCTG
  5   1   2       chi Gas7      in                         XZG30024.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACTTTGCAGAGGTGTTGCCAGACCTCTCAAGCCGTGAGATGCAGTGGCTGGCCCAAGGTCAGCTGGAGATTTCAGTGCAGACAGAAGGGAGACGTGGGCAACGCATGTCAGGCATCATCACAGTCAGAAAATCATGTGACACACTGCAGAGTGTGTTGTCTGGTGGTGACACTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGCATCACACTGCATGAAAATGGAACCATGGAATATCAGATTCAAATTGCTGGTACCACAAGTGCTGTGACAGCAGTGACACTGGAGACAAAACCTCGCAGAAAAACAAAGAGAAATATACTGCATGATATGACCAAGGACTACCAAGATGGAAGGGTCTGGGGATACTGGATAGATGCTAATGCACGAGACCTACATATGCTGTTGCAAAGTGAGCTCTTCCTTAATGTAGCAACAAAGGATTTCCAGGAAGGGGAACCTAGAGGTCAAATAACCCCTCTGCTATACAGCGGCCTTTGGGCCAGATATGAGCGTAAGTGTGCCATGCATTTGTATCTTTATATCTGTCTTTAACAGTCTAACTTTCTAGGTATATCTATTTTTATGAGGCTGCATTGCTCTTCTCTCACTGTTTTATTTTAACTCTTTCTCCTTCCCACCATTTCAAATTGCATTCTTGCTCTCCTGCTTTACCATCCCATTCTTTCTTGCTTTCCCCCCCTTC
  5   1   2       bld Gas7      in                           XZG903.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGCACGCATGTCAGGCATCATCACAGTCAGAAAATCATGTGACACACTGCAGAGTGTGTTGTCTGGTGGTGACACTTTAAATCCCACCAAAACTGGAGCTGTGGGATCTGCAAGCATCACACTGCATGAAAATGGAACCATGGAATATCAGATTCAAATTGCTGGTACCACAAGTGCTGTGACAGCAGTGACACTGGAGACAAAACCTCGCAGAAAAACAAAGAGAAATATACTGCATGATATGACCAAGGACTACCAAGATGGAAGGGTCTGGGGATACTGGATAGATGCTAATGCACGAGACCTACATATGCTGTTGCAAAGTGAGCTCTTCCTTAATGTAGCAACAAAGGATTTCCAGGAAGGGGAACTTAGAGGTCAAATAACCCCTCTGCTATACAGCGGCCTTTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCCATCAGGACAGGCTCAGCAGGTCACGCATGGGTTTCACTGGATGAGCACTGCCATCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGATGCTGCACTGAATGCTCATCTCCATGGTTTTGCTGAGCTTGGTGAAGTCGGTGAGAGTACCCCTGGGCACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCCCAGGGTAGTGTAAAAGACCTTGATCTTGAACTTTTGGGACATCTGAGCCGGGGCACAGC
  5   1   2       bld Gas7      in                         XZG23149.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGGGATCTGCAAGCATCACACTGCATGAAAATGGAACCATGGAATATCAGATTCAAATTGCTGGTACCACAAGTGCTGTGACAGCAGTGACACTGGAGACAAAACCTCGCAGAAAAACAAAGAGAAATATACTGCATGATATGACCAAGGACTACCAAGATGGAAGGGTCTGGGGATACTGGATAGATGCTAATGCACGAGACCTACATATGCTGTTGCAAAGTGAGCTCTTCCTTAATGTAGCAACAAAGGATTTCCAGGAAGGGGAACTTAGAGGTCAAATAACCCCTCTGCTATACAGCGGCCTTTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCCATCAGGACAGGCTCAGCAGGTCACGCATGGGTTTCACTGGATGAGCACTGCCATCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGATGCTGCACTGAATGCTCATCTCCATGGTTTTGCTGAGCTTGGTGAAGTCGGTGAGAGTACCCCTGGGCACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCCCAGGGTAGTGTAAAAGACCTTGATCTTGAACTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCCAGTGAGCACCAAACTGAACCCCTCGTGGTGAAATTCCGAGGACAAGTGCACATACCCTAACACTGTGAATCTGGAGGAGTCTCTCT
  5   1   2       bld Gas7      in                         XZG18851.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAAGCATCACACTGCATGAAAATGGAACCATGGAATATCAGATTCAAATTGCTGGTACCACAAGTGCTGTGACAGCAGTGACACTGGAGACAAAACCTCGCAGAAAAACAAAGAGAAATATACTGCATGATATGACCAAGGACTACCAAGATGGAAGGGTCTGGGGATACTGGATAGATGCTAATGCACGAGACCTACATATGCTGTTGCAAAGTGAGCTCTTCCTTAATGTAGCAACAAAGGATTTCCAGGAAGGGGAACTTAGAGGTCAAATAACCCCTCTGCTATACAGCGGCCTTTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCCATCAGGACAGGCTCAGCAGGTCACGCATGGGTTTCACTGGATGAGCACTGCCATCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGATGCTGCACTGAATGCTCATCTCCATGGTTTTGCTGAGCTTGGTGAAGTCGGTGAGAGTACCCCTGGGCACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCCCAGGGTAGTGTAAAAGACCTTGATCTTGAACTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAACCCTCGTGGTGAAATTCGAGGACAAGTGCACATACCTAACAACCTGTGAATCTGGAGGAGTCTCTCTAACTCCGGAGGAG
  5   1   2       bld Te5       in                         CAAO8546.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTACCACAAGTGCTGTGACAGCAGTGACACTGGAGACAAAACCTCGCAGAAAAACAAAGAGAAATATACTGCATGATATGACCAAGGACTACCAAGATGGAAGGGTCTGGGGATACTGGATAGATGCTAATGCACGAGACCTACATATGCTGTTGCAAAGTGAGCTCTTCCTTAATGTAGCAACAAAGGATTTCCAGGAAGGGGAACTTAGAGGTCAAATAACCCCTCTGCTATACAGCGGCCTTTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCCATCAGGACAGGCTCAGCAGGTCACGCATGGGTTTCACTGGATGAGCACTGCCATCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGATGCTGCACTGAATGCTCATCTCCATGGTTTTGCTGAGCTTGGTGAAGTCGGTGAGAGTACCCCTGGGCACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCCCAGGGTAGTGTAAAAGACCTTGATCTTGAACTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAACCCTCGTGGTGAAATTCGAGGACAAGTGCACATACCTAACAACTGTGAATCTGGAGGAGTCTCTCTAACTCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGAGACCCAGAAGATCTTCGGAAAGATCCTAGAGCATGCTTTTTTGAAGGTCAACTGAGAGCCCATGGTTCACGATGGGCTCCAGATTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGTC
  3   1   2       bld Gas       ?                    TGas122k05.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAAGAGAAATATACTGCATGATATGACCAAGGACTACCAAGATGGAAGGGTCTGGGGATACTGGATAGATGCTAATGCACGAGACCTACATATGCTGTTGCAAAGTGAGCTCTTCCTTAATGTAGCAACAAAGGATTTCCAGGAAGGGGAACTTAGAGGTCAAATAACCCCTCTGCTATACAGCGGCCTTTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCCATCAGGACAGGCTCAGCAGGTCACGCATGGGTTTCACTGGATGAGCACTGCCATCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGATGCTGCACTGAATGCTCATCTCCATGGTTTTGCTGAGCTTGGTGAAGTCGGTGAGAGTACCCCTGGGCACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCCCAGGGTAGTGTAAAAGACCTTGATCTTGAACTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAACCCTCGTGGTGAAATTCGAGGACAAGTGCACATACCTAACAACTGTGAATCTGGAGGAGTCTCTCTAACTCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGAGACCCAGAAGATCTTAGGAAAGATCCTAGAGCATGCTTTTTTGAAGGTCAACTAAGAGCCCATGGTTCACGATGGGCTCCAGATTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGTCAGATCAGTGTTGTCCTGT
  3   1   2       bld Te5       in                         CAAO8546.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCATGATATGACCAGGGACTACCAGATGGGAAGGGTCTGGGGATACTGGATAGATGCTAATGCACGAGACCTACATATGCTGTTGCAAAGTGAGCTCTTCCTTAATGTAGCAACAAAGGATTTCCAGGAAGGGGAACTTAGAGGTCAAATAACCCCTCTGCTATACAGCGGCCTTTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCCATCAGGACAGGCTCAGCAGGTCACGCATGGGTTTCACTGGATGAGCACTGCCATCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGATGCTGCACTGAATGCTCATCTCCATGGTTTTGCTGAGCTTGGTGAAGTCGGTGAGAGTACCCCTGGGCACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCCCAGGGTAGTGTAAAAGACCTTGATCTTGAACTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAACCCTCGTGGTGAAATTCGAGGACAAGTGCACATACCTAACAACTGTGAATCTGGAGGAGTCTCTCTAACTCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGAGACCCAGAAGATCTTCGGAAAGATCCTAGAGCATGCTTTTTTGAAGGTCAACTGAGAGCCCATGGTTCACGATGGGCTCCAGATTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGTCAGATCAGTGTTGTCCTGTGTGCGAAG
  5   1   2       bld Gas                            TGas083f21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGATGGAAGGGTCTGGGGATACTGGATAGATGCTAATGCACGAGACCTACATATGCTGTTGCAAAGTGAGCTCTTCCTTAATGTAGCAACAAAGGATTTCCAGGAAGGGGAACTTAGAGGTCAAATAACCCCTCTGCTATACAGCGGCCTTTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCCATCAGGACAGGCTCAGCAGGTCACGCATGGGTTTCACTGGATGAGCACTGCCATCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGATGCTGCACTGAATGCTCATCTCCATGGTTTTGCTGAGCTTGGTGAAGTCGGTGAGAGTACCCCTGGGCACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCCCAGGGTAGTGTAAAAGACCTTGATCTTGAACTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAACCCTCGTGGTGAAATTCGAGGACAAGTGCACATACCTAACAACTGTGAATCTGGAGGAGTCTCTCTAACTCCCGAGGAGCCTGAGTATGATATGGAATTATATGAGGAGGGAAGGCAGCGAGACCCAGAAGATCTTAGGAAAGATCCTAGAGCATGCTT
  3   1   2       bld Gas7      in                         XZG18851.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGGGATACTGGATAGATGCTAATGCACGAGACCTACATATGCTGTTGCAAAGTGAGCTCTTCCTTAATGTAGCAACAAAGGATTTCCAGGAAGGGGAACTTAGAGGTCAAATAACCCCTCTGCTATACAGCGGCCTTTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCCATCAGGACAGGCTCAGCAGGTCACGCATGGGTTTCACTGGATGAGCACTGCCATCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGATGCTGCACTGAATGCTCATCTCCATGGTTTTGCTGAGCTTGGTGAAGTCGGTGAGAGTACCCCTGGGCACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCCCAGGGTAGTGTAAAAGACCTTGATCTTGAACTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAACCCTCGTGGTGAAATTCGAGGACAAGTGCACATACCTAACAACTGTGAATCTGGAGGAGTCTCTCTAACTCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGAGACCCAGAAGATCTTCGGAAAGATCCTAGAGCATGCTTTTTTGAAGGTCAACTAAGAGCCCATGGTTCACGATGGGCTCCAGATTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGTCAGATCAGTGTTGTCCTGTGTGCG
  3   1   2       bld Gas       in                    TGas105c02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGATACTGGATAGATGCTAATGCACGAGACCTACATATGCTGTTGCAAAGTGAGCTCTTCCTTAATGTAGCAACAAAGGATTTCCAGGAAGGGGAACTTAGAGGTCAAATAACCCCTCTGCTATACAGCGGCCTTTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCCATCAGGACAGGCTCAGCAGGTCACGCATGGGTTTCACTGGATGAGCACTGCCATCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGATGCTGCACTGAATGCTCATCTCCATGGTTTTGCTGAGCTTGGTGAAGTCGGTGAGAGTACCCCTGGGCACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCCCAGGGTAGTGTAAAAGACCTTGATCTTGAACTTTTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTGAACCCTCGTGGTGAAATTCGAGGACAAGTGCACATACCTAACAACTGTGAATCTGGAGGAGTCTCTCTAACTCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGAGACCCAGAAGATCTTCGGAAAGATCCTAGAGCATGCTTTTTTGAAGGTCAACTAAGAGCCCATGGTTCACGATGGGCTCCAGATTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTATCCATTTGTCAGATCAGTGTTGTCCTGTGGGAAGAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu080l20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGATACTGGATAGATGCTAATGCACGAGACCTACATATGCTGTTGCAAAGTGAGCTCTTCCTTAATGTAGCAACAAAGGATTTCCAGGAAGGGGAACTTAGAGGTCAAATAACCCCTCTGCTATACAGCGGCCTTTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCCATCAGGACAGGCTCAGCAGGTCACGCATGGGTTTCACTGGATGAGCACTGCCATCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGATGCTGCACTGAATGCTCATCTCCATGGTTTTGCTGAGCTTGGTGAAGTCGGTGAGAGTACCCCTGGGCACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCCCAGGGTAGTGTAAAAGACCTTGATCTTGAACTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAACCCTCGTGGTGAAATTCGAGGACAAGTGCACATACCTAACAACTGTGAATCTGGAGGAGTCTCTCTAACTCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGAGACCCAGAAGATCTTAGGAAAGATCCTAGAGCATGCTTTTTTGAAGGTCAACTAAGAGCCCATGGTTCACGATGGGCTCCAGATTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGTCAGATCAGTGTTGTCCGTGGGAGAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas102f08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGAAGGGGAACTTAGAGGTCAAATAACCCCTCTGCTATACAGCGGCCTTTGGGCCAGATATGAGCAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCCATCAGGACAGGCTCAGCAGGTCACGCATGGGTTTCACTGGATGAGCACTGCCATCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGATGCTGCACTGAATGCTCATCTCCATGGTTTTGCTGAGCTTGGTGAAGTCGGTGAGAGTACCCCTGGGCACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCCCAGGGTAGTGTAAAAGACCTTGATCTTGAACTTTTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTGAACCCTCGTGGTGAAATTCGAGGACAAGTGCACATACCTAACAACTGTGAATCTGGAGGAGTCTCTCTAACTCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGAGACCCAGAAGATCTTCGGAAAGATCCTAGAGCATGCTTTTTTGAAGGTCAACTAAGAGCCCATGGTTCACGATGGGCTCCAGATTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGTCAGATCAGGTTGTCCTGTGGGAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG30024.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTATATAATATATGTAGTGGTGGTCGTTTGCAGTTTTACCTGATATCCCTGTTTCTTTACAGAGCTCCCAGTTCCTCTAGCTGGTCAGTTTGTGTCACCACCCATCAGGACAGGCTCAGCAGGTCACGCATGGGTTTCACTGGATGAGCACTGCCATCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGATGCTGCACTGAATGCTCATCTCCATGGTTTTGCTGAGCTTGGTGAAGTCGGTGAGAGTACCCCTGGGCACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCCCAGGGTAGTGTAAAAGACCTTGATCTTGAACTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAACCCTCGTGGTGAAATTCGAGGACAAGTGCACATACCTAACAACTGTGAATCTGGAGGAGTCTCTCTAACTCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGAGACCCAGAAGATCTTCGGAAAGATCCTAGAGCATGCTTTTTTGAAGGTCAACTAAGAGCCCATGGTTCACGATGGGCTCCAGATTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGTCAGATCAGTGTTGTCCTGTGTGCG
  5  -1   2       bld Gas       in                   TGas062k18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCAGGACAGGCTCAGCAGGTCACGCATGGGTTTCACTGGATGAGCACTGCCATCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGATGCTGCACTGAATGCTCATCTCCATGGTTTTGCTGAGCTTGGTGAAGTCGGTGAGAGTACCCCTGGGCACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCCCAGGGTAGTGTAAAAGACCTTGATCTTGAACTTTTGGGACATCTGAGCCGGGGCACAGCATTTATTCAAGTGAGCACCAAACTGAACCCTCGTGGTGAAATTCGAGGACAAGTGCACATACCTAACAACTGTGAATCTGGAGGAGTCTCTCTAACTCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGAGACCCAGAAGATCTTCGGAAAGATCCTAGAGCATGCTTTTTTGAAGGTCAACTAAGAGCCCATGGTTCACGATGGGCTCCAGATTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGTCAGATCAGTGTTGTCCTGTGTGCGAAAAAAAAAAAAAAA
  5   1   2       bld Gas7      in                          XZG4863.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGCTCAGCAGGTCACGCATGGGTTTCACTGGATGAGCACTGCCATCTGCATTATCAGATTGTGGTGACTGGTCTGGGTAAGGCAGAGGATGCTGCACTGAATGCTCATCTCCATGGTTTTGCTGAGCTTGGTGAAGTCGGTGAGAGTACCCCTGGGCACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCCCAGGGTAGTGTAAAAGACCTTGATCTTGAACTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAACCCTCGTGGTGAAATTCGAGGACAAGTGCACATACCTAACAACTGTGAATCTGGAGGAGTCTCTCTAACTCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGAGACCCAGAAGATCTTAGGAAAGATCCTAGAGCATGCTTTTTTGAAGGTCAACTAAGAGCCCATGGTTCACGATGGGCTCCAGATTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGTCAGATCAGTGTTGTCCTGTGTGCGAAGAANAAAAAGAAATTAGAGAGGTAAAAAAAACCGAGAGAGCTCGCACAGCANATGAAGGCTGCTTCTTTGATGGAGATCGCTCAT
  5  -1   2       bld Neu                            TNeu005f12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCCATAGAAGCCCTTTAACAACCTCTTGTGCCCAGGGGTACTCTCACCGACTTCACCAAGCTCAGCAAAACCATGGAGATGAGCATTCAGTGCAGCATCCTCTGCCTTACCCAGACCAGTCACCACAATCTGATAATGCAGATGGCAGTGCTCATCCAGTGAAACCCATGCGTGACCTGATGAGCCTGTCATGATGGGTGGTGACACAAACTGACCAGTTAAAGGAAATGGGAGGTGCTCATATCTAACAACTGTGAATCTGGAGGAGTCTCTCTAACTCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGAGACCCAGAAGATCTTAGGAAAGATCCTAGAGCATGCTTTTTTGAAGGTCAACTAAGAGCCCATGGTTCACGATGGGCTCCAGATTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGTCAGATCAGTGTTGTCCTGTGTGCGAAGAAAAAAAAAAAAAAAAAAGCGGCCGCGTCGA
  3   1   2       bld Gas0                                 dad25h10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACTGAATGCTCATCTCCATGGTTTTGCTGAGCTTGGTGAAGTCGGTGAGAGTACCCCTGGGCACAAGAGGTTGTTAAAGGGCTTCTATGGGTCAGAGGCCCAGGGTAGTGTAAAAGACCTTGATCTTGAACTTTTGGGACATCTGAGCCGGGGCACAGCATTTATCCAAGTGAGCACCAAACTGAACCCTCGTGGTGAAATTCGAGGACAAGTGCACATACCTAACAACTGTGAATCTGGAGGAGTCTCTCTAACTCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGAGACCCAGAAGATCTTCGGAAAGATCCTAGAGCATGCTTTTTTGAAGGTCAACTGAGAGCCCATGGTTCACGATGGGCTCCAGATTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGTCAGATCAGTGATGTCCTGTGTGCGAAG
  3   1   2       bld Gas7                                 XZG57027.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGCTCATCTCCATGGTTTTTCTGAACTTGGGGAAGTCGGTGAGAGTACCCCTGGGCCCAAGAGGTTGTTAAAGGGGTTTTATGGGTCAGAGGCCCAGGGTAGTGTAAAAGACCTTGATTTTGAACTTTTGGGACATTTGAGCCGGGGGTCAGCATTTTTCCAAGTGAGCCCCAAACTGAACCCTTGGGGGGAAATTTGGGGACAAGGGCACATACCTAACAACTGGGAATTTGGGGGAGTTTTTTTAACTCCCGAGGGGCCTGGGTATGAATATGAATTTTTTGGGGGGGGAAGGCAGGGGGACCCAGAAGATTTTTGGAAAGATCCTAGAGCATGCTTTTTTGAAGGTCAAATGAGAGCCCATGGTTCCCGATGGGCTCCCGATTATGACAGGAAATGCTTTGTGGGCAGCTGTCAGAAAAGTACCGTGATCTGGGATCCTATTGGGGGCCCCCCTTTGAAATGCTCCCAGCCTGTCCATTTGT
  5  -1   2       chi Neu                            TNeu029d07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCACAATCTGATAATGCAGATGGCAGTGCTCATCCAGTGAAACCCATGCGTGACCTGCTGAGCCTGTCCAGATGGGTGGTGACACAACCTGACCAGCTAAAGGAACTGGGAGCTGCTCATATCTAACAACTGTGAATCTGGAGGAGTCTCTCTAACTCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGAGACCCAGAAGATCTTAGGAAAGATCCTAGAGCATGCTTTTTTGAAGGTCAACTAAGAGCCCATGGTTCACGATGGGCTCCAGATTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGTCAGATCAGTGTTGTCCTGTGTGCGAAGAAAAAA
  5   1   2       bld Gas7                                 XZG22796.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAGTGCACATACCTAACAACTGTGAATCTGGAGGAGTCTCTCTAACTCCCGAGGAGCCTGAGTATGAATATGAATTATATGAGGAGGGAAGGCAGCGAGACCCAGAAGATCTTAGGAAAGATCCTAGAGCATGCTTTTTTGAAGGTCAACTAAGAGCCCATGGTTCACGATGGGCTCCAGATTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGTCAGATCAGTGTTGTCCTGTGTGCGAAGAAAAAAAAGAAATTAGAGAGGTAAAAAAAACCGAGAGAGCTCGCACAGCAAATGAAGGCTGCTTCTTTGATGGAGATCGCTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCTATTTGCACCTGCAAGGGTTCCACTGGAGAAGTGCATTGTGAGAAGGTGACCTGTCCACGACTTTCCTGTACCAACCCAATTCGTGCTAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGAAGTCCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGACCGCGATCATGCAAATTTGGGCGTCACTGGTACCCTAATAATGAGCGCTGGCATCCAACTGTGACACCCTTTGGAGAGATGAAGTGTGTTACATGTGCTTGTGTGGAGGGAGTACACAGTGTCGGAGACAGGAGTGTACAGGAAATACA
  5   1   2       bld Neu                            TNeu010a18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTTTTTGAAGGTCAACTAAGAGCCCATGGTTCACGATGGGCTCCAGATTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGTCAGATCAGTGTTGTCCTGTGTGCGAAGAAAAAAAAGAAATTAGAGAGGTAAAAAAAACCGAGAGAGCTCGCACAGCAAATGAAGGCTGCTTCTTTGATGGAGATCGCTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCTATTTGCACCTGCAAGGGTTCCACTGGAGAAGTGCATTGTGAGAAGGTGACCTGTCCACGACTTTCCTGTACCAACCCAATTCGTGCTAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGAAGTCCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGACCGCGATCATGCAAATTTGGGCGTCACTGGTACCCTAATAATGAGCGCTGGCATCCAACTGTGACACCCTTTGGAGAGATGAAGTGTGTTACATGTGCTTGTGTGGAGGGAGTTACACAGTGTCGGAGACAGGAGTGTACAGGAAATACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGC
  5   1   2       bld Neu                            TNeu068a10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTTTTTGAAGGTAACTAAGAGCCCATGGTTCACGATGGGCTCCAGATTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGTCAGATCAGTGTTGTCCTGTGTGCGAAGAAAAAAAAGAAATTAGAGAGGTAAAAAAAACCGAGAGAGCTCGCACAGCAAATGAAGGCTGCTTCTTTGATGGAGATCGCTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCTATTTGCACCTGCAAGGGTTCCACTGGAGAAGTGCATTGTGAGAAGGTGACCTGTCCACGACTTTCCTGTACCAACCCAATTCGTGCTAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGAAGTCCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGACCGCGATCATGCAAATTTGGGCGTCACTGGTACCCTAATAATGAGCGCTGGCATCCAACTGTGACACCCTTTGG
  5   1   2       bld Gas7      in                         XZG26384.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGATTATGACAGGAAATGCTCTGTGTGCAGCTGTCAGAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGTCAGATCAGTGTTGTCCTGTGTGCGAAGAAAAAAAAGAAATTAGAGAGGTAAAAAAAAACCGAGAGAGCTCGCACAGCAAATGAAGGCTGCTTCTTTGATGGAGATCGCTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCTATTTGCACCTGCAAGGGTTCCACTGGAGAAGTGCATTGTGAGAAGGTGACCTGTCCACGACTTTCCTGTACCAACCCAATTCGTGCTAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGAAGTCCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGACCGCGATCATGCAAATTTGGGCGTCACTGGTACCCTAATAATGAGCGCTGGCATCCAACTGTGACACCCTTTGGAGAGATGAAGTGTGTTACATGTGCTTGTGTGGAGGGAGTTACACAGTGTCGGAGACAGGAGTGTACAGGAGATACATGTGGGACTGG
  5   1   2       bld Gas                            TGas016n16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAACGTACCGTGATCTGTGATCCTATTGTGTGCCCACCTCTGAACTGCTCCCAGCCTGTCCATTTGTCAGATCAGTGTTGTCCTGTGTGCGAAGAAAAAAAAGAAATTAGAGAGGTAAAAAAAAACCGAGAGAGCTCGCACAGCAAATGAAGGCTGCTTCTTTGATGGAGATCGCTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCTATTTGCACCTGCAAGGGTTCCACTGGAGAAGTGCATTGTGAGAAGGTGACCTGTCCACGACTTTCCTGTACCAACCCAATTCGTGCTAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGAAGTCCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGACCGCGATCATGCAAATTTGGGCGTCACTGGTACCCTAATAATGAGCGCTGGCATCCAACTGTGACACCCTTTGGAGAGATGAAGTGTGTTACATGTGCTTGTGTGGAGGGAGTTACACAGTGTCGGAGACAGGAGTGTACAGGAAATACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAAGCAAGATGAAGATGAAAAGGTGAAAT
  5   1   2       bld Neu       in                   TNeu120p03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTGCGAGGAAAAAAGAGACCTTTAAGAGGTCAAAAGGACCGATGAGAGCTCTCTCCGTATATGAAGGCTGCTTGTTTGATGGAGATCGCTCATGGAAGGCGGCTGGTCCACGTTGCCATCCTTTTGTTCCTACATTTGGTCTAATTAAATGTGCTATTTTCACCTGTAAGGGTTCCACTGGAGAAGTGCATTGTGAGAAGGTGACCTGTCCACGACTTTCCT
  5   1   2       bld Neu       in                   TNeu120o03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTGCGAAGAAAAAAAAGAAATTAGAGAGGTAAAAAAAACCGAGAGAGCTCGCACAGCAAATGAAGGCTGCTTCTTTGATGGAGATCGCTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCTATTTGCACCTGCAAGGGTTCCACTGGAGAAGTGCATTGTGAGAAGGTGACCTGTCCACGACTTTCCTGTACCAACCCAATTCGTGCTAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGAAGTCCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGACCGCGATCATGCAAATTTGGGCGTCACTGGTACCCTAATAATGAGCGCTGGCATCCAACTGTGACACCCTTTGGAGAGATGAAGTGTGTTACATGTGCTTGTGTGGAGGGAGTTACACAGTGTCGGAGACAGGAGTGTACAGGAAATACATGT
  5   1   2       bld Neu                            TNeu143o11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTGCGAAGAAAAAAAAGAAATTAGAGAGGTAAAAAAAACCGAGAGAGCTCGCACAGCAAATGAAGGCTGCTTCTTTGATGGAGATCGCTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCTATTTGCACCTGCAAGGGTTCCACTGGAGAATTGCATTGTGAGAAGGTGACCTGTCCACGACTTTCCTGTACCAACCCAATTCGTGCTAATCCATCTGATTGCTGCAAACAGTGCCCATTAGATGAGCGAATTCCTTTGGAGCTGGCAGACAGTATGCATTCAGATGGACCGCGATCATGCAAATTTGGGCGTCACTGGTACCCTAATAATGAGCGCTGGCATCCAACTGTGACACCCTTTGGAGAGATGAAGTGTGTTACATGTGCTTGTGTGGAGGGAGTTACACAGTGTCGGAGACAGGAGTGTGCAGGAAATACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAAGCAAGATGAAGATGAAA
  5   1   2       bld Gas7      in                         XZG57999.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGCAAATGAAGGCTGCTTCTTTGATGGAGATCGCTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCTATTTGCACCTGCAAGGGTTCCACTGGAGAAGTGCATTGTGAGAAGGTGACCTGTCCACGACTTTCCTGTACCAACCCAATTCGTGCTAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGAAGTCCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGACCGCGATCATGCAAATTTGGGCGTCACTGGTACCCTAATAATGAGCGCTGGCATCCAACTGTGACACCCTTTGGAGAGATGAAGTGTGTTACATGTGCTTGTGTGGAGGGAGTTACACAGTGTCGGAGACAGGAGTGTACAGGAAATACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAAGCAAGATGAAGATGAAAAGGTGAAATCAGAGGAGACAAGGACTCCGTGGAGTTTCTAGAACGGAGTGCAACTGGGGCAATGGGACTGATTATCAAGGCTCATACAGGCAAGCCCCCAAGCCAAAACAACTGCCAGGACTCATGGATGGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTACTGGATTATCTCCTTTTGTTTCATTTGCTGTCATGAAGCAGTGGGATTCTAGAGGCAGCATTTGGAACTAANATACCTTGCCACCTTGGATTCATCCTTTCAAACACCCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTAGAGTTATGCCACAGGAGCA
  5   1   2       bld Tad5      in                         XZT40591.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCTTCTTTGATGGAGATCGCTCATGGAAGGCGGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCTATTTGCACCTGCAAGGGTTCCACTGGAGAAGTGCATTGTGAGAAGGTGACCTGTCCACGACTTTCCTGTACCAACCCAATTCGTGCTAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGAAGTCCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGACCGCGATCATGCAAATTTGGGCGTCACTGGTACCCTAATAATGAGCGCTGGCATCCAACTGTGACACCCTTTGGAGAGATGAAGTGTGTTACATGTGCTTGTGTGGAGGGAGTTACACAGTGTCGGAGACAGGAGTGTACAGGAAATACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAAGCAAGATGAAGATGAAAAGGTGAAATCAGAGGAGACAAGGACTCCGTGGAGTTTCTAGAACGGAGTGCAACTGGGGCAATGGGACTGATTATCAAGGCTCATACAGGCAAGCCCCCAAGCCAAAACAACTGCCAGGACTCATGGATGGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTACTGGATTATCTCCTTTTGTTTCATTTGCTGCCATGAAGCAGTGGGATTCTAGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCTTTCAAACACCCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGT
  5   1   2       bld Gas7      in                         XZG56688.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCTGGTACACGTTGGCATCCTTTTGTTCCTCCATTTGGTCTAATTAAATGTGCTATTTGCACCTGCAAGGGTTCCACTGGAGAAGTGCATTGTGAGAAGGTGACCTGTCCACGACTTTCCTGTACCAACCCAATTCGTGCTAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGAAGTCCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGACCGCGATCATGCAAATTTGGGCGTCACTGGTACCCTAATAATGAGCGCTGGCATCCAACTGTGACACCCTTTGGAGAGATGAAGTGTGTTACATGTGCTTGTGTGGAGGGAGTTACACAGTGTCGGAGACAGGAGTGTACAGGAAATACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAAGCAAGATGAAGATGAAAAGGTGAAATCAGAGGAGACAAGGACTCCGTGGAGTTTCTAGAACGGAGTGCAACTGGGGCAATGGGACTGATTATCAAGGCTCATACAGGCAAGCCCCCAAGCCAAAACAACTGCCAGGACTCATGGATGGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTACTGGATTATCTCCTTTTGTTTCATTTGCTGCCATGAAGCAGTGGGATTCTAGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCTTTCAAACACCCAGTCTGTCTTTCTT
  5   1   2       bld Gas7      in                         XZG36870.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGTCCACGACTTTCCTGTACCAACCCAATTCGTGCTAATCCATCTGATTGCTGCAAACAGTGCCCAGTAGAGGAGCGAAGTCCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGACCGCGATCATGCAAATTTGGGCGTCACTGGTACCCTAATAATGAGCGCTGGCATCCAACTGTGACACCCTTTGGAGAGATGAAGTGTGTTACATGTGCTTGTGTGGAGGGAGTTACACAGTGTCGGAGACAGGAGTGTACAGGAAATACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAAGCAAGATGAAGATGAAAAGGTGAAATCAGAGGAGACAAGGACTCCGTGGAGTTTCTAGAACGGAGTGCAACTGGGGCAATGGGACTGATTATCAAGGCTCATACAGGCAAGCCCCCAAGCCAAAACAACTGCCAGGACTCATGGATGGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTACTGGATTATCTCCTTTTGTTTCATTTGCTGCCATGAAGC
  5   1   2       bld Gas7      in                         XZG40874.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCGAAGTCCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGACCGCGATCATGCAAATTTGGGCGTCACTGGTACCCTAATAATGAGCGCTGGCATCCAACTGTGACACCCTTTGGAGAGATGAAGTGTGTTACATGTGCTTGTGTGGAGGGAGTTACGCAGTGTCGGAGACAGGAGTGTACAGGAAATACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAAGCAAGATGAAGATGAAAAGGTGAAATCAGAGGAGACAAGGACTCCGTGGAGTTTCTAGAACGGAGTGCAACTGGGGCAATGGGACTGATTATCAAGGCTCATACAGGCAAGCCCCCAAGCCAAAACAACTGCCAGGACTCATGGATGGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTACTGGATTATCTCCTTTTGTTTCATTTGCTGCCATGAAGCAGTGGGATTCTAGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCTTTCAAACACCCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTAGAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAANAGTGCCCTGTGGCTTTCTGCAGGACGGGAAGAAAAGTACCAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCC
  5   1   2       bld Gas                            TGas041c21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGTCCTTTGGAGCTGGCAGACAGTATGCAGTCAGATGGACCGCGATCATGCAAATTTGGGCGTCACTGGTACCCTAATAATGAGCGCTGGCATCCAACTGTGACACCCTTTGGAGAGATGAAGTGTGTTACATGTGCTTGTGTGGAGGGAGTTACGCAGTGTCGGAGACAGGAGTGTACAGGAAATACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAAGCAAGATGAAGATGAAAAGGTGAAATCAGAGGAGACAAGGACTCCGTGGAGTTTCTAGAACGGAGTGCAACTGGGGCAATGGGACTGATTATCAAGGCTCATACAGGCAAGCCCCCAAGCCAAAACAACTGCCAGGACTCATGGATGGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTACTGGATTATCTCCTTTTGTTTCATTTGCTGCCATGAAGCAGTGGGATTCTAGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCTTTCAAACACCCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTAGAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAAAAGTGCCCTGTGGC
  3   1   2       bld Gas7      in                         XZG57999.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACACCCTTTGGAGAGATGAAGTGTGTTACATGTGCTTGTGTGAGGGAGTTACACAGTGTCGGAGACAGGAGTGTACAGGAAATACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAAGCAAGATGAAGATGAAAAGGTGAAATCAGAGGAGACAAGGACTCCGTGGAGTTTCTAGAACGGAGTGCAACTGGGGCAATGGGACTGATTATCAAGGCTCATACAGGCAAGCCCCCAAGCCAAAACAACTGCCAGGACTCATGGATGGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTACTGGATTATCTCCTTTTGTTTCATTTGCTGTCATGAAGCAGTGGGATTCTAGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCTTTCAAACACCCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTAGAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAAAAGTGCCCTGTGGCTTTCTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAACTGAAGAAATTTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Neu       in                    TNeu120o03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTGGAGAGATGAAGTGTGTTACATGTGCTTGTGTGGAGGGAGTTACACAGTGTCGGAGACAGGAGTGTACAGGAAATACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAAGCAAGATGAAGATGAAAAGGTGAAATCAGAGGAGACAAGGACTCCGTGGAGTTTCTAGAACGGAGTGCAACTGGGGCAATGGGACTGATTATCAAGGCTCATACAGGCAAGCCCCCAAGCCAAAACAACTGCCAGGACTCATGGATGGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTACTGGATTATCTCCTTTTGTTTCATTTGCTGCCATGAAGCAGTGGGATTCTAGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCTTTCAAACACCCAGTCTGTCTTTTTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTAGAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAAAAGTGCCCTGTGGCTTTCTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAACTGAAGAAATTTTCCCAGTAAAAAAATAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7                                 XZG64332.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGTGTTACATGTGCTTGTGTGGAGGGAGTTACACAGTGTCGGAGACAGGAGTGTACAGGAAATACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAAGCAAGATGAAGATGAAAAGGTGAAATCAGAGGAGACAAGGACTCCGTGGAGTTTCTAGAACGGAGTGCAACTGGGGCAATGGGACTGATTATCAAGGCTCATACAGGCAAGCCCCCAAGCCAAAACAACTGCCAGGACTCATGGATGGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTACTGGATTATCTCCTTTTGTTTCATTTGCTGCCATGAAGCAGTGGGATTCTAGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCTTTCAAACACCCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTAGAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAAAAGTGCCCTGTGGCTTTCTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGNATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAACT
  3   1   2       bld Gas7 5g3  in                         XZG61427.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTTACGCAGTGTCGGAGACAGGAGTGTACAGGAAATACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAAGCAAGATGAAGATGAAAAGGTGAAATCAGAGGAGACAAGGACTCCGTGGAGTTTCTAGAACGGAGTGCAACTGGGGCAATGGGACTGATTATCAAGGCTCATACAGGCAAGCCCCCAAGCCAAAACAACTGCCAGGACTCATGGATGGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTACTGGATTATCTCCTTTTGTTTCATTTGCTGCCATGAAGCAGTGGGATTCTAGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCTTTCAAACACCCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTAGAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAAAAGTGCCCTGTGGCTTTCTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAACTGAAGAAATTTTCCCAGT
  3   1   2      seed Gas7 5g3  in                         XZG64003.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGACAGGAGTGTACAGGAAATACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAAGCAAGATGAAGATGAAAAGGTGAAATCAGAGGAGACAAGGACTCCGTGGAGTTTCTAGAACGGAGTGCAACTGGGGCAATGGGACTGATTATCAAGGCTCATACAGGCAAGCCCCCAAGCCAAAACAACTGCCAGGACTCATGGATGGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTACTGGATTATCTCCTTTTGTTTCATTTGCTGCCATGAAGCAGTGGGATTCTAGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCTTTCAAACACCCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTAGAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAAAAGTGCCCTGTGGCTTTCTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAACTGAAGAAATTTTCCCAGT
  3   1   2       bld Gas7      in                         XZG23149.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACAGGAGTGTACAGGAAATACATGTGGTACTGGTTCAAAGCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAAGCAAGATGAAGATGAAAAGGTGAAATCAGAGGAGACAAGGACTCCGTGGAGTTTCTAGAACGGAGTGCAACTGGGGCAATGGGACTGATTATCAAGGCTCATACAGGCAAGCCCCCAAGCCAAAACAACTGCCAGGACTCATGGATGGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTACTGGATTATCTCCTTTTGTTTCATTTGCTGCCATGAAGCAGTGGGATTCTAGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCTTTCAAACACCCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTAGAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAAAAGTGCCCTGTGGCTTTCTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAACTGAAGAAATTTTCCC
  5   1   2       bld Gas7                                 XZG44763.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCGGGACAGATGTTGCACCAAGTGCAAAGATGCCAAGCAAGATGAAGATGAAAAGGTGAAATCAGAGGAGACAAGGACTCCGTGGAGTTTCTAGAACGGAGTGCAACTGGGGCAATGGGACTGATTATCAAGGCTCATACAGGCAAGCCCCCAAGCCAAAACAACTGCCAGGACTCATGGATGGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTACTGGATTATCTCCTTTTGTTTCATTTGCTGCCATGAAGCAGTGGGATTCTAGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCTTTCAAACACCCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTAGAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAAAAGTGCCCTGTGGCTTTCTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAACTGA
  3   1   2       bld Gas7      in                          XZG7253.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGCAAAGATGCCAAGCAAGATGAAGATGAAAAGGTGAAATCAGAGGAGACAAGGACTCCGTGGAGTTTCTAGAACGGAGTGCAACTGGGGCAATGGGACTGATTATCAAGGCTCCTACAGGCAAGCCCCCAAGCCAAAACAACTGCCAGGACTCATGGATGGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTACTGGATTATCTCCTTTTGTTTCATTTGCTGCCATGAAGCAGTGGGATTCTAGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCTTTCAAACACCCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTAGAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAAAAGTGCCCTGTGGCTTTCTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAACTGA
  3   1   2       bld Tad5      in                         XZT40591.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAAGGACTCCGTGGAGTTTCTAGAACGGAGTGCAACTGGGGCAATGGGACTGATTATCAAGGCTCATACAGGCAAGCCCCCAAGCCAAAACAACTGCCAGGACTCATGGATGGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTACTGGATTATCTCCTTTTGTTTCATTTGCTGCCATGAAGCAGTGGGATTCTAGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCTTTCAAACACCCAGTCTGTCTTTTTGACAGAAGCAACTTTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTTTGATCTGTAGAGTTATGCAACAGGAGCACAGGCCCAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAAAAGTGCCCTGTGGCTTTTTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTTGAGGGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAACTGAAGAAATTTTCCCCGT
  3   1   2       bld Gas7      in                         XZG40874.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTTTCTAGAACGGAGTGCAACTGGGGCAATGGGACTGATTATCAAGGCTCATACAGGCAAGCCCCCAAGCCAAAACAACTGCCAGGACTCATGGATGGTCTGCACAATGTTTTGTCCCACTCTGATGACACTGCTACTGGATTATCTCCTTTTGTTTCATTTGCTGCCATGAAGCAGTGGGATTCTAGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCTTTCAAACACCCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTAGAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAAAAGTGCCCTGTGGCTTTCTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAACTGAAGAAATTTTCCCAGT
  3   1   2       bld Gas1      in                     NISC_mq14b08.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCACAATGTTTTGTCCCACTCTGATGACACTGCTACTGGATTATCTCCTTTTGTTTCATTTGCTGCCATGAAGCAGTGGGATTCTAGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCTTTCAAACACCCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTAGAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAAAAGTGCCCTGTGGCTTTCTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTCCAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAACTGAAGAAATTTTCCCAGTAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Gas0                                 dad27c10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATCTCCTTTTGTTTCATTTGCTGCCATGAAGCAGTGGGATTCTAGAGGCAGCATTTGGAACTAAAATACCTTGCCACCTTGGATTCATCCTTTCAAACACCCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTAGAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAAAAGTGCCCTGTGGCTTTCTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGCATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAACTGAAGAAATTTTTCCCAGTAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu120p03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATGAAGCAGTGGGATTTTAGAGGCAGCATTTGGAAGTAAAATACCTTGCCTCCTGGGATTTATCCTTTCAAACACCCAGTTTGTTTTTCTGACAGAAGCAATTTTAAATCTTGCTTAAACAGGTCCTGGAGTTTTAAGGTTTGATATGTAGAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGTTGTGCATATGTAGATATATTGGAAAAAAGTGCCCTGTGCCTTTGTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGCGCTTGCTGGAAAG
  3   1   2       bld Gas7      in                         XZG36870.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACCTTGCCACCTTGGATTCATCCTTTCAAACACCCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTAGAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAAAAGTGCCCTGTGGCTTTTTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAACTGG
  3   1   2       bld Gas7      in                          XZG4863.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATTCATCCTTTCAAACACCCAGTCTGTCTTTCTGACAGAAGCAACTCTAAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTAGAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAAAAGTGCCCTGTGGCTTTCTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTGGAGTGGGTGCGGTCCCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAAC
  3   1   2       bld Gas7      in                         XZG20660.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAATCCTGCCTAAACAGGACCTGGAGTTTTAACGTCTGATCTGTAGAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAAAAGTGCCCTGTGGCTTTCTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGTTGGTCATATTTATTGAACTAAAATAAACTGAAGAAATTTTCCCAGTAATTGTTTTTCTATATTTTATTGGACATGGATAGAGAAGAAGGAAGTGTATATAAGAGGGAACTGGTAGGGGGGATGTCCTGAGTAATGCAAAGTCGTTCATTAATGGGCACATTCTACATTAAATGGCCAATATCCTGTCTGTGTTTTTAATTCATAAATTAAGAGGGATGCTGCAAATTCAGGATTCAGTTTAGGATTTGACCAAATCCTTAAAATATTTGCAGTATTTGGAAAAATATTTACGGTTTGGATTTAGTTCAGTTGAATGTTTAAAGTCATGTGACTTTAAAGCTCTGAACAACTGAATAAAATTATTTTTTGTTCAC
  3   1   2       bld Gas7      in                         XZG56688.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTTTTAACGTCTGATCTGTAGAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAAAAGTGCCCTGTGGCTTTCTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAACTGAAGAAATTTTCCCAGTAATTGTTTTTCTATATTTTATTGGACATGGATAGAGAAGAAGGAAGTGTATATAAGAGGGAACTGGTAGGGGGGATGTCCTGAGTAATGCAAAGTCGTTCATTAATGGGCACATTCTACATTAAATGGCCAATATCCTGTCTGTGTTTTTAATTCATAAATTAAGAGGGATGCTGCAAATTCAGGATTCAGTTTAGGATTTGACCAAATCCTTAAAATATTTGCAGTATTTGGAAAAATATTTACGGTTTGGATTTAGTTCAGTTGAATGTTTAAAGTCGTGACTTTAAAGCTCTGAACAACTGAATAAAATTATTTTTTGTTCAC
  3   1   2       bld Gas7      in                         XZG26384.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTAACGTCTGATCTGTAGAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAAAAGTGCCCTGTGGCTTTCTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAACTGAAGAAATTTTCCCAGT
  3   1   2       bld Gas7      in                           XZG903.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGTTATGCAACAGGAGCACAGGCACAGCATAGGTAGCTGTGCATATGTAGATATATTGACTAAAAGTGCCCTGTGGCTTTCTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAACTGAAGAAATTTTCCCAGTAATTGTTTTTCTATATTTTATTGGACATGGATAGAGAAGAAGGAAGTGTATATAAGAGGGAACTGGTAGGGGGGATGTCCTGAGTAATGCAAAGTCGTTCATTAATGGGCACATTCTACATTAAATGGCCAATATCCTGTCTGTGTTTTTAATTCATAAATTAAGAGGGATGCTGCAAATTCAGGATTCAGTTTAGGATTTGACCAAATCCTTAAAATATTTGCAGTATTTGGAAAAATATTTACGGTTTGGATTTAGTTCAGTTGAATGTTTAAAGTACATGTGACTTTAAAGCTCTGAACAACGAATAAAATTATTTTTG
  3   1   2       bld Gas7      in                         XZG23790.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACGCGTCCGGTGGCTTTCTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAACTGAAGAAATTTTCCCAGTAATTGTTTTTCTATATTTTATTGGACATGGATAGAGAAGAAGGAAGTGTATATAAGAGGGAACTGGTAGGGGGGATGTCCTGAGTAATGCAAAGTCGTTCATTAATGGGCACATTCTACATTAAATGGCCAATATCCTGTCTGTGTTTTTAATTCATAAATTAAGAGGGATGCTGCAAATTCAGGATTCAGTTTAGGATTTGACCAAATCCTTAAAATATTTGCAGTATTTGGAAAAATATTTACGGTTTGGATTTAGTTCAGTTGAATGCTTAAAGTCATGTGACTTTAAAGCTCTGAACAACTGAATAAAATTATTTTTTGTTC
  5   1   2       bld Gas7      in                         XZG23790.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGGCTTTCTGCAGGACGGGAAGAAAAGTACAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAACTGAAGAAATTTTCCCAGTAATTGTTTTTCTATATTTTATTGGACATGGATAGAGAAGAAGGAAGTGTATATAAGAGGGAACTGGTAGGGGGGATGTCCTGAGTAATGCAAAGTCGTTCATTAATGGGCACATTCTACATTAAATGGCCAATATCCTGTCTGTGTTTTTAATTCATAAATTAAGAGGGATGCTGCAAATTCAGGATTCAGTTTAGGATTTGACCAAATCCTTAAAATATTTGCAGTATTTGGAAAAATATTTACGGTTTGGATTTAGTTCAGTTGAATGCTTAAAGTCATGTGACTTTAAAGCTCTGAACAACTGAATAAAATTATTTTTTGTTCAAAAAAAAAAAAAAAAAAAAAAGG
  5   1   2       bld Neu                            TNeu107c24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAGTCAAGTGACAGACAAAGATTACAGTGTGCTTGCTGGAAAGTCTGTATATATGTCTGCGTGTGTGAATGTGTGAACGCATGATGTTACTTTGAGGGTGTATGAACAGACATATATCATTTCCTATTGTCCAAGCACACTCTTTGAGGAACTTTGTCTTGTATTATTTATGGTATTTTGAGTGGGTGCGGTACCTGTACTAATTAACTATTAATGATGGTCATATTTATTGAACTAAAATAAACTGAAG
  3   1   2       bld Neu0 5g3  in                     NISC_ng20d11.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGTTACTTTGAGGGTGTATGACCAGACATATATCATTTCCTATTGTCCAAGCACACTCTTGGAGGACCTTGGTTTTGTATTATTCATGGTATTTTGAGGGGGTGCGGTCCCTTTCCTAATTACCTCTTAATGATGGTCATATTTATTGACTCTAAAATAAGCTGAAGAAATTTTCCCATTaaaaaaccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)