Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 193.0    0Xt7.1-TGas141f23.3.5                       54 PI      77        659      972                GATA binding protein 4 [Xenopus tropicalis]
     2 513.0    0Xt7.1-TNeu072n14.3                          7 PI      80        834     1455                transcription factor xGATA-5a [Xenopus laevis]

 This cluster: approximate FL confidence score = 96%

 1012075153 Xt7.1-CABG12671.3 - 49 ESTs
                                                                       .......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABG12671.3                                                                                                                                          TCTGACTCCGACTGCGACTGGATCGCAAGACGCTTCCCAGCAGAAGCCACGTTCAGCCAATCTGCCCGGAGTCGCTGGTAGGAAGGCTCAGCCGGTGCTGTTCGGTTCGTACCGCCGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCACGACCCCTCGAACTTCCTGCACTCTACGGGCAGCCCCCCGGTCTATGTGCCGACTAGTCGGATGCCGGCCATGCTACAGTCGCTCCCCTACCTACAGAGCTGCGACACTGCCCACCAGGGCCACCATCTGGGCAACCACCCGGGCTGGGCACAGACTGCCAACGAGAGCCACACGTTCAATGCCAGCAGCCCCCACACCCCCAGCGGATTCCCTTACTCGCACAGCCCCCCTGTGGGCAACGCCAGTGCCAGGGAAGGTGCCTACCAGAGCCCCCTGATCATGGGCAGCAGTGCCAGGGACCAGTATGGCAACTCCCTGGTGCGCACCGGCTCCTACCCCAGCCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACAGCCTGCAGGGGAGGCAGCCCTTACCGGGTAGGAGATCCAGCCTGGAGTTCCTAGAAGAGTTTCATGGTGAGGGAAGAGAATGCGTCAACTGTGGGGCTATGTCTACCCCTCTGTGGAGACGAGATGGAACGGGCCACTACCTGTGCAATGCCTGCGGGCTGTACCATAAAATGAATGGCATCAACAGACCCCTAATCAAACCACAGAAAAGGCTGTCCTCCTCCCGGCGGGCCGGCCTTTGCTGCACTAACTGTCACACCAGCACCACAACCCTGTGGAGGCGCAACTCGGAGGGGGAGCCGGTGTGTAACGCTTGTGGCCTGTACATGAAACTACATGGGGTACCTCGGCCTCTGGCCATGAAGAAAGAAAGTATTCAGACCCGGAAAAGGAAGCCAAAAAATGTCAGTAAAGGAAAGACTTCCACAGGCTCGACATCGGCCACCAACTCCCCGTCTTCAGTTACAATTCCGATCCGACGCCCGTGTTAAAAACAGAACCCCAATATCGCATCCCAGTACCCGGGTCAGGCAATTGTAGCGGTCTCCCAGGGGCAGAGCCAAACGGACGATCTGGTCAACGGGTCCACGAGCTGAAGGTTTATCCCAGAGGAATACGCCTACAGCCCCACCGCTCTGAGCCAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCTGTCTGACTACCTTTTTAGTGCAATTTGTTTCACATCTAATAAAGAGTGATAATGTGTCACCGAGTATAAAAATATATTTTATTAAAATCTTATTACAGTTGGAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008225848                                                                                                                                                TCCGACTGCGACTGGATCGCAAGACGCTTCCCAGCAGAAGCCACGTTCAGCCAATCTGCCCGGAGTCGCTGGTAGGAAGGCTCAGCCGGTGCTGTTCGGTTCGTACCGCCGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCACGACCCCTCGAACTTCCTGCACTCTACGGGCAGCCCCCCGGTCTATGTGCCGACTAGTCGGATGCCGGCCATGCTACAGTCGCTCCCCTACCTACAGAGCTGCGACACTGCCCACCAGGGCCACCATCTGGGCAACCACCCGGGCTGGGCACAGACTGCCAACGAGAGCCACACGTTCAATGCCAGCAGCCCCCACACCCCCAGCGGATTCCCTTACTCGCACAGCCCCCCTGTGGGCAACGCCAGTGCCAGGGAAGGTGCCTACCAGAGCCCCCTGATCATGGGCAGCAGTGCCAGGGACCAGTATGGCAACTCCCTGGTGCGCACCGGCTCCTACCCCAGCCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACAGCCTGCAGGGGAGGCAGCCCTTACCGGGTAGGAGATCCAGCCTGGAGTTCCTAGAAGAGTTTCATGGTGAGGGAAGAGAATGCGTCAACTGTGGGGCTATGTCTACCCCTCTGTGGAGACGAGATGGAACGGGCCACTACCTGTGCAATGCCTGCGGGCTGTACCATAAAATGAATGGCATCAACAGACCCCTAATCAAACCACAGAAAAGGCTGTCCTCCTCCCGGCGGGCCGGCCTTTGCTGCACTAACTGTCACACCAGCACCACAACCCTGTGGAGGCGCAACTCGGAGGGGGAGCCGGTGTGTAACGCTTGTGGCCTGTACATGAAACTACATGGGGTACCTCGGCCTCTGGCCATGAAGAAAGAAAGTATTCAGACCCGGAAAAGGAAGCCAAAAAATGTCAGTAAAGGAAAGACTTCCACAGGCTCGACATCGGCCACCAACTCCCCGTCTTCxxTxxxAATTCCGATCCGACGCCCGTGTTAAAAACAxxAxCCCAATATCGCATCCCAGTACCCGGGTCAGGCAATTGTAGCGGTCTCCCAGGGGCAGAGCCAAACGGACGATCTGGTCAAxGGxxCCACGAGxxxxAxGTTTATCCCAGAGGAATACGCCTACAGCCCCACCGCTCTGAGCCAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCTGTCTGACTACCTTTTTAGTGCAATTTGTTTCACATCTAATAAAGAGTGATAATGTGTCACCGAGTATAAAAATATATTTTATTAAAATCTTATTACAGxxGGAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                               3     3     4     4     4     4     4     4     4     4     5     5     5     5     6     6    13    14    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    19    19    19    19    19    19    18    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    18    18    18    18    18    18    18    18    18    18    18    18    19    19    17    17    16    16    16    16    13    13    12    12     7     7     7     8     6     7     6     7     7     8     6     8     6     8     6     8     6     8     5     7     5     7     5     7     4     6     4     6     4     6     4     6     5     7     5     7     5     8     5     8     5     8     4     8     4     9     4     9     4     9     5    10     5     9     5     9     4     9     5    10     5    10     4     9     4    10     4    10     4    10     4    10     6    11    10    15    13    18    11    19    20    26    20    26    20    26    21    27    21    28    21    29    28    30    29    30    29    30    29    30    27    29    29    29    29    29    28    29    29    29    28    29    28    29    28    29    28    29    28    29    28    28    27    27    26    27    27    27    27    28    27    28    27    28    27    28    26    27    26    27    27    27    26    27    27    27    26    27    25    27    26    27    26    27    26    26    26    26    26    26    25    26    26    26    26    26    26    26    25    26    24    26    23    26    25    25    25    25    22    25    24    24    24    24    19    24    17    22    18    21    17    21    11    13     9    10    10    10    10    10     3     7     3     3     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          T--------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --------G--G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --G---C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------GT
                                               BLH ATG     121    1280                                                                                                                                          
                                               BLH MIN     121     173                                                                                                                                          
                                               BLH OVR     121     110                                                                                                                                          
                                               CDS MIN     121      50                                                                                                                                          
                                               EST CLI      84      50                                                                                                                                          
                                               ORF LNG     121       6                                                                                                                                          
                                                                                                                 PROTEIN --- Sc ---- 1e-015     NP_116632.1 activator of transcription of nitrogen-regulated genes; inactivated by increasesin intracellular glutamate levels; Gat1p [Saccharomyces cerevisiae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 2e-043     NP_001033436.1 Erythroid-Like Transcription factor family member (elt-1) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 5e-054     BAE06473.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Dm ---- 5e-058     NP_732102.1 pannier CG3978-PB [Drosophila melanogaster] ---------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                    PROTEIN --- Sp ---- 3e-064     NP_001005725.1 GATA transcription factor e [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 3e-113     NP_536721.1 GATA binding protein 5; transcription factor GATA-5; GATA binding factor-5 [Homosapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 1e-113     NP_032119.1 GATA binding protein 5; GATA-binding protein 5 [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN === Dr ==== 5e-132     NP_571310.2 GATA-binding protein 5 [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN === Gg ==== 3e-159     NP_990752.1 GATA-5 transcription factor [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 0          AAA63687.1 transcription factor xGATA-5b [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN === ?? ==== 0          NP_001079831.1 transcription factor xGATA-5b [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PREDICTED = Xt ==== 0          AAH88567.1 Hypothetical LOC496852 [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABG12671.3                                                                                                                                                                                                                                                                   ATG---------------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------TAA---TGA------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------TGA------------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------ATG---------TGA---------TAG------------------TAATAA---------ATG------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ...
  5   1   1           Gas1 FL                     IMAGE:6988214.FL-MGC                                                                                                                                                                                                  CCAATCTGCCCGGAGTCGCTGGTAGGAAGGCTCAGCCGGTGCTGTTCGGTTCGTACCGCCGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCACGACCCCTCGAACTTCCTGCACTCTACGGGCAGCCCCCCGGTCTATGTGCCGACTAGTCGGATGCCGGCCATGCTACAGTCGCTCCCCTACCTACAGAGCTGCGACACTGCCCACCAGGGCCACCATCTGGGCAACCACCCGGGCTGGGCACAGACTGCCAACGAGAGCCACACGTTCAATGCCAGCAGCCCCCACACCCCCAGCGGATTCCCTTACTCGCACAGCCCCCCTGTGGGCAACGCCAGTGCCAGGGAAGGTGCCTACCAGAGCCCCCTGATCATGGGCAGCAGTGCCAGGGACCAGTATGGCAACTCCCTGGTGCGCACCGGCTCCTACCCCAGCCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACAGCCTGCAGGGGAGGCAGCCCTTACCGGGTAGGAGATCCAGCCTGGAGTTCCTAGAAGAGTTTCATGGTGAGGGAAGAGAATGCGTCAACTGTGGGGCTATGTCTACCCCTCTGTGGAGACGAGATGGAACGGGCCACTACCTGTGCAATGCCTGCGGGCTGTACCATAAAATGAATGGCATCAACAGACCCCTAATCAAACCACAGAAAAGGCTGTCCTCCTCCCGGCGGGCCGGCCTTTGCTGCACTAACTGTCACACCAGCACCACAACCCTGTGGAGGCGCAACTCGGAGGGGGAGCCGGTGTGTAACGCTTGTGGCCTGTACATGAAACTACATGGGGTACCTCGGCCTCTGGCCATGAAGAAAGAAAGTATTCAGACCCGGAAAAGGAAGCCAAAAAATGTCAGTAAAGGAAAGACTTCCACAGGCTCGACATCGGCCACCAACTCCCCGTCTTCAGTTACAAATTCCGATCCGACGCCCGTGTTAAAAACAGAACCCAATATCGCATCCCAGTACCCGGGTCAGGCAATTGTAGCGGTCTCCCAGGGGCAGAGCCAAACGGACGATCTGGTCAACGGGTCCCACGAGCTGAAGTTTATCCCAGAGGAATACGCCTACAGCCCCACCGCTCTGAGCCAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCTGTCTGACTACCTTTTTAGTGCAATTTGTTTCACATCTAATAAAGAGTGATAATGTGTCACCGAGTATAAAAATATATTTTATTAAAATCTTATTACAGTTGAAAAAAAAAAAAAAAAAAA
  5   1   2       bld TbA  5g3  in                   TTbA046n13.p1kSP6                                                                                                                                     CTCCGTCTGACTCCGACTGCGACTGGATCGCAAGACGCTTCCCAGCAGAAGCCACGTTCAGCCAATCTGCCCGGAGTCGCTGGTAGGAAGGCTCAGCCGGTGCTGTTCGGTTCGTACCGCCGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCACGACCCCTCGAACTTCCTGCACTCTACGGGCAGCCCCCCGGTCTATGTGCCGACTAGTCGGATGCCGGCCATGCTACAGTCGCTCCCCTACCTACAGAGCTGCGACACTGCCCACCAGGGCCACCATCTGGCCAACCACCCGGGCTGGGCACAGACTGCCAACGAGAGCCACACGTTCAATGCCAGCAGCCCCCACACCCCCAGCGGATTCCCTTACTCGCACAGCCCCCCTGTGGGCAACGCCAGTGCCAGGGAAGGTGCCTACCAGAGCCCCCTGATCATGGGCAGCAGTGCCAGGGACCAGTATGGCAACTCCCTGGTGCGCACCGGCTCCTACCCCAGCCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACAGCCTGCAGGGGAGGCAGCCCTTACCGGGT
  5   1   2       bld TbA  5g3  in                   TTbA076e15.p1kSP6                                                                                                                                          TCTGACTCCGACTGCGACTGGATCGCAAGACGCTTCCCAGCAGAAGCCACGTTCAGCCAATCTGCCCGGAGTCGCTGGTAGGAAGGCTCAGCCGGTGCTGTTCGGTTCGTACCGCCGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCACGACCCCTCGAACTTCCTGCACTCTACGGGCAGCCCCCCGGTCTATGTGCCGACTAGTCGGATGCCGGCCATGCTACAGTCGCTCCCCTACCTACAGAGCTGCGACACTGCCCACCAGGGCCACCATCTGGGCAACCACCCGGGCTGGGCACAGACTGCCAACGAGAGCCACACGTTCAATGCCAGCAGCCCCCACACCCCCAGCGGATTCCCTTACTCGCACAGCCCCCCTGTGGGCAACGCCAGTGCCAGGGAAGGTGCCTACCAGAGCCCCCTGATCATGGGCAGCAGTGCCAGGGACCAGTATGGCAACTCCCTGGTGCGCACCGGCTCCTACCCCAGCCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACAGCCTGCAGGGGAGGCAGCCCTTACCGGGTAGGAGATCCAGCCTGGAGTTCCTAGAAGAGTTTCATGGTGAGGGAAGAAGATGCGTNCACTGTGGGGCTATGTCTACCCCTCTGT
  5   1   2       bld TbA  5g3  in                   TTbA078p04.p1kSP6                                                                                                                                          TCTGACTCCGACTGCGACTGGATCGCATTACGCTTCCCAGCAGAAGCCACGTTCAGCCAATCTGCCCGGAGTCCCTGGTAGGAAGGCTCAGCCGGTGCTGTTCCGTTCCTACCGCCGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCACGACCCCTCGAACTTCCTGCACTCTACGGGCAGCCCCCCGGTCTATGTGCCGACTAGTCGGATGCCGGCCATGCTACAGTCGCTCCCCTACCTACAGAGCTGCGACACTGCCCACCAGGGCCACCATCTGGGCAACCACCCGGGCTGGGCACAGACTGCCAACGAGAGCCACACGTTCAATGCCAGCAGCCCCCACACCCCCAGCGGATTCCCTTACTCGCACAGCCCCCCTGTGGGCAACGCCAGTGCCAGGGAAGGTGCCTACCAGAGCCCCCTGATCATGGGCAGCAGTGCCAGGGACCAGTATGGCAACTCCCTGGTGCGCACCGGCTCCTACCCCAGCCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACAGCCTGCAGGGGAGGCAGCCCTTACCGGGTAGGAGATCCAGCCTGGAGTTCCTAGAAGAGTTTCATGGTGAGGGAAGAGAATGCGTCAACTGTGGGGCTATGTCTACCCCTCTGTGGAGACGAGATGGAACGGGCCACTACCTGTGCAATGCCTGCGGGCTGTACCATAAAATGAATGGCATCAACAGACCCCTAAT
  5   1   2   32  bld Gas7 5x3  out                          XZG367.5p ...............................................................................................................................................TCCGACTGCGACTGGATCGCAAGACGCTTCCCAGCAGAAGCCACGTTCAGCCAATCTGCCCGGAGTCGCTGGTAGGAAGGCTCAGCCGGTGCTGTTCGGTTCGTACCGCCGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCACGACCCCTCGAACTTCCTGCACTCTACGGGCAGCCCCCCGGTCTATGTGCCGACTAGTCGGATGCCGGCCATGCTACAGTCGCTCCCCTACCTACAGAGCTGCGACACTGCCCACCAGGGCCACCATCTGGGCAACCACCCGGGCTGGGCACAGACTGCCAACGAGAGCCACACGTTCAATGCCAGCAGCCCCCACACCCCCAGCGGATTCCCTTACTCGCACAGCCCCCCTGTGGGCAACGCCAGTGCCAGGGAAGGTGCCTACCAGAGCCCCCTGATCATGGGCAGCAGTGCCAGGGACCAGTATGGCAACTCCCTGGTGCGCACCGGCTCCTACCCCAGCCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACAGCCTGCAGGGGAGGCAGCCCTTACCGGGTAGGAGATCCAGCCTGGAGTTCCTAGAAGAGTTTCATGGTGAGGGAAGAGAATGCGTCAACTGTGGGGCTATGTCTACCCCTCTGTGGAGACGAGAT
  5   1   2       bld Gas1 FL                            IMAGE:6988214                                                                                                                                                                                                  CCAATCTGCCCGGAGTCGCTGGTAGGAAGGCTCAGCCGGTGCTGTTCGGTTCGTACCGCCGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCACGACCCCTCGAACTTCCTGCACTCTACGGGCAGCCCCCCGGTCTATGTGCCGACTAGTCGGATGCCGGCCATGCTACAGTCGCTCCCCTACCTACAGAGCTGCGACACTGCCCACCAGGGCCACCATCTGGGCAACCACCCGGGCTGGGCACAGACTGCCAACGAGAGCCACACGTTCAATGCCAGCAGCCCCCACACCCCCAGCGGATTCCCTTACTCGCACAGCCCCCCTGTGGGCAACGCCAGTGCCAGGGAAGGTGCCTACCAGAGCCCCCTGATCATGGGCAGCAGTGCCAGGGACCAGTATGGCAACTCCCTGGTGCGCACCGGCTCCTACCCCAGCCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACAGCCTGCAGGGGAGGCAGCCCTTACCGGGTAGGAGATCCAGCCTGGAGTTCCTAGAAGAGTTTCATGGTGAGGGAAGAGAATGCGTCAACTGTGGGGCTATGTCTACCCCTCTGTGGAGACGAGATGGAACGGGCCACTACCTGTGCAATGCCTGCGGGCTGTACCATANAATGAATGGCATCAACAGACCCCTAATCAAACCACAGAAAAGGCTGTCCTCCCTCCCGGCGGGCCGGGCCTTTGGCTGCACTAACTGGTCACAACCAGCACCCACAACCCCTGTTGGGAGGGCGCAACCTTCGGAAGGGGGGGAAGCCC
  5   1   2       bld Gas8 5g3  in                          st60b21.5p                                                                                                                                                                                                                              GGCTCAGCCGGTGCTGTTCGGTTCGTACCGCCGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCACGACCCCTCGAACTTCCTGCACTCTACGGGCAGCCCCCCGGTCTATGTGCCGACTAGTCGGATGCCGGCCATGCTACAGTCGCTCCCCTACCTACAGAGCTGCGACACTGCCCACCAGGGCCACCATCTGGGCAACCACCCGGGCTGGGCACAGACTGCCAACGAGAGCCACACGTTCAATGCCAGCAGCCCCCACACCCCCAGCGGATTCCCTTACTCGCACAGCCCCCCTGTGGGCAACGCCAGTGCCAGGGAAGGTGCCTACCAGAGCCCCCTGATCATGGGCAGCAGTGCCAGGGACCAGTATGGCAACTCCCTGGTGCGCACCGGCTCCTACCCCAGCCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACAGCCTGCAGGGGAGGCAGCCCTTACCGGGTAGGAGATCCAGCCTGGAGTTCCTAGAAGAGTTTCATGGTGAGGGAAGAGAATGCGTCAACTGTGGGGCTATGTCTACCCCTCTGTGGAGACGAGATGGAACGGGCCACTACCTGTGCAATGCCTGCGGNCTGTACCATAAAATGA
  5   1   2       bld HdA  5g                        THdA046i07.p1kSP6                                                                                                                                                                                                                               CTCAGCCGGTGCTGTTCGGTTCGTACCGCCGAGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCACGACCCCTCGAACTTCCTGCACTCTACGGGCAGCCCCCCGGTCTATGTGCCGACTAGTCGGATGCCGGCCATGCTACAGTCGCTCCCCTACCTACAGAGCTGCGACACTGCCCACCAGGGCCACCATCTGGGCAACCACCCGGGCTGGGCACAGACTGCCAACGAGAGCCACACGTTCAATGCCAGCAGCCCCCACACCCCCAGCGGATTCCCTTACTCGCACAGCCCCCCTGTGGGCAACGCCAGTGCCAGGGAAGGTGCCTACCAGAGCCCCCTGATCATGGGCAGCAGTGCCAGGGACCAGTATGGCAACTCCCTGGTGCGCACCGGCTCCTACCCCAGCCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACAGCCTGCAGGGGAGGCAGCCCTTACCGGGTAGGAGATCCAGCCTGGAGTTCCTAGAAGAGTTTCATGGTGAGGGAAGAGAATGCGTCAACTGTGGGGCTATGTCTACCCCTCTGTGGAGACGAGATGGAACGGGCCACTACCTGTGCAATGCCTGCGGGCTGTACCATAAAATGAATGGCATCAACAGACCCCTAATCAAACCACAGAAAAGGCTGTCCTCCTCCCGGCGGGCCGGCCTTTGCTGCACTAACTGTCACACCAGCACCACAACCCTGTGGAGGCGC
  5   1   2       bld Gas8 5g3  in                          st62b21.5p                                                                                                                                                                                                                               GCTCAGCCGGTGCTGTTCGGTTCGTACCGCCGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCACGACCCCTCGAACTTCCTGCACTCTACGGGCAGCCCCCCGGTCTATGTGCCGACTAGTCGGATGCCGGCCATGCTACAGTCGCTCCCCTACCTACAGAGCTGCGACACTGCCCACCAGGGCCACCATCTGGGCAACCACCCGGGCTGGGCACAGACTGCCAACGAGAGCCACACGTTCAATGCCAGCAGCCCCCACACCCCCAGCGGATTCCCTTACTCGCACAGCCCCCCTGTGGGCAACGCCAGTGCCAGGGAAGGTGCCTACCAGAGCCCCCTGATCATGGGCAGCAGTGCCAGGGACCAGTATGGCAACTCCCTGGTGCGCACCGGCTCCTACCCCAGCCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACAGCCTGCAGGGGAGGCAGCCCTTACCGGGTAGGAGATCCAGCCTGGAGTTCCTAGAAGAGTTTCATGGTGAGGGAAGAGAATGCGTCAACTGTGGGGCTATGTCTACCCCTCTGTGGA
  5   1   2       bld Gas8 5g3  in                          st63b21.5p                                                                                                                                                                                                                               GCTCAGCCGGTGCTGTTCGGTTCGTACCGCCGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCACGACCCCTCGAACTTCCTGCACTCTACGGGCAGCCCCCCGGTCTATGTGCCGACTAGTCGGATGCCGGCCATGCTACAGTCGCTCCCCTACCTACAGAGCTGCGACACTGCCCACCAGGGCCACCATCTGGGCAACCACCCGGGCTGGGCACAGACTGCCAACGAGAGCCACACGTTCAATGCCAGCAGCCCCCACACCCCCAGCGGATTCCCTTACTCGCACAGCCCCCCTGTGGGCAACGCCAGTGCCAGGGAAGGTGCCTACCAGAGCCCCCTGATCATGGGCAGCAGTGCCAGGGACCAGTATGGCAACTCCCTGGTGCGCACCGGCTCCTACCCCAGCCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACAGCCTGCAGGGGAGGCAGCCCTTACCGGGTAGGAGATCCAGCCTGGAGTTCCTAGAAGAGTTTCATGGTGAGGGAAGAGAATGCGTCAACTGTGGGGCTATGTCTACCCCTCTGTGGAGACGAGATGGAACGGGCCACTACCTG
  5   1   2       bld Gas8 5g3  in                          st67b21.5p                                                                                                                                                                                                                               GCTCAGCCGGTGCTGTTCGGTTCGTACCGCCGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCACGACCCCTCGAACTTCCTGCACTCTACGGGCAGCCCCCCGGTCTATGTGCCGACTAGTCGGATGCCGGCCATGCTACAGTCGCTCCCCTACCTACAGAGCTGCGACACTGCCCACCAGGGCCACCATCTGGGCAACCACCCGGGCTGGGCACAGACTGCCAACGAGAGCCACACGTTCAATGCCAGCAGCCCCCACACCCCCAGCGGATTCCCTTACTCGCACAGCCCCCCTGTGGGCAACGCCAGTGCCAGGGAAGGTGCCTACCAGAGCCCCCTGATCATGGGCAGCAGTGCCAGGGACCAGTATGGCAACTCCCTGGTGCGCACCGGCTCCTACCCCAGCCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACAGCCTGCAGGGGAGGCAGCCCTTACCGGGTAGGAGATCCAGCCTGGAGTTCCTAGAAGAGTTTCATGGTGAGGGAAGAGAATGCGTCAACTGTGGGGCTATGTCTACCCCTCTGTGGAGACGAGATGGAACGGGCCACTACCTGTGCAATGCCTGCGG
  5   1   2       bld Gas8 5g3  in                          st70b21.5p                                                                                                                                                                                                                               GCTCAGCCGGTGCTGTTCGGTTCGTACCGCCGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCACGACCCCTCGAACTTCCTGCACTCTACGGGCAGCCCCCCGGTCTATGTGCCGACTAGTCGGATGCCGGCCATGCTACAGTCGCTCCCCTACCTACAGAGCTGCGACACTGCCCACCAGGGCCACCATCTGGGCAACCACCCGGGCTGGGCACAGACTGCCAACGAGAGCCACACGTTCAATGCCAGCAGCCCCCACACCCCCAGCGGATTCCCTTACTCGCACAGCCCCCCTGTGGGCAACGCCAGTGCCAGGGAAGGTGCCTACCAGAGCCCCCTGATCATGGGCAGCAGTGCCAGGGACCAGTATGGCAACTCCCTGGTGCGCACCGGCTCCTACCCCAGCCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACAGCCTGCAGGGGAGGCAGCCCTTACCGGGTAGGAGATCCAGCCTGGAGTTCCTAGAAGAGTTTCATGGTGAGGGAAGAGAATGCGTCAACTGTGGGGCTATGTCTACCCCTCTGTGGAGACGAGATGGAACGGGCCACTACCTGTG
  5   1   2       bld Gas8 5g3  in                          st68b21.5p                                                                                                                                                                                                                                     CCGGTGCTGTTCGGTTCGTACCGCCGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCACGACCCCTCGAACTTCCTGCACTCTACGGGCAGCCCCCCGGTCTATGTGCCGACTAGTCGGATGCCGGCCATGCTACAGTCGCTCCCCTACCTACAGAGCTGCGACACTGCCCACCAGGGCCACCATCTGGGCAACCACCCGGGCTGGGCACAGACTGCCAACGAGAGCCACACGTTCAATGCCAGCAGCCCCCACACCCCCAGCGGATTCCCTTACTCGCACAGCCCCCCTGTGGGCAACGCCAGTGCCAGGGAAGGTGCCTACCAGAGCCCCCTGATCATGGGCAGCAGTGCCAGGGACCAGTATGGCAACTCCCTGGTGCGCACCGGCTCCTACCCCAGCCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACAGCCTGCAGGGGAGGCAGCCCTTACCGGGTAGGAGATCCAGCCTGGAGTTCCTAGAAGAGTTTCATGGTGAGGGAAGAGAATGCGTCAACTGTGGGGCTATGTCTACCCCTCTGTGGAGACGAGATGGAACGGGCCACTACCTGTGCAATGCCTGCGGGCTGTACCATA
  5   1   2       bld Gas8 5g3  in                          st78b21.5p                                                                                                                                                                                                                                       GGTGCTGTTCGGTTCGTACCGCCGGATCATGTACCCCAGCCTGGCCCTCACTGNCAACCATGCCCAGCCGGCCTACTCCCACGACCCCTCGAACTTCCTGCACTCTACGGGCAGCCCCCCGGTCTATGTGCCGACTAGTCGGATGCCGGCCATGCTACAGTCGCTCCCCTACCTACAGAGCTGCGACACTGCCCACCAGGGCCACCATCTGGGCAACCACCCGGGCTGGGCACAGACTGCCAACGAGAGCCACACGTTCAATGCCAGCAGCCCCCACACCCNCAGCGGATTCCCTTACTCGCACAGCCCCCCTGTGGGCAACGCCAGTGCCAGGGAAGGTGCCTACCAGAGCCCCCTGATCATGGGCAGCAGTGCCAGGGACCAGTATGGNAACTCCCTGGTGCGCACCGGCTCCTANCCNANCCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACAGCCTGCAGGGGAGGCAGCCCTTACCGGGTAGGAGATCCAGCCTGGAGTTCCTAGAAGAGTTTCATGGTGAGGGAAGAGAATGCGTCAACTGTGGGGCTATGTCTACCCCTCTGTGGAGACGAGATGGAACGGGCCACTACCTGTGCAATGCCTGCGGGCTGTACCATAAAATGAATG
  5   1   2       bld Gas8 5g3  in                          st79b21.5p                                                                                                                                                                                                                                        GTGCTGTTCGGTTCGTACCGCCGGATCATGTACCCCAGCCTGGCCCTCACTGNCAACCATGCCCAGNCGGCCTACTCCCACGACCCCTCGAACTTCCTGCACTCTACGGNCAGCCCCCCGGTCTATGTGCCGACTAGTCGGATGCCGGCCATGCTACAGTCGCTCCCCTACCTACAGAGCTGCGACACTGCCCACCAGGGCCACCATCTGGGCAACCACCCGGGCTGGGCACAGACTGCCAACGAGAGCCACACGTTCAATGCCAGCANCCCCCACACCCCCAGCGGATTCCCTTACTCGCACAGCCCCCCTGTGGGCAACGCCAGTGCCAGGGAAGGTGCCTACCAGAGCCCCCTGATCATGGGCAGCAGTGCCAGGGACCAGTATGGNAACTCCCTGGTGCGCACCGGNTCCTACCCCAACCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACANCCTGCAGGGGAGGCAGCCCTTACCGGGTAGGAGATCCAGCCTGGAGTTCCTAGAAGAGTTTCATGGTGAGGGAAGAGAATGCGTCAACTGTGGGGCTATGTCTACCCCTCTGTGGAGACGAGATGGAACGGGCCACTACCTGTGCAATGCCTGCGGGCTGTACCATA
  5   1   2       bld Gas8 5g3  in                          st66b21.5p                                                                                                                                                                                                                                           CTGTTCGGTTCGTACCGCCGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCACGACCCCTCGAACTTCCTGCACTCTACGGGCAGCCCCCCGGTCTATGTGCCGACTAGTCGGATGCCGGCCATGCTACAGTCGCTCCCCTACCTACAGAGCTGCGACACTGCCCACCAGGGCCACCATCTGGGCAACCACCCGGGCTGGGCACAGACTGCCAACGAGAGCCACACGTTCAATGCCAGCAGCCCCCACACCCCCAGCGGATTCCCTTACTCGCACAGCCCCCCTGTGGGCAACGCCNGTGCCAGGGAAGGTGCCTACCAGAGCCCCCTGATCATGGGCAGCAGTGCCAGGGACCAGTATGGCAACTCCCTGGTGCGCACCGGCTCCTACCCCAGCCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACAGCCTGCAGGGGAGGCAGCCCTTACCGGGTAGGAGATCCAGCCTGGAGTTCCTAGAAGAGTTTCATGGTGAGGGAAGAGAATGCGTCAACTGTGGGGCTATGTCTACCCCTCTGTGGAGACGAGATGGAACGGGCCACTACCTGT
  5   1   2       bld Gas8 5g3  in                          st69b21.5p                                                                                                                                                                                                                                           CTGTTCGGTTCGTACCGCCGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCACGACCCCTCGAACTTCCTGCACTCTACGGGCAGCCCCCCGGTCTATGTGCCGACTAGTCGGATGCCGGCCATGCTACAGTCGCTCCCCTACCTACAGAGCTGCGACACTGCCCACCAGGGCCACCATCTGGGCAACCACCCGGGCTGGGCACAGACTGCCAACGAGAGCCACACGTTCAATGCCAGCAGCCCCCACACCCCCAGCGGATTCCCTTACTCGCACAGCCCCCCTGTGGGCAACGCCAGTGCCAGGGAAGGTGCCTACCAGAGCCCCCTGATCATGGGCAGCAGTGCCAGGGACCAGTATGGCAACTCCCTGGTGCGCACCGGCTCCTACCCCAGCCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACAGCCTGCAGGGGAGGCAGCCCTTACCGGGTAGGAGATCCAGCCTGGAGTTCCTAGAAGAGTTTCATGGTGAGGGAAGAGAATGCGTCAACTGTGGGGCTATGTCTACCCCTCTGTGGAGACGAGATGGAACGGGCCACTACCTGTGCAATGCCTGCGGGCTGTACCATA
  5   1   2       bld In66                            IMAGE:8963533.5p                                                                                                                                                                                                                                                                                                                                       TGTCACTTCTACGGGCAGCCCCCCGGTCTATGTGCCGACTAGTCGGATGCCGGCCATGCTACAGTCGCTCCCCTACCTACAGAGCTGCGACACTGCCCACCAGGGCCACCATCTGGGCAACCACCCGGGCTGGGCACAGACTGCCAACGAGAGCCACACGTTCAATGCCAGCAGCCCCCACACCCCCAGCGGATTCCCTTACTCGCACAGCCCCCCTGTGGGCAACGCCAGTGCCAGGGAAGGTGCCTACCAGAGCCCCCTGATCATGGGCAGCAGTGCCAGGGACCAGTATGGCAACTCCCTGGTGCGCACCGGCTCCTACCCCAGCCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACAGCCTGCAGGGGAGGCAGCCCTTACCGGGTAGGAGATCCAGCCTGGAGTTCCTAGAAGAGTTTCATGGTGAGGGAAGAGAATGCGTCAACTGTGGGGCTATGTCTACCCCTCTGTGGAGACGAGATGGAACGGGCCACTACCTGTGCAATGCCTGCGGGCTGTACCATAAAATGAATGGCATCAACAGACCCCTAATCAAACCACAGAAAAGGCTGTCCTCCTCCCGGCGGGCCGGCCTTTGCTGCACTAACTGTCACACCAGCACCACAACCCTGTGGAGGCGCAACTCGGAGGGGGAGCCGGTGTGTACGCTTGTGGCTGTACATGAACTACATGGGGTACCTCGGGCTCTGCCATGAGAAGAAGTATCAGACCCGGAAAGAGCAAAAATGTTCAGTAAAGAGACTTCCACAGCTCGACTCGCACACTCCCGTCTTCAGTACAATCGATCCGACGCCCCGTGTTAAACAGAACCCAATAATCGCAAT
  5   1   2       bld Tad5      in                         XZT67676.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCCAGCAGCCCCCACACCCCCAGCGGATTCCCTTACTCGCACAGCCCCCCTGTGGGCAACGCCAGTGCCAGGGAAGGTGCCTACCAGAGCCCCCTGATCATGGGCAGCAGTGCCAGGGACCAGTATGGCAACTCCCTGGTGCGCACCGGCTCCTACCCCAGCCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACAGCCTGCAGGGGAGGCAGCCCTTACCGGGTAGGAGATCCAGCCTGGAGTTCCTAGAAGAGTTTCATGGTGAGGGAAGAGAATGCGTCAACTGTGGGGCTATGTCTACCCCTCTGTGGAGACGAGATGGAACGGGCCACTACCTGTGCAATGCCTGCGGGCTGTACCATAAAATGAATGGCATCAACAGACCCCTAATCAAACCACAGAAAAGGCTGTCCTCCTCCCGGCGGGCCGGCCTTTGCTGCACTAACTGTCACACCAGCACCACAACCCTGTGGAGGCGCAACTCGGAGGGGGAGCCGGTGTGTAACGCTTGTGGCCTGTACATGAAACTACATGGGGTACCTCGGCCTCTGGCCATGAAGAAAGAAAGTATTCAGACCCGGAAAAGGAAGCCAAAAAATGTCAGTAAAGGAAAGACTTCCACAGGCTCGACATCGGCCACCAACTCCCCGTCTTCAGTTACAAATTCCGATCCGACGCCCGTGTTAAAAACAGAACCCAATATCGCATCCCAGTACCCGGGTCAGGCAATTGTAGCGGTCTC
  5   1   2       bld In62                            IMAGE:8954386.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGGAACCAGTATGGCAACTCCCTGGTGCGCACCGGCTCCTACCCCAGCCCCTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGCAGCATGTTGCACAGCCTGCAGGGGAGGCAGCCCTTACCGGGTAGGAGATCCAGCCTGGAGTTCCTAGAAGAGTTTCATGGTGAGGGAAGAGAATGCGTCAACTGTGGGGCTATGTCTACCCCTCTGTGGAGACGAGATGGAACGGGCCACTACCTGTGCAATGCCTGCGGGCTGTACCATAAAATGAATGGCATCAACAGACCCCTAATCAAACCACAGAAAAGGCTGTCCTCCTCCCGGCGGGCCGGCCTTTGCTGCACTAACTGTCACACCAGCACCACAACCCTGTGGAGGCGCAACTCGGAGGGGGAGCCGGTGTGTAACGCTTGTGGCCTGTACATGAAACTACATGGGGTACCTCGGCCTCTGGCCATGAAGAAAGAAAGTATTCAGACCCGGAAAAGGAAGCCAAAAAATGTCAGTAAGGAAAGACTTCCACAGGCTCGACATCGGCCACCAACTCCCCGTCTTCAGTTACAAATTCCGATCCGACGCCCGTGTTAAAAACAGACCCAATATCGCATCCCAGTACCCGGGTCAGGCATTGTAGCGGTCTCCCAGGGCGAGCAACGGACGATCTGTCACGGGTCCACGAGCTGAGTTATCCAGAGATACGCTACGCCCACCGCTCTGACATCAGACTGACGTCCTTAGCCAGGATCTGGTGCCGCTGCCTCGCTACTGACCAATGGACACAGTCTGGATAACGCTCTGGACATGACCGCTGACCTTGAAGACAAGTCGCCAAGACGATCCGCGCGACTGGCTGAAACCTAATGCACAATCCA
  5   1   2       bld Sto1      in                        CABG12671.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGGGTGGGGCTATGTCTACCCCTCTGTGGAGACGAGATGGAACGGGCCACTACCTGTGCAATGCCTGCGGGCTGTACCATAAAATGAATGGCATCAACAGACCCCTAATCAAACCACAGAAAAGGCTGTCCTCCTCCCGGCGGGCCGGCCTTTGCTGCACTAACTGTCACACCAGCACCACAACCCTGTGGAGGCGCAACTCGGAGGGGGAGCCGGTGTGTAACGCTTGTGGCCTGTACATGAAACTACATGGGGTACCTCGGCCTCTGGCCATGAAGAAAGAAAGTATTCAGACCCGGAAAAGGAAGCCAAAAAATGTCAGTAAAGGAAAGACTTCCACAGGCTCGACATCGGCCACCAACTCCCCGTCTTCAGTTACAAATTCCGATCCGACGCCCGTGTTAAAAACAGAACCCAATATCGCATCCCAGTACCCGGGTCAGGCAATTGTAGCGGTCTCCCAGGGGCAGAGCCAAACGGACGATCTGGTCAACGGGTCCCACGAGCTGAAGTTTATCCCAGAGGAATACGCCTACAGCCCCACCGCTCTGAGCCAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGAT
  5   1   2       bld In60                            IMAGE:8950543.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTTAGGAAAATTCAACGGATAAGAGCGATTCTGTATTCGTCCCCAGTCCTCCTCCCGGCGGGCCGGCCTTTGCTGCACTAACTGTCACACCAGCACCACAACCCTGTGGAGGCGCAACTCGGAGGGGGAGCCGGTGTGTAACGCTTGTGGCCTGTACATGAAACTACATGGGGTACCTCGGCCTCTGGCCATGAAGAAAGAAAGTATTCAGACCCGGAAAAGGAAGCCAAAAAATGTCAGTAAAGGAAAGACTTCCACAGGCTCGACATCGGCCACCAACTCCCCGTCTTCAGTTACAAATTCCGATCCGACGCCCGTGTTAAAAACAGAACCCAATATCGCATCCCAGTACCCGGGTCAGGCAATTGTAGCGGTCTCCCAGGGGCAGAGCCAAACGGACGATCTGGTCAACGGGTCCCACGAGCTGAAGTTTATCCCAGAGGAATACGCCTACAGCCCCACCGCTCTGAGCCAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGACCGGATCCGCCGCCGTAATCCTTGCGCTGGGAAGCCACCGAATGGCATCAACTTTTCTCTATGTGAACGAAAACGGACTTATCTTG
  5   1   2       bld Te1       in                         CBWN7274.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAAAGGCTGTCCTCCTCCCGGCGGGCCGGCCTTTGCTGCACTAACTGCCACACCAGCACCACAACCCTGTGGAGGCGCAACTCGGAGGGGGAGCCGGTGTGTAACGCTTGTGGCCTGTACATGAAACTACATGGGGTACCTCGGCCTCTGGCCATGAAGAAAGAAAGTATTCAGACCCGGAAAAGGAAGCCAAAAAATGTCAGTAAAGGAAAGACTTCCACAGGCTCAACATCGGCCACCAACTCCCCGTCTTCAGTTACAAATTCCGATCCGACGCCCGTGTTAAAAACAGAACCCAACATCGCATCCCAGTACCCGGGCCAGGCAATTGTAGCGGTCTCCCAGGGGCAGAGTCAAACGGACGATCTGGTCAACGGGTCCCACGAGCTGAAGTTTATCCCAGAGGAATACGCCTACAGCCCCACCGCTCTGAGCCAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGATGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAG
  5   1   2       bld Sto1      in                        CABG12031.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATGAAGAAAGAAAGTATTCAGACCCGGAAAAGGAAGCCAAAAAATGTCAGTAAAGGAAAGACTTCCACAGGCTCGACATCGGCCACCAACTCCCCGTCTTCAGTTACAAATTCCGATCCGACGCCCGTGTTAAAAACAGAACCCAATATCGCATCCCAGTACCCGGGTCAGGCAATTGTAGCGGTCTCCCAGGGGCAGAGCCAAACGGACGATCTGGTCAACGGGTCCCACGAGCTGAAGTTTATCCCAGAGGAATACGCCTACAGCCCCACCGCTCTGAGCCAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTATCTCCAAAATGGCTTCATTGGTCTCTGCGTTTCA
  3  -1   2       bld Int1      in                         CAAP7363.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGACCCGGAAAAGGAAGCCAAAAAATGTCAGTAAAGGAAAGACTTCCACAGGCTCAACATCGGCCACCAACTCCCCGTCTTCAGTTACAAATTCCGATCCGACGCCCGTGTTAAAAACAGAACCCAACATCGCATCCCAGTACCCGGGCCAGGCAATTGTAGCGGTCTCCCAGGGGCAGAGCCAAACGGACGATCTGGTCAACGGGTCCCACGAGCTGAAGTTTATCCCAGAGGAATACGCCTACAGCCCCACCGCTCTGAGCCAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGATGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTGTTTCTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGATGCTACCGTCCC
  5   1   2       bld Tad5      in                         XZT50020.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTCCACAGGCTCAACATCGGCCACCAACTCCCCGTCTTCAGTTACAAATTCCGATCCGACGCCCGTGTTAAAAACAGAACCCAACATCGCATCCCAGTACCCGGGCCAGGCAATTGTAGCGGTCTCCCAGGGGCAGAGCCAAACGGACGATCTGGTCAACGGGTCCCACGAGCTGAAGTTTATCCCAGAGGAATACGCCTACAGCCCCACCGCTCTGAGCCAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGATGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTGTTTCTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGATGCTACCGTCCCCTCGTGTAATATGTTCCCTGTCTGACTACC
  5  -1   2       bld Int1      in                         CAAP7363.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTTACAAATTCCGATCCGACGCCCGTGTTAAAAACAGAACCCAACATCGCATCCCAGTACCCGGGCCAGGCAATTGTAGCGGTCTCCCAGGGGCAGAGCCAAACGGACGATCTGGTCAACGGGTCCCACGAGCTGAAGTTTATCCCAGAGGAATACGCCTACAGCCCCACCGCTCTGAGCCAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGATGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTGTTTCTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGATGCTACCGTCCCCTCGTGTAATATGTTCCCTGTCTGACTACCTTTTTA
  3   1   2       bld Sto1      in                        CABG12671.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCAGTACCCGGGTCAGGCAATTGTAGCGGTCTCCCAGGGGCAGAGCCAAACGGACGATCTGGTCAACGGGTCNCACGAGCTGAAGTTTATCCCAGAGGAATACGCCTACAGCCCCACCGCTCTGAGCCAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCTGTCTGACTACCTTTTTAGTGCAATTTGTTTCACATCTAATAAAGAGTGATAATGGT
  3   1   2       bld Sto1      in                        CABG12031.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGGGCAGAGCCAAACGGACGATCTGGTCAACGGGTCCCACGAGCTGAAGTTATCCCAGAGGAATACGCCTACAGCCCCACCGCTCTGAGCCAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCTGTCTGACTACCTTTTTAGTGCAATTTGTTTCACATCTAATAAAGAGTGATAATGTGTCACCGAGTATAAAAATATATTTTATTAAAATCTTATTACAGTTAAAAAAAA
  3   1   2       bld Gas8      ?                           st72b21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACGAGCTGAAGTTTATCCCAGAGGAATACGCNTACAGCCCCACCGCTTTGAGCCAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCTGTCTGACTACCTTTTTAGTGCAATTTGTTTCACATCTAATAAAGAGTGATAATGGTCACCGA
  3   1   2       bld Gas8 5g3  in                          st62b21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCCAGAGGAATACGCCTACAGCCCCACCGCTTTGAGCCAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCNGTCNGACCTACCTTTTTAGTGCAATTTGTTTCACATCTAATAAAGAGTGATA
  3   1   2       bld Sto1      in                        CABG10508.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCAGAGGAATACGCCTACAGCCCCACCGCTCTGAGCCAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCGATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCTGTCTGACTACCTTTTTAGTGCAATTTGTTTCACATCTAATAAAGAGTGATAATGTGTCACCGAGTATAAAAATATATTTTATTAAAATCTTATTACAGTGGAAAAAA
  5   1   2       bld Sto1      in                        CABG10508.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCAGAGGAATACGCCTACAGCCCCACCGCTCTGAGCCAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCGATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCTGTCTGACTACCTTTTTAGTGCAATTTGTTTCACATCTAATAAAGAGTGATAATGTGTCACCGAGTATAAAAATATATTTTATTAAAATCTTATTACAGTTGGAAAAAA
  3   1   2       bld Gas8 5g3  in                          st66b21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCAGAGGAATACGCCTACAGCCCCACCGCTTTGAGCCCATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCTGTCTGACTACCTTTTTAGTGCAATTTGTTTCACATCTAATAAAGAGTGATAATG
  3   1   2       bld Gas8 5g3  in                          st60b21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAATACGCCTACAGCCCCACCGNTTTGAGCCAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCNGTCNGACTACCTTTTTAGTGCAATTTGTTTCACATCNAATAAAGAG
  3   1   2       bld Gas8 5g3  in                          st63b21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAATACGCCTACAGCCCCACCGCTTTGAGCCAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCTGTCTGACTACCTTTTTAGTGCAATTTGTTTCACATCTAATAAAGAGTGATAAT
  3   1   2       bld Gas8 5g3  in                          st67b21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATACGCCTACAGCCCCACCGNTNTGAGCCAATCAGGACTGAACGTTCCCNTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCNGTCNGACTACCTTTTTAGTGCAAT
  3   1   2       bld Gas7      in                         XZG38425.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCACGCGTCCGCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCTGTCTGACTACCCTTTTAGTGCAATTTGTTTCACATCTAATAAAGAGTGATAATGTGTCACCGAGTATAAAAATATATTTTATTAAAATCTTATTACAGTTGG
  3   1   2       bld Te1       in                         CBWN7274.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAGCCAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGATGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTGTTTCTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCTGTCTGACTACCTTTTTAGTGCAATTTGTTTCACATCTAATAAAGAGTGATAATGTGTCACCGAGTATAAAAATATATTTTATTAAAATCTTAAAAAAAAAAAAAAA
  3   1   2      seed Tad5      in                         XZT67676.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGCCAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCTGTCTGACTACCTTTTTAGTGCAATTTGTTTCACATCTAATAAAGAGTGATAATGTGTCACCGAGTATAAAAATATATTTTATTAAAATCTTATTACAGTTGG
  3   1   2       bld Gas8 5g3  in                          st68b21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGCCAATCAGGACTGAACGTTCCCNTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCTGTCTGACTACCTTTNTAGTGCAATTTGTTTCACATCTAATAAAGAGTG
  3   1   2       bld Gas8 5g3  in                          st70b21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGCCAATCAGGACTGAACGTTCCCNTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCTGTCTGACTACCTTTTTAGTGCAATTTGTTTCACATCTAATAAAGAGTGATAATG
  3   1   2       bld TbA  5g3  in                    TTbA078p04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATTTTGGGTTTTTGACGATTTTTCGCATTTTTGGGGAGAGGAAGGAGCATTGTTTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGGGGGGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATTTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTTGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAAAGGCTTCATTGGTCTTTGCGTTTCACAGAGAACGTCAAGATATTTTTTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCTGTCTGACTACCTTTTTAGTGCAATTTGTTTCACATCTAATAAAGAGGGATAATGTGTCCCCGAGTATAAAAATATATTTTATTAAAATCTTATTACAGGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Gas8 5g3  in                          st69b21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATCAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCTGTCTGACTACCTTTTTAGTGCAATTTGTTTCACATCTAATAAAGAGTGATAATGGTCACCGAG
  5   1   2       bld Gas7      in                         XZG38425.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGGACTGAACGTTCCCCTACGCCAGGAGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCTGTCTGACTACCCTTTTAGTGCAATTTGTTTCACATCTAATAAAGAGTGATAATGTGTCACCGAGTATAAAAATATATTTTATTAAAATCTTATTACAGTTGGAAAAAAAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas8 5g3  in                          st78b21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTCATGGTGCGCGCTGGCACTCGCCTAAACCTGAACCCAATGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCNTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTACCCTGTCTGACTACCTTTTTAGTGCAATTTGTTTCACATCTAATAAAGAGTGATAATG
  3   1   2       bld Tad5      in                         XZT50020.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCACTCGCCTAAACCTGAACCCAATGGGGGACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCCCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCCCCGAATGGCAACGACTTTCCCTATTGGATGAAACGGACGTATTTTGGGTTTTTGACGATTTTTCGCATTTTTGGGGAGAGGAAGGAGCATTGTTTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGGGGGGATTTTAACCTCTTGTTTCTTGGAATCCTCCCGACGTTTCGGCAAAACCATTTGTTCCAACACCGAAACTCCTCCAGGGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTTGGCCTGGTCCCGCCCCAGTTTTAATACAGGGCCCCCCCTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAAAGGCTTCATTGGTCTTTGGGTTTCACAGAGAACGTCAAGATATTTTTTTAAGATGCTACCGTCCCCTCGTGTAATATGTTCCCTGTCTGACTACCTTTTTAGGGCAATTTGTTTCCCATTTAATAAAGAGGGATAATGGGTCCCCGGGTATAAAAATATATTTTATTAAAATCTTATTCCAGTTGGG
  3   1   2       bld TbA  5g3  in                    TTbA076e15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGAACCCCAATGGGGACACAACGAGGTTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCCTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAACGGATCCGCCGCCGTAATCCTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATTTTGGGTTTTTGACGATTTTTTGCATTTTTGGGGAGAGGAAGGAGCATTGTTTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGGGGGGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATTTGTTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTTGGCCTGGTCACGCCCCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATTTCCAAAAAAGGGTTCATTGGTTTTTGCGTTTCACAGAGAACGTCAAGATATTTTTTTAAGACGCTACCGTCCCCTCGTGTAATATGTTCCCTGTTTGACTACCTTTTTAGTGCAATTTGTTTCACATCTAATAAAGAGTGATAATGTGTCCCCGAGTATAAAAATATATTTTATTAAAATTTTATTACAGTGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Gas8 5g3  in                          st79b21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GACACAACGAGGTCCGTGGGTTTAGCAGCTCCTGGGAGCAGAGAGGGCACCGCCTGACGCTTTATGAAGGACACAAGGTGCCGCGCCCAGAGGAANGGATCCGCCGCNGTAATCNTGCGCTGGGAAGCCACCGAATGGCAACGACTTTCCCTATTGGACGAAACGGACGTATCTTGGGTTTCTGACGATTCTTCGCATTTCTGGGGAGAGGAAGGAGCATTGTCTCCATGGCAACTTCCATGGAAGGACTCAGTTGGGGGGCCAAGCTGCCAATCAAACCAGGGGCGGTGATTTTAACCTCTTATTTTTTGGAATCCTCCCGACGTTACGGCAAAACCATCTGCTCCAACACCGAAACTCCTCCAGCGACAATGAGGGGAATCCGTGGAGCCAATAAGGACTCGGCCTGGTCACGCACCAGTTATAATACAGGGCACACACTTTGGGCTTTTGGGTTTTTTTATCTCCAAAAATGGCTTCATTGGTCTCTGCGTTTCACAGAGAACGTCAAGATATTTTCTTAAGACGCTACCGTCCCCTCGTGTAATATGTTACCCTGTCTGACTACCTTTTTAGTGCAATNTGTTTCACATCTAATAAAGAGTGATAA
  3   1   2       add TbA  5g3  in                    TTbA046n13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTGTTTCCATGGCAATTCCATGGGAAGGACTCAGTTGGGGGGGCCAAGCTGCCAATCAAACCAGGGGGCAGTGATTTTAACTTCTGGTTTCTTGGAATCCTCCCGACGGTTACGGCAAAACCTTTGGTTCCAACACCGAAAATTCTTCCAGGGGACA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)