Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZG39507.3                            9 END     6          13       75                Hypothetical LOC496558 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012075141 Xt7.1-TGas086e11.3 - 46 ESTs
                                                                       -620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas086e11.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTCCCAGGTGGGGCTAAGGAAGAAGCCAATGGGAAAGCGCTGCCCCAGAACCAAGCAGCCTGGCACGTCCCTGCTGGGGAGAAGGGAGCACCCGGATTGGCAGAGGAGATATTGGCCCCCACCAGGGTAGCAAAGGCGGAGACTCCGGCGGAGCAGGAAGTGAGCTGTGAGCAGGGACAGGCGGGCCCCACTCCCCCGGCAGGACAGACAGACAAGCTGGGGGCGCAGGAGGAGGGGGAAGGGCAGACTGAGGAGGATCCTGGGAGTGAGAACAGGGAGGCGACAGAGGAAAATGAATTGGCCACAGACTCGGGGGATTCCCAGCACCTGGGATCTGGCGCAACTCCCTACCCGGATCGGAATGAGTCCCGGCCCTACGGCTCCACTACTCACAAGTGTAAGTACTGTGGCAAAGAATTCACCCATACGGGCAACTACACCCGGCACATCCGCACCCACACTGGGGAGAAGCCCTTCTCCTGCCGCGAGTGCAACAAGGCGTTCTCCGACCCGGCGGCCTGCCGAGCCCACGAGAAGACTCACAGCCCCCTGAAACCGTACGGCTGCGAGGACTGCGGGAAGAGCTACCGCCTCGTCAGCCTCCTCAATCTGCACAAGAAGCGCCACACGGGGGACGCCCGCTACCGCTGCACCGACTGCAACAAGCATTTCACCACCTCGGGCAACCTGAAGCGCCACCAACTGGTCCACAGCGGGGAGAAACCGTACCACTGCGAGTACTGCAACCGGCCCTTCTCCGACCCCACCTCCAAAATGCGCCACTTAGAGACGCACGACACTAACAAGGAGCACAAGTGCCCCCACTGCGACAAAAAGTTCAACCAACTGGGAAACCTGAAAGCCCACCTGAAGATTCACATAGCCGACGGCCCCCTGAAATGCAGAGAATGCGGGAAGCAGTTTACCACGTCAGGGAATCTGAAGAGACACCTGCGGATACACAGCGGGGAGAAGCCGTACGTGTGTGTGCACTGCAAGAGGAAGTTTGCGGATCCCGGAGCGCTGCAGCGCCACGTCCGGACTCACACCGGGGAGAAGCCGTGCCTGTGTATGATCTGCGGCAAAGCCTTCACCCAGGCCAGCTCCCTAATCGCCCACGTGCGCCAGCACACCGGGGAGAAGCCGTACGTCTGCGAGCGCTGCGGGAAGAGGTTTGTGCAGTCGAGCCAGCTGGCCAATCACATCCGCCATCACGACAACATTCGGCCGCACAAGTGCAGTGTGTGTAACAAAGCCTTCGTCAATGTGGGGGACCTGACCAAGCACGTCATCATCCACACCGGAGAGAAGCCCTTCCTGTGCGACAAGTGCGGCCGGGGCTTTAACCGAGTGGACAATCTCCGCTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAACATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACATGTGGGGGGGCCCTTATGCATCTAATAAACATTATTTTTTAATTAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008226110                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGTGGGGCTAAGGAAGAAGCCAATGGGAAAGCGCTGCCCCAGAACCAAGCAGCCTGGCACGTCCCTGCTGGGGAGAAGGGAGCACCCGGATTGGCAGAGGAGATATTGGCCCCCACCAGGGTAGCAAAGGCGGAGACTCCGGCGGAGCAGGAAGTGAGCTGTGAGCAGGGACAGGCGGGCCCCACTCCCCCGGCAGGACAGACAGACAAGCTGGGGGCGCAGGAGGAGGGGGAAGGGCAGACTGAGGAGGATCCTGGGAGTGAGAACAGGGAGGCGACAGAGGAAAATGAATTGGCCACAGACTCGGGGGATTCCCAGCACCTGGGATCTGGCGCAACTCCCTACCCGGATCGGAATGAGTCCCGGCCCTACGGCTCCACTACTCACAAGTGTAAGTACTGTGGCAAAGAATTCACCCATACGGGCAACTACACCCGGCACATCCGCACCCACACTGGGGAGAAGCCCTTCTCCTGCCGCGAGTGCAACAAGGCGTTCTCCGACCCGGCGGCCTGCCGAGCCCACGAGAAGACTCACAGCCCCCTGAAACCGTACGGCTGCGAGGACTGCGGGAAGAGCTACCGCCTCGTCAGCCTCCTCAATCTGCACAAGAAGCGCCACACGGGGGACGCCCGCTACCGCTGCACCGACTGCAACAAGCATTTCACCACCTCGGGCAACCTGAAGCGCCACCAACTGGTCCACAGCGGGGAGAAACCGTACCACTGCGAGTACTGCAACCGGCCCTTCTCCGACCCCACCTCCAAAATGCGCCACTTAGAGACGCACGACACTAACAAGGAGCACAAGTGCCCCCACTGCGACAAAAAGTTCAACCAACTGGGAAACCTGAAAGCCCACCTGAAGATTCACATAGCCGACGGCCCCCTGAAATGCAGAGAATGCGGGAAGCAGTTTACCACGTCAGGGAACCTGAAGAGACACCTGCGGATACACAGCGGGGAGAAGCCGTACGTGTGTGTGCACTGCAAGAGGAAGTTTGCGGATCCCGGAGCGCTGCAGCGCCACGTCCGGACTCACACCGGGGAGAAGCCGTGCCTGTGTATGATCTGCGGCAAAGCCTTCACCCAGGCCAGCTCCCTAATCGCCCACGTGCGCCAGCACACCGGGGAGAAGCCGTACGTCTGCGAGCGCTGCGGGAAGAGGTTTGTGCAGTCGAGCCAGCTGGCCAATCACATCCGCCATCACGACAACATTCGGCCGCACAAGTGCAGTGTGTGTAACAAAGCCTTCGTCAATGTGGGGGACCTGACCAAGCACGTCATCATCCACACCGGAGAGAAGCCCTTCCTGTGCGACAAGTGCGGCCGGGGCTTTAACCGAGTGGACAATCTCCGCTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAACATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACATGTGGGGGGGCCCTTATGCATCTAATAAACATTATTTTTTAATTAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  2     2     3     3     3     3     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     5     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     8     8     8     8    10    10    11    11    10    11    10    11    10    11     9    11    10    12    10    12    10    12     9    12     9    12    10    12     8     9     8     9     8     9     8     9     7     8     7     8     7     8     7     8     8     9     9    10     9     9     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8    10     8    11     8    11     8    11     8    11     8    11    10    12     9    12     9    12    10    13    10    13    10    13    10    13    11    14    13    16    15    17    13    17    15    17    18    19    19    20    16    21    16    21    16    20    15    20    16    21    18    21    22    24    24    26    24    26    24    26    24    26    24    26    24    26    24    26    23    26    24    26    25    27    25    27    23    28    28    28    27    27    28    28    28    28    28    29    30    30    30    30    30    30    30    30    30    30    27    30    28    28    27    28    27    28    23    28    28    28    28    28    27    28    27    28    26    28    25    28    27    28    28    28    28    28    26    28    27    27    26    27    27    28    25    28    26    28    25    28    22    27    25    27    24    26    24    26    24    26    23    26    20    23    20    23    16    23    10    12     9    12     7    12     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         T-----------
                                                                                                                                                                                               PREDICTED - Dr ---- 0          XP_693378.1 PREDICTED: similar to Zinc finger and BTB domain containing protein 17 (Zinc finger protein 151) (Myc-interacting zinc finger protein) (Miz-1 protein) [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                            PROTEIN --- Mm ---- 0          NP_033567.1 zinc finger protein 100 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                            PROTEIN --- Hs ---- 0          NP_003434.1 zinc finger protein 151 (pHZ-67) [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Xl ---- 0          AAH91717.1 Unknown (protein for MGC:85135) [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - ?? ---- 0          NP_001089997.1 hypothetical protein LOC735068 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                PREDICTED - Xt ---- 0          AAH84492.1 Hypothetical LOC496558 [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas086e11.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------TGA------------------------------------------------------------------------------------------------------ATG---------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   2       bld Thy1                                 CBST549.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCTGTGTGTATTGATTAACCCCTGAGATTACATGGAATGTTTCTGTTAAGACCTCCCAGGTGGGGCTAAGGAAGAAGCCAATGGGAAAGCGCTGCCCCATAACCAAGCAGCCTGGCACGTCCCTGCTGGGGAGAAGGGAGCACCCGGATTGGCAGAGGAGATATTGGCCCCCACCAGGGTAGCAAAGGCGGAGACTCCGGCGGAGCAGGAAGTGAGCTGTGAGCAGGGACAGGCGGGCCCCACTCCCCCGGCAGGACAGACAGACAAGCTGGGGGCGCAGGAGGAGGGGGAAGGGCAGACTGAGGAGGATCCTGGGAGTGAGAACAGGGAGGCGACAGAGGAAAATGAATTGGCCACAGACTCGGGGGATTCCCAGCACCTGGGATCTGGCGCAACTCCCTACCCGGATCGGAATGAGTCCCGGCCCTACGGCTCCACTACTCACAAGTGTAAGTACTGTGGCAAAGAATTCACCCATACGGGCAACTACACCCGGCACATCCGCACCCACACTGGGGAGAAGCCCTTCTCCTGCCGCGAGTGCAACAAGGCGTTCTCCGACCCGGCGGCCTGCCGAGCCCACGAGAAGACTCACAGCCCCCTGAAACCATACGGCTGCGAGGACTGCGGGAAGAGCTACCGCCTCGTCAGCCTCCTCAATCTGCACAAGAAGCGCCACACGGGGGACGCCCGCTACCGCTGCACCGACTGCAACAAGCATTTCACCACCTCGGGCAACCTGAAGCGCCACCAACTGGTCCACAGCGGGG
  5   1   2       bld Gas       in                   TGas086e11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTCCCTGCCGAGGAGCCGGGGCTCACAAACCAAGACCTCCCAGGTGGGGCTAAGGAAGAAGCCAATGGGAAAGCGCTGCCCCAGAACCAAGCAGCCTGGCACGTCCCTGCTGGGGAGAAGGGAGCACCCGGATTGGCAGAGGAGATATTGGCCCCCACCAGGGTAGCAAAGGCGGAGACTCCGGCGGAGCAGGAAGTGAGCTGTGAGCAGGGACAGGCGGGCCCCACTCCCCCGGCAGGACAGACAGACAAGCTGGGGGCGCAGGAGGAGGGG
  5   1   2       bld Tad5                                 XZT66273.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTCCAGGTGGGGCTAAGGAAGAAGCCAATGGGAAAGCGCTGCCCCAGAACCAAGCAGCCTGGCACGTCCCTGCTGGGGAGAAGGGAGCACCCGGATTGGCAGAGGAGATATTGGCCCCCACCAGGGTAGCAAAGGCGGAGACTCCGGCGGAGCAGGAAGTGAGCTGTGAGCAGGGACAGGCGGGCCCCACTCCCCCGGCAGGACAGACAGACAAGCTGGGGGCGCAGGAGGAGGGGGAAGGGCAGACTGAGGAGGATCCTGGGAGTGAGAACAGGGAGGCGACAGAGGAAAATGAATTGGCCACAGACTCGGGGGATTCCCAGCACCTGGGATCTGGCGCAACTCCCTACCCGGATCGGAATGAGTCCCGGCCCTACGGCTCCACTACTCACAAGTGTAAGTACTGTGGCAAAGAATTCACCCATACGGGCAACTACACCCGGCACATCCGCACCCACACTGGGGAGAAGCCCTTCTCCTGCCGCGAGTGCAACAAGGCGTTCTCCGACCCGGCGGCCTGCCGAGCCCACGAGAAGACTCACAGCCCCCTGAAACCGTACGGCTGCGAGGACTGCGGGAAGAGCTACCGCCCGTCAGCCTCCTCAATCTGCACAAGAAGCGCCACACGGGGGACGCCCGCTACCGCTGCACCGACTGCAACAAGCATTTCACCACCTCGGGCAACCTGAAGCGCCACCAACTGGTCCACAGCGGGGAGAAACCGTACCACTGCGAGTACTGCAACCGGCCCTTCTCTCGACCCACCTCCAAAATGCGCCACTTAGAGACGCACGACACTAACAAGGAGCACAAGTGCCCCCACTGCGAC
  5   1   2       bld Gas8      in                          st13f10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGCGCTGCCCCAGAACCAAGCAGCCTGGCACGTCCCTGCTGGNGAGAAGGGAGCACCCGGATTGGCAGAGGAGATATTGGCCCCCACCAGGGTANCAAAGGCGGAGACTCCGGCGGAGCANGAAGTGAGCTGTGAGCANGGACAGGCGGGCCCCACTCCCCCGGCAGGACAGACAGACNAGCTGGGGGCGCAGGAGGAGGGGGAAGGGCAGACTGANGAGGATCCTGGGAGTGAGAACAGGGAGGCGACAGAGGAAAATGAATTGGCCACAGACTCGGGGGATTCCCAGCACCTGGGATCTGGCGCAACTCCCTACCCGGATCGGAATGAGTCCCGGCCCTACGGCTCCACTACTCANAAGTGTAAGTACTGTGGCAAAGAATTCACCCATACNGGCAACTACACCCGGCACATCCGCACCCACACTGGGGAGAAGCCCTTCTCCTGCCGNGAGTGCAACAAGGCGTTCTCCGACCCGGCGGCCTGCCGAGCCCACNANAAGACTCACAGCCCCCTGAAACCGTACGGCTGCTAGGACTGCGGGAAGAGCTACCGCCTCGTCAGCCTCCTCAATCTGCACAAGAAGCGCCACACGGGGGACGCCCGCTACCGCTGCACCGACTGCAACAAGCATTTCACCACCTCGGGCANCCTGAAGCGCCACCAACTGGTCNA
  5   1   2       bld Te4                                 CAAN12283.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGCACGTCCCTGCTGGGGAGAAGGGAGCACCCGGATTGGCAGAGGAGATATTGGCCCCCACCAGGGTAGCAAAGGCGGAGACTCCGGCGGAGCAGGAAGTGAGCTGTGAGCAGGGACAGGCGGGCCCCACTCCCCCGGCAGGACAGACAGACAAGCTGGGGGCGCAGGAGGAGGGGGAAGGGCAGACTGAGGAGGATCCTGGGAGTGAGAACAGGGAGGCGACAGAGGAAAATGAATTGGCCACAGACTCGGGGGATTCCCAGCACCTGGGATCTGGCGCAACTCCCTACCCGGATCGGAATGAGTCCCGGCCCTACGGCTCCACTACTCACAAGTGTAAGTACTGTGGCAAAGAATTCACCCATACGGGCAACTACACCCGGCACATCCGCACCCACACTGGGGAGAAGCCCTTCTCCTGCCGCGAGTGCAACAAGGCGTTCTCCGACCCGGCGGCCTGCCGAGCCCACGAGAAGACTCACAGCCCCCTGAAACCGTACGGCTGCGAGGACTGCGGGAAGAGCTACCGCCTCGTCAGCCTCCTCAATCTGCACAAGAAGCGCCACACGGGGGACGCCCGCTACCGCTGCACCGACTGCAACAAGCATTTCACCACCTCGGGCAACCTGAAGCGCCACCAACTGGTCCACAGCGGGGAGAAACCGTACCACTGCGAGTACTGCAACCGGCCCTTCTCCGACCCCACCTCCAAAATGCGCCACTTAGAGACGCACGACACTAACAAGGAGCACAAGTGCCCCCACTGCGACAAAAAGTCAACCCACT
  5   1   2       bld Gas8      in                          st88n10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAAAGGCGGAGACTCCGGCGGAGCATGAAGTGAGCTGTGAGCAGGGACAGGCGGGCCCCACTCCCCCGGCAGGACAGACAGACNAGCTGGGGGCGCAGGAGGAGGGGGAAGGGCAGACTGANGAGGATCCTGGGAGTGAGAACAGGGAGGCGACAGAGGAAAATGAATTGGCCACAGACTCGGGGGATTCCCAGCACCTGGGATCTGGCGCAACTCCCTACCCGGATCGGAATGAGTCCCGGCCCTACGGCTCCACTACTCACAAGTGTAAGTACTGTGGCAAAGAATTCACCCATACGGGCAACTACACCCGGCACATCCNCACCCACACTGGGGAGAAGCCCTTCTCCTGCCGCGAGTGCAACAAGGCGTTCTCCGACCCGGCGGCCTGCCNAGCCCACGAGAAGACTCACAGCCCCCTGAAACCGTACGGCTGCGAGGACTGCGGGAAGAGCTACCGCCTCGTCAGCCTCCTCANTCTGCACAAGAANCGCCNCACGGGGGACGCCCGCTACCGCTGCACCGACTGCAACAAGCATTTCACCACCTCGGNNNACCTGAAGCGCCACCNACTGGTCCACAGCGGGGAGAAACCGTACCACTGCGAGTACTGCAACCGGCCCTTCTCC
  5   1   2       bld Te1                                 CBWN18030.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCACAAGTGTAAGTACTGTGGCAAAGAATTCACCCATACGGGCAACTACACCCGGCACATCCGCACCCACACTGGGGAGAAGCCCTTCTCCTGCCGCGAGTGCAACAAGGCGTTCTCCGACCCGGCGGCCTGCCGAGCCCACGAGAAGACTCACAGCCCCCTGAAACCGTACGGCTGCGAGGACTGCGGGAAGAGCTACCGCCTCGTCAGCCTCCTCAATCTGCACAAGAAGCGCCACACGGGGGACGCCCGCTACCGCTGCACCGACTGCAACAAGCATTTCACCACCTCGGGCAACCTGAAGCGCCACCAACTGGTCCACAGCGGGGAGAAACCGTACCACTGCGAGTACTGCAACCGGCCCTTCTCCGACCCCACCTCCAAAATGCGCCACTTAGAGACGCACGACACTAACAAGGAGCACAAGTGCCCCCACTGCGACAAAAAGTTCAACCAACTGGGAAACCTGAAAGCCCACCTGAAGATTCACATAGCCGACGGCCCCCTGAAATGCAGAGAATGCGGGAAGCAGTTTACCACGTCAGGGAATCTGAAGAGACACCTGCGGATACACAGCGGGGAGAAGCCGTACGTGTGTGTGCACTGCAAGAGGAAGTTTGCGGATCCCGGAGCGCTGCAGCGCCACGTCCGGACTCACACCGGGGAGAAGCCGTGCCTGTGTATGATCTGCGGCAAAGCCTTCACCCAGGCCAGCTCCCTAATCGCCCACGTGCGCCAGCACACCGGGGAGAAGCCGTACGTCTGCGAGCGCTGCGGGAAGAGG
  5   1   2       bld Eye       in                         CCAX9954.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGGCACATCCGCACCCACACTGGGGAGAAGCCCTTCTCCTGCCGCGAGTGCAACAAGGCGTTCTCCGACCCGGCGGCCTGCCGAGCCCACGAGAAGACTCACAGCCCCCTGAAACCGTACGGCTGCGAGGACTGCGGGAAGAGCTACCGCCTCGTCAGCCTCCTCAATCTGCACAAGAAGCGCCACACGGGGGGGACGCCCGCTACCGCTGCACCGACTGCAACAAGCATTTTTACCACCCTTCGGGGCAACCTGAAGCGCCCACCCAACTGGGTC
  5   1   2       bld Te4       in                         CAAN7859.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACGAGAAGACTCACAGCCCCCTGAAACCATACGGCTGCGAGGACTGCGGGAAGAGCTACCGCCTCGTCAGCCTCCTCAATCTGCACAAGAAGCGCCACACGGGGGACGCCCGCTACCGCTGCACCGACTGCAACAAGCATTTCACCACCTCGGGCAACCTGAAGCGCCACCAACTGGTCCACAGCGGGGAGAAACCGTACCACTGCGAGTACTGCAACCGGCCCTTCTCCGACCCCACCTCCAAAATGCGCCACTTAGAGACGCACGACACTAACAAGGAGCACAAGTGCCCCCACTGCGACAAAAAGTTCAACCAACTGGGAAACCTGAAAGCCCACCTGAAGATTCACATAGCCGACGGCCCCCTGAAATGCAGAGAATGCGGGAAGCAGTTTACCACGTCGGGGAATCTGAAGAGACACCTGCGGATACACAGCGGGGAGAAGCCGTACGTGTGTGTGCACTGCAAGAGGAAGTTTGCGGATCCCGGAGCGCTGCAGCGCCACGTCCGGACTCACACCGGGGAGAAGCCGTGCCTGTGTATGATCTGCGGCAAAGCCTTCACCCAGGCCAGCTCCCTAATCGCCCACGTGCGCCAGCACACCGGGGAGAAGCCGTACGTCTGCGAGCGCTGCGGGAAGAGGTTTGTGCAGTCGAGCCAGCTGGCCAATCACATCCGCCATCACGACAACATTCGGCCGCACAAGTGCAGTGTGTGTAACANAGCCTTCGTCAATGTGGGGGACCTGACCAAGCACGTCATCATCCACACCGG
  5   1   2       bld Eye                                  CCAX7913.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGTACGGCTGCGAGGACTGCGGGAAGAGCTACCGCCTCGTCAGCCTCCTCAATCTGCACAAGAAGCGCCACACGGGGGACGCCCGCTACCGCTGCACCGACTGCAACAAGCATTTTACCACCTCGGGCAACCTGAAGCGCCACCAACTGGTCCACAGCGGGGAGAAACCGTACCACTGCGAGTACTGCAACCGGCCCTTCTCCGACCCCACCTCCAAAATGCGCCACTTAGAGACGCACGACACTAACAAGGAGCACAAGTGCCCCCACTGCGACAAAAAGTTCAACCAACTGGGAAACCTGAAAGCCCACCTGAAGATTCACATAGCCGACGGCCCCCTGAAATGCAGAGAATGCGGGAAGCAGTTTACCACGTCAGGGAACCTGAAGAGACACCTGCGGATACACAGCGGGGAGAAGCCGTACGTGTGTGTGCACTGCAAGAGGAAGTTTGCGGATCCCGGAGCGCTGCAGCGCCACGTCCGGACTCACACCGGGGAGAAGCCGTGCCTGTGTATGATCTGCGGCAAAGCCTTCACCCAGGCCAGCTCCCTAATCGCCCACGTGCGCCAGCACACCGGGGAGAAGCCGTACGTCTGCGAGCGCTGCGGGAAGAGGTTTGTGCAGTCGAGCCAGCTGGCCAATCACATCCGCCATCACGACAACATTCGGCCGCACAAGTGCAGTGTGTGTAACAAAGCCTTCGTCAATGTGGGGGACCTGACCAAGCACGTCATCATCCACACCGGAGAGAAGCCCTTCCTGTGTG
  5   1   2       bld Egg       in                   TEgg071c01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGCTGCGAGGACTGCGGGAAGAGCTACCGCCTCGTCAGCCTCCTCAATCTGCACAAGAAGCGCCACACGGGGGACGCCCGCTACCGCTGCACCGACTGCAACAAGCATTTCACCACCTCGGGCAACCTGAAGCGCCACCAACTGGTCCACAGCGGGGAGAAACCGTACCACTGCGAGTACTGCAACCGGCCCTTCTCCGACCCCACCTCCAAAATGCGCCACTTAGAGACGCACGACACTAACAAGGAGCACAAGTGCCCCCACTGCGACAAAAAGTTCAACCAACTGGGAAACCTGAAAGCCCACCTGAAGATTCACATAGCCGACGGCCCCCTGAAATGCAGAGAATGCGGGAAGCAGTTTACCACGTCGGGGAATCTGAAGAGACACCTGCGGATACACAGCGGGGAGAAGCCGTACGTGTGTGTGCACTGCAAGAGGAAGTTTGCGGATCCCGGAGCGCTGCAGCGCCACGTCCGGACTCACACCGGGGAGAAGCCGTGCCTGTGTATGATCTGCGGCAAAGCCTTCACCCAGGCCAGCTCCCTAATCGCCCACGTGCGCCAGCACACCGGGGAGAAGCCGTACGTCTGCGAGCGCTGCGGGAAGAGGTTTGTGCAGTCGAGCCAGCTGGCCAATCACA
  5   1   2       bld Gas8      in                          st33a04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGACTGCGGGAAGAGCTACCGCCTCGTCAGCCTCCTCAATCTGCACAAGAAGCGCCACACGGGGGACGCCCGCTACCGCTGCACCGACTGCAACAAGCATTTCACCACCTCGGGCAACCTGAAGCGCCACCAACTGGTCCACAGCGGGGAGAAACCGTACCACTGCGAGTACTGCAACCGGCCCTTCTCCGACCCCACCTCCAAAATGCGCCACTTAGAGACGCACGACACTAACAAGGAGCACAAGTGCCCCCACTGCGACAAAAAGTTCAACCAACTGGGAAACCTGAAAGCCCACCTGAAGATTCACATAGCCGACGGCCCCCTGAAATGCAGAGAATGCGGGAAGCAGTTTACCACGTCAGGGAACCTGAAGAGACACCTGCGGATACACAGCGGGGAGAAGCCGTACGTGTGTGTGCACTGCAAGAGGAAGTTTGCGGATCCCGGAGCGCTGCAGCGCCACGTCCGGACTCACACCGGTACCGCCACTTCCTCCCCGTATCCCTCCCCCGCTCCTGCCCCCCCGCGGGGTAACTAACCCCTCTCTGTCCCTAACAGGGGAGAAGCCGTGCCTGTGTATGATCTGCGGCAAAGCCTTCACCCAGGCCAGCTCCCTAATCGCCCACGTGCGCCAGCACACCGGGGAAAAAGCCGTACGTCTGCGAGC
  5   1   2       bld Gas       in                   TGas142k16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGACGCCCGCTACCGCTGCACCGACTGCAACAAGCATTTCACCACCTCGGGCAACCTGAAGCGCCACCAACTGGTCCACAGCGGGGAGAAACCGTACCACTGCGAGTACTGCAACCGGCCCTTCTCCGACCCCACCTCCAAAATGCGCCACTTAGAGACGCACGACACTAACAAGGAGCACAAGTGCCCCCACTGCGACAAAAAGTTCAACCAACTGGGAAACCTGAAAGCCCACCTGAAGATTCACATAGCCGACGGCCCCCTGAAATGCAGAGAATGCGGGAAGCAGTTTACCACGTCGGGGAATCTGAAGAGACACCTGCGGATACACAGCGGGGAGAAGCCGTACGTGTGTGTGCACTGCAAGAGGAAGTTTGCGGATCCCGGAGCGCTGCAGCGCCACGTCCGGACTCACACCGGGGAGAAGCCGTGCCTGTGTATGATCTGCGGCAAAGCCTTCACCCAGGCCAGCTCCCTAATCGCCCACGTGCGCCAGCACACCGGGGAGAAGCCGTACGTCTGCGAGCGCTGCGGGAAGAGGTTTGTGCAGTCGAGCCAGCTGGCCAATCACATCCGCCATCACGACAACATTCGGCCGCACAAGTGCAGTGTGTGTAACAAAGCCTTCGTCAATGTGGGGGACCTGACCAAGCACGTCATCATCCACACC
  5   1   2       bld Lun1                                 CABD2766.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGAGGAGCACAAGTGCCCCCACTGCGACAAAAAGTTCAACCAACTGGGAAACCTGAAAGCCCACCTGAAGATTCACATAGCCGACGGCCCCCTGAAATGCAGAGAATGCGGGAAGCAGTTTACCACGTCAGGGAACCTGAAGAGACACCTGCGGATACACAGCGGGGAGAAGCCGTACGTGTGTGTGCACTGCAAGAGGAAGTTTGCGGATCCCGGAGCGCTGCAGCGCCACGTCCGGACTCACACCGGGGAGAAGCCGTGCCTGTGTATGATCTGCGGCAAAGCCTTCACCCAGGCCAGCTCCCTAATCGCCCACGTGCGCCAGCACACCGGGGAGAAGCCGTACGTCTGCGAGCGCTGCGGGAAGAGGTTTGTGCAGTCGAGCCAGCTGGCCAATCACATCCGCCATCACGACAACATTCGGCCGCACAAGTGCAGTGTGTGTAACAAAGCCTTCGTCAATGTGGGGGACCTGACCAAGCACGTCATCATCCACACCGGAGAGAAGCCCTTCCTGTGTGACAAGTGTGGCCGGGGCTTTAACCGAGTGGACAATCTCCGCTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAATATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGA
  5   1   2       bld Gas7      in                         XZG30063.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAGTGCCCCCACTGCGACAAAAAGTTCAACCAACTGGGAAACCTGAAAGCCCACCTGAAGATTCACATAGCCGACGGCCCCCTGAAATGCAGAGAATGCGGGAAGCAGTTTACCACGTCAGGGAACCTGAAGAGACACCTGCGGATACACAGCGGGGAGAAGCCGTACGTGTGTGTGCACTGCAAGAGGAAGTTTGCGGATCCCGGAGCGCTGCAGCGCCACGTCCGGACTCACACCGGGGAGAAGCCGTGCCTGTGTATGATCTGCGGCAAAGCCTTCACCCAGGCCAGCTCCCTAATCGCCCACGTGCGCCAGCACACCGGGGAGAAGCCGTACGTCTGCGAGCGCTGCGGGAAGAGGTTTGTGCAGTCGAGCCAGCTGGCCAATCACATCCGCCATCACGACAACATTCGGCCGCACAAGTGCAGTGTGTGTAACAAAGCCTTCGTCAATGTGGGGGACCTGACCAAGCACGTCATCATCCACACCGGAGAGAAGCCCTTCCTGTGTGACAAGTGTGGCCGGGGCTTTAACCGAGTGGACAATCTCCGCTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAATATCGTGACGGTGGCGTCTGATG
  5   1   2       bld Gas8      in                         st101g19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAGAGAATGCGGGAAGCAGTTTACCACGTCAGGGAATCTGAAGAGACACCTGCGGATACACAGCGGGGAGAAGCCGTACGTGTGTGTGCACTGCAAGAGGAAGTTTGCGGATCCCGGAGCGCTGCAGCGCCACGTCCGGACTCACACCGGGGAGAAGCCGTGCCTGTGTATGATCTGCGGCAAAGCCTTCACCCAGGCCAGCTCCCTAATCGCCCACGTGCGCCAGCACACCGGGGAGAAGCCGTACGTCTGCGAGCGCTGCGGGAAGAGGTTTGTGCAGTCGAGCCAGCTGGCCAATCACATCCGCCATCACGACAACATTCGGCCGCACAAGTGCAGTGTGTGTAACAAAGCCTTCGTCAATGTGGGGGACCTGACCAAGCACGTCATCATCCACACCGGAGAGAAGCCCTTCCTGTGCGACAAGTGCGGCCGGGGCTTTAACCGAGTGGACAATCTCCGCTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAACATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCAC
  5   1   2       bld Gas7      in                         XZG18516.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGACGCGTGGGCGGACGCGTGGGCTGCGGCAAAGCCTTCACCCAGGCCAGCTCCCTAATCGCCCACGTGCGCCAGCACACCGGGGAGAAGCCGTACGTCTGCGAGCGCTGCGGGAAGAGGTTTGTGCAGTCGAGCCAGCTGGCCAATCACATCCGCCATCACGACAACATTCGGCCGCACAAGTGCAGTGTGTGTAACAAAGCCTTCGTCAATGTGGGGGACCTGACCAAGCACGTCATCATCCACACCGGAGAGAAGCCCTTCCTGTGTGACAAGTGTGGCCGGGGCTTTAACCGTGGACAATCTCCGCTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTTGACGAGGACGAGGTGAACATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCG
  3   1   2       bld Neu0 FL   out                      IMAGE:6991718                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATAATTTGGGGGGCAAAAGCCTTTCACCCCAGGGCCAAGCTCCCTTAATTCGCCCCAGGTTGCGCCCAGCAACCCCGGGGAGAAAGCGTTACTTTTTCAAGCGGTGCGGGAAGAGGTTTGTGCAGTCGAGCCAGCTGCCCAATCACATCCGCCATCACGACAACATTCGGCCGCACAAGTGCAGTGTGTGTAACAAAGCTTTCGTCAATGGGGGGACCTGACCAAGCACGTCATCATCCACACGGGAGAGAAGCCCTTCCTGTGTGACAAGTGTGGCCGGGGCTTTAACCGAGTGGACAATCTCCGCTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAATATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACATGTGGGGGGGCCCTTATGC
  3   1   2       bld Egg                             TEgg046j03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGCACACCGGGGAGAAGCCGTACGTCTGCGAGCGCTGCGGGAAGAGGTTTGTGCAGTCGAGCCAGCTGGCCAATCACATCCGCCATCACGACAACATTCGGCCGCACAAGTGCAGTGTGTGTAACAAAGCCTTCGTCAATGTGGGGGACCTGACCAAGCACGTCATCATCCACACCGGAGAGAAGCCCTTCCTGTGCGACAAGTGCGGCCGGGGCTTTAACCGAGTGGACAATCTCCGCTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAACATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACATGTGGGGAGGCGCCTTATGCATCTAATAAACATTTTTTTTAATAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas086e11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCGAGCGCTGCGGGAAGAGGTTTGTGCAGTCGAGCCAGCTGGCCAATCACATCCGCCATCACGACAACATTCGGCCGCACAAGTGCAGTGTGTGTAACAAAGCCTTCGTCAATGTGGGGGACCTGACCAAGCACGTCATCATCCACACCGGAGAGAAGCCCTTCCTGTGTGACAAGTGTGGCCGGGGCTTTAACCGAGTGGACAATCTCCGCTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAACATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACATGTGGGGGGGACCGTATGCATCTAATAAACATTATTTTTTAATTAAAAAAAAAAAAAAAAAAAA
  3   1   2      seed Te4       in                         CAAN7859.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCGCTGCGGAAAGAGGTTTGTGCAGTCGAGCCAGCTGGCCAATCACATCCGCCATCACGACAACATTCGGCCGCACAAGTGCAGTGTGTGTAACAAAGCCTTCGTCAATGTGGGGGACCTGACCAAGCACGTCATCATCCACACCGGAGAGAAGCCCTTCCTGTGTGACAAGTGTGGCCGGGGCTTTAACCGAGTGGACAATCTCCGCTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAACATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACATGTGGGGGGGCCCTTATGCATCTAATAAACATTATTTTTTAATT
  3   1   2       bld Gas       in                    TGas142k16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCAATCACATCCGCCATCACGACAACATTCGGCCGCACAAGTGCAGTGTGTGTAACAAAGCCTTCGTCAATGTGGGGGACCTGACCAAGCACGTCATCATCCACACCGGAGAGAAGCCCTTCCTGTGTGACAAGTGTGGCCGGGGCTTTAACCGAGTGGACAATCTCCGCTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAACATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACATGTGGGGGGACCGGTTATGCATCTAATAAACATTATTTTTTAATAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas8      in                          st15m12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATCACGACAACATTCGGCCGCACAAGTGCAGTGTGTGTAACAAAGCCTTCGTCAATGTGGGGGACCTGACCAAGCACGTCATCATCCACACCGGAGAGAAGCCCTTCCTGTGCGACAAGTGCGGCCGGGGCTTTAACCGAGTGGACAATCTCCGCTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAACATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGA
  3   1   2       bld Gas8      in                          st33a04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACAACATTCGGCCGCACAAGTGCAGTGTGTGTAACAAAGCNTTCGTCAATGTGGGGGACCTGACCAAGCACGTCATCATCCACACCGGAGAGAAGCCCTTCCTGTGCGACAAGTGCGGCCGGGGCTTTAACCGAGTGGACAATCTCCGCTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAACATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACATGTGGGGGGCCCTA
  3   1   2       bld Gas8 5g3  out                         st19e07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACATTCGGCCGCACAAGTGCAGTGTGTGTAACAAAGCCTTCGTCAATGTGGGGGACCTGACCAAGCACGTCATCATCCACACCGGAGAGAANNCCTTCCTGTGCGACAAGTGCGGCCGGGGCTTTAACCGAGTGGACAATCTCCGCTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAACATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCAAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACATGTGGGGGGGCCC
  3   1   2       bld Egg       in                    TEgg071c01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGCACAAGTGCAGTGTGTGTAACAAAGCCTTCGTCAATGTGGGGGACCTGACCAAGCACGTCATCATCCACACCGGAGAGAAGCCCTTCCTGTGTGACAAGTGTGGCCGGGGCTTTAACCGAGTGGACAATCTCCGCTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAACATCGTGACGGTGGCGTTTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGATTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGGGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTTTGGGGGGGGGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACATGTGGGGGGGCCCTTATGCATTTAATAAACGATTATTTTTTTTTTANAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas8      in                         st101g19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGTGCAGTGTGTGTAACAAAGCTTTNGTCAATGTGGGGGACNTGACCAAGCACGTCATCATNCACACNGGAGAGAAGCCCTTCCTGTGCGACAAGTGCGGCCGGGGCTTTAACCGAGTGGACAATCTCCGCTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAACATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAAGTGTACCATGTGGGGGGCCCT
  3   1   2       bld Gas8      in                          st15m12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCAATGTGGGGACCTGACCAAGCACGTCATCATCCACACCGGAGAGAAGCCCTTCCTGTGCGACAAGTGCGGCCGGGGCTTTAACCGAGTGGACAATCTCCGCTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAACATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACATGTGGGGGGCCCTA
  3   1   2       bld Gas8 5g3  out                         st36p23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCAATGTGGGGACCTGACCAAGCACGTCATCATCCACACCGGAGAGAAGCCCTTCCTGTGCGACAAGTGCGGCCGGGACTTTAACCGAGTGGACAATCTCCGCTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAACATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACATGTGGGGGGGCCCT
  3   1   2       bld Gas8      in                          st88n10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACCAAGCACGTCATCATCCACACCGGAGAGAAGCCCTTCCTGTGCGACAAGTGCGGCCGGGGCTTTAACCGAGTGGACAATCTCCGCTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAACATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACCTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACCATGTGGGGGGCCCT
  3   1   2       bld Gas8 5g3  out                        st108c04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATCCACACCGGAGAGAAGCCNTTCCTGTGCGACAAGTGCGGCCGGGGCTTTTAACCGAGTGGACAATTTTCCGNTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAACATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACATGTGGGGG
  3   1   2       bld Gas8 5g3  out                         st69i11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGTGAAGACNGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAACATCGTGACGGTGGCGTCTNGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCNCAGGTGAACCCCTTGCGCCATTGTGCCCCNCCAGCTGCTGAGCCAATAGCTTTGTGCTAAATATTNTGTCTCCTCCCTCAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACANGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGNTGGACCTCGGTGCCNGACACTGAGAATGGGACTGNCCGAGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCTTGC
  3   1   2       bld Gas8      in                          st13f10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGAAGACGGTGCATCANGGGAAGGCGGGGATGAAGNTGCTNGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAACATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGGTGAACCCCTTGCGCCATTGTGCCCCCCCAGCTGCTGAGCCAATAGCTTTGTGCTAAATATTCTGTCTCCTCCCTCAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACCATGTGGGGGGCCCT
  3   1   2       bld Gas8                                  st63b04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGCTTTAACNGANTGGACAATCTCCGCTCCCACNTGAAGACGGTGCATCAGGGGAAGGCGGGGATNAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAACATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGNCCATCGCCGCCACGGNCGTNACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGNGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCATGAGACTNGTGCGGGGAGAAGTTCCTGGACNNCAACAGCTTGGNGCNACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTNCAGGCCGACACGGACTTTTTCCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGNTCATATTCCGCGCGCGGGACGGGGCNGACGAACACCCCCAGGCTGTNGATTNTCCAGATTCCCGGTGGAATATGNTGGACCTCGGTGCCGGACACTGANAATGGGACT
  5   1   2       bld Bone      in                        CBTC2575.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCCGCTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAATATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGGGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACATGTGGGGGGGCCCTTATGCATCTAATAAACATTATTTTTTAATT
  3   1   2       bld Gas7      in                         XZG30063.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCTCCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAATATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACATGTGGGGGGGCCCTTATGCATCTAATAAACATTATTTTTTAATT
  3   1   2       bld Bone      in                        CBTC2575.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCACGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAATATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGGGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACATGTGGGGGGGCCCTTATGCATCTAATAAACATTATTTTTTAATT
  5   1   2       bld Gas7                                 XZG60922.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGAGCGAGAGGAGGGGGAGCTGGACGAGGACGAGGTGAACATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCCACACCCAGATACTGTACGCCTGCGACTCG
  3   1   2       bld Gas8                                   st7f12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGAAGACGGTGCATCAGGGGAAGGCGGGGATGAAGGTGCTGGANCGAGAGGAGGGGGAGCTGGACGANGACGAGGTGAACATCGTGACGGTGGCGTCTGATGAGATGGTCACTTTAACCACGGAGACCATCGCCGCCACGNCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTNCGAATGCACACGGCCCAGGNGCTGGTCATGTTNCAGGCCGACANGGACTTTTACCAGCAGTACAGCGCCCNCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTNCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTANCATGTGGGGGGCCNT
  3   1   2       bld Te4  5g3  out                        CAAN4422.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGACGGTGCCTTCCGATAAGATGGTCACTTTAACCACGGAGACCATTTCCCCCACGGCCGTTACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCACCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACCCCAACAGCTTGGCCCAACACGTGGGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGATTTTTTCCACCAGTACAGCGCCCCCCCCACGTGGCACTCCGAGCAGGTCATACAGTCCGGGGAGTTCTTATTTCGCGCGCGGGACGGGGCCGACGAACCCCCCCAGGCTGTTGATTCCCAGAGCCCGGTGGAATAGCTGGACCTCGGTCCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCCCACAGGTTTTGGGGGGGCGGCAACTGGACCCTCGGACCTTGC
  3   1   2       bld Gas8      in                          st10k05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTTAACCACGGAGACCATCGCCGCCACGGCCGTGACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCCTTGCTGGTGTATAAAGTGTACCATGTGGGGGGCC
  5   1   2       bld Gas8      in                          st10k05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCGCCGCCACGGCCGTGAACAGAACTCACAGTGGTTCCGGTCACCACGTCGGTGGCAGCCGATGAGACGGAAGCGCTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACATGTGGGGGGGCCCTTATGCATCTAATAAACATTATTTTTTANTTA
  3   1   2       bld Gas8      in                         st115b17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACCACGTCGGTGGCAGCNGATGAGACGGAAGCGNTTAAGGCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTNCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCNCCANCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGNTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCATCAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGA
  3   1   2       bld Gas7      in                         XZG18516.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTTTAGACGGAAGCCCTTAAGGGGGAGATCAGCAAGGCGGTGAAACAGGTGCGGGAAGCAGATCCCAACACCCCGATTCTGTTCGCCTGGGTCTCGTGGGGGGAGAAGTTCCTGGACGCCAACAGCTTGGGGCAACACGTGGGAATGCTCACGGCCCAGGCGCTGGTCATGTTTCAGGCCGACACGGATTTTTTCCAACAGTACAGGGCCCCCCCCCCTTGGCACCCCGAGCAGGTTTTTCAGTCCGGGGAGCTCTTATTTCGCCCCCGGGACGGGGCCGACGAACACCCCCCGGCTGTTGATTGCCAGAGCCCGGTGGAATAGTTGGACCTCGGTGCCGGACCCTGAAAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTTTGGGGGGGGGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACATTTGGGGGGGCCCTTATGCATTTAATAAACATTTTTTTTTTTTTTCCGCAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas8      in                         st115b17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGGAGATCAGCAAGGCGGTGAAACAGGTGCAGGAAGCAGATCCCAACACCCAGATACTGTACGCCTGCGACTCGTGCGGGGAGAAGTTCCTGGACGCCAACAGCTTGGCGCAACACGTGCGAATGCACACGGCCCAGGCGCTGGTCATGTTCCAGGCCGACACGGACTTTTACCAGCAGTACAGCGCCCCCACCACGTGGCACACCGAGCAGGTCATACAGTCCGGGGAGCTCATATTCCGCGCGCGGGACGGGGCCGACGAACACCCCCAGGCTGTCGATTGCCAGAGCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACATGTGGGGGGGCCCTTATGCATCTAATAAACATTATTTTTTACTT
  3   1   2       bld Eye       in                         CCAX9954.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCACCCCCCAGGCTGTCGATTGCCCAGAGCCCCGGTGGAATAGCTGGACCTCGGTGCCGGACACTGAGAATGGGACTGGCCGAGTGCCCAAGCGCCACAGGTTCTGGGGCGGCGGCAACTGGACCCTCGGACCTTGCTGGTGTATAAAGTGTACATGTGGGGGGGCCCTTATGCATTTAATAAACATTATTTTTTAATTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)