Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 19 Jun 2019 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABH802.3.5                          51 END     1           1        1                Hypothetical protein MGC146202 [Xenopus tropicalis]
     2   2.0    0Xt7.1-XZG50435.5.5                         46 END     1           1        2                MGC80897 protein [Xenopus laevis]
     3   2.0    0Xt7.1-CAAN7313.3                            2 END     1           1       50                DDHD domain containing 1 isoform 3 [Mus musculus]

 This cluster: approximate FL confidence score = 95%

 1012075213 Xt7.1-TNeu114p13.3 - 60 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     3     3     8     8    20    23    21    24    22    25    23    25    24    25    24    25    24    25    24    25    24    25    24    25    24    25    24    25    24    25    23    25    23    25    23    25    23    24    23    24    23    24    23    24    23    24    23    24    23    24    23    24    23    24    23    25    23    25    23    25    23    25    23    25    23    25    22    24    22    24    22    24    21    23    21    23    21    23    21    23    21    23    21    23    21    23    21    23    21    23    20    23    21    23    20    23    19    23    19    23    19    22    20    23    18    21    17    20    17    20    18    20    17    19    16    17    15    17    13    15    13    15    12    15    12    15    12    15    12    15    11    14    11    14    11    14     9    12    10    12     6     8     6    10     6    10     5     8     5     8     5     7     6     8     5     7     6     7     5     7     4     7     5     8     6     7     6     8     7     9     7     9     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     8    10     8    10     9    10     8     9     8     9     9    10    10    11    11    12    11    12    12    14    14    16    15    17    15    17    15    17    15    17    15    17    15    18    16    18    14    18    16    18    19    19    18    18    19    19    19    20    19    20    19    20    20    21    20    21    21    23    21    23    21    23    21    23    21    23    22    25    22    25    21    24    26    27    27    27    26    26    24    26    24    24    23    23    23    23    23    23    23    23    23    23    21    23    22    23    23    23    23    23    23    23    23    23    23    23    23    23    21    23    21    23    19    23    23    25    21    24    24    24    22    24    23    24    24    24    20    24    23    24    24    24    24    24    24    24    22    24    24    24    23    23    21    21    20    20    19    19    18    19     8    11     7     7
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -T--------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --T---------
                                               BLH ATG      86    1133                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      86     199                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      86      87                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               CDS MIN      86      59                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI      27      59                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      86       8                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Sc ---- 1e-013     NP_010225.1 involved intracellular protein transport, coiled-coil protein necessary forprotein transport from ER to Golgi; Uso1p [Saccharomyces cerevisiae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Sp ---- 5e-040     NP_999665.1 nuclear intermediate filament protein [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 3e-044     NP_001076764.1 Intermediate Filament, A family member (ifa-1) [Caenorhabditis elegans] --------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Dm ==== 2e-046     NP_476616.1 CG6944-PA [Drosophila melanogaster] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Bf ---- 2e-065     CAA11447.1 intermediate filament protein B1 [Branchiostoma floridae] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Br ---- 8e-066     CAA45827.1 cytoplasmic intermediate filament protein [Branchiostoma lanceolatum] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ci ---- 3e-085     CAC24550.1 intermediate filament protein IF-A [Ciona intestinalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Gg ==== 2e-141     NP_001041541.1 vimentin [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Dr ==== 2e-154     NP_571129.1 plasticin [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Mm ---= 5e-175     NP_038667.1 peripherin 1; peripherin [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Hs ==== 6e-179     NP_006253.2 peripherin; neurofilament 4 (57kD) [Homo sapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Xl ==== 0          AAH45209.1 similar to peripherin [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === ?? ==== 0          NP_001080529.1 peripherin [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Xt ==== 0          NP_001001235.1 hypothetical protein MGC69454 [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TNeu114p13.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAA------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------ATG------------------------------------------------------------------------ATG---------ATG------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------TAGATG---TAA---TAA------------------------TGA------ATG------------------------------------------------------------------------------------------------------------------------TAA---------------------TAG---------------------------TAA------ATG---ATG------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------TAG---------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  5   1   2       bld Tbd0 FL   in                    IMAGE:5335951.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACTCTCAGACTTTCCTCTCAGCATCACTCAAAGAATCAGGTATCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGGGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCAACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGTGGAGAGGGACAACCTCGCTGAAGACCTTGCTTTTCTGAAGCAAAGGCTGGATGAAGAGGTTCACAAGCGGGAAGATGCAGAGAATAAT
  5   1   2   20  bld Eye  5g                              CCAX3451.b1 ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CACTCTCAGACTTTCCTCTCAGCATCACTCAAAGAATCAGGTATCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGCGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGTGGAGAGGGACAACCTCGCTGAAGACCTTGCTTTTCTGAAGCAAAGGCTGGATGAAGAGGTTCACAAGCGGGAAGATGCA
  5   1   2       bld BrSp 5g3  in                     EC2BBA35DD05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGTCCTCTCAGCATCACTCAAAGAATCAGGTATCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGGGTGGACTTCTCGGTGGCTGAGGCTGTCCACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCT
  5   1   2       bld 1030 5g                         IMAGE:7091397.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCTCTCAGCATCACTCAAAGAATCAGGTATCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGCGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGTGGAGAGGGACNACCTCGCTGAAGACTTGCTTTTCTGAAGCAAGGCTGGATGAAGAGGTCACAAGCGGGAGATGCAGAAATATCTAAGTTTGTTAGAAGGATGTGATGATGCACA
  5   1   2       bld 1030 5g                         IMAGE:7029007.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGCATCACTCAAAGAATCAGGTATCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGCGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGGACCGCATCCAGGTGGAGAGGGACAACCTCGCTGAAGACCTTGCTTTTCTGAAGCANAGGCTGGATGAAGAGGTTCACAACCGGGAAGATGCAAAGAATAATCTAGTTTTGTTTAGAAAGGATGGGGATGATGCCCACCCTGTCTCGCCTGGAACCTGGGAGAGGAAAAATTTGAGTCTTTTGAGGGATGAAAATTGAATTTTCTGAAAAAACCTTTTCTGAGGGAGGGAAATCACATGGAGGTAACAACTA
  5   1   2       bld TbA  5g                        TTbA054p07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATCACTCAAAGAATCAGGTATCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGCGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGTGGAGAGGGACAACCTCGCTGAAGACCTTGCTTTTCTGAAGCAAAGGCTGGATGAAGAGGTTCACAAGCGGGAAGATGCAGAGAATAATCTAGTTTTGTTTAGAAAGGATGTGGATGATGCCACACTGTCTCGCCTGGAGCTGGAGAGGAAGATTGAGTCTTTGATGGATGAAATTGAATTTCTGAAGAAGCTTCATGAGGAGGAACTCAATGATGTACAAGTGACAGTACAGGCACAGCCAATACACATGGAAATTGAAGCTGCTAAACAGCCCGACCTGACCTCTGCACTG
  5   1   2   10  bld Tbd1 5g3  in                         CBXT9115.b1 ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCACTCAAAGAATCAGGTATCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGGGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGTGGAGAGGGACAACCTCGCTGAAGACCTTGCTTTTCTGAAGCAAAGGCTGGATGAAGAGGTTCACAAGCGGGAAGATGCAGAGAATAATCTAGTTTTGTTTAGAAAGGATGTGGATGATGCCACACTGTCTCGCCTGGAGCTGGAGAGGAAGATTGAGTCTTTGATGGA
  5   1   2   10  bld Eye  5g3  in                          CCAX848.b1 ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCACTCAAAGAATCAGGTATCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGCGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGTGGAGAGGGACAACCTCGCTGAAGACCTTGCTTTTCTGAAGCAAAGGCTGGATGAAGAGGTTCACAAGCGGGAAGATGCAGAGAATAATCTAGTTTTGTTTAGAAAGGATGTGGATGATGCCACACTGTCTCGCCTGGAGCTGGAGAGGAAGATTGAGTCTTTGATGGA
  5   1   2       bld TpA  5g                        TTpA038a14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCAAGAATCAGGGTATCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGGGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCAACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGTGGAGAGGGACAACCTCGCTGAAGACCTTGCTTTTCTGAAGCAAAGGCTGGATGAAGAGGTTCACAAGCGGGAAGATGCAGAGAATAATCTAGTTTTGTTTAGAAAGGATGTGGATGATGCCACACTGTCTCGCCTGGAGCTGGAGAGGAAGATTGAGTCTTTGATGGATGAAATTGAATTTCTGAAGAAGCTTCATGAGGAGGAACTCAATGATGTACAAGTGACAGTACAGGCACAGCCAATACACATGGAAATTGAAGCTGCTAAACAGCCCGACCTGACCTCTGCACTG
  5   1   2       bld HdA  5x3  in                  THdA025o22.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCAAGAATCAGGTATCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGGGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCAACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGNTGGAGAGGGACAACCTCGCTGAAGACCTTGCTTTTCTGAAGCAAAGGCTGGATGAAGAGGTTCACAAGCGGGAAGATGCAGAGAATAATCTAGTTTTGTTTAGAAAGGATGTGGATGATGCCACACTGTCTCGCCTGGAGCTGGAGAGGAAGATTGAGTCTTTGATGGATGAAATTGAATTTCTGAAGAAGCTTCATGAGGAGGAACTCAATGATGTACAAGTGACAGTACAGGCACAGCCAATACACATGGAAATTGAAGCTGCTAAACAGCCCGACCTGACCTCTGCACTGAGGGACATTCGAAGTCAATATGAGACTATTGCTGC
  5   1   2   12  bld Gas7 5g3  in                         XZG48908.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCAAAGAATCAGGTATCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGGGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCAACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGTGGAGAGGGACAACCTCGCAGAAGACCTTGCTTTTCTGAAGCAAAGGCTGGATGAAGAGGTTCACAAGCGGGAAGATGCAGAGAATAATCTAGTTTTGTTTAGAAAGGATGTGGATGATGCCACACTGTCTCGCCTGGAGCTGGAGAGGAAGATTGAGTCTTTGATGGATGAAATTGAATTTCTGAAGAAGCTTCATGAGGAGGAACTCAATGATGTACAAGTGACACTACAGGCACAGCCAATACACATGGAAATTGAAGCTGCTAAACAGCCCGACCTGACCTCTGCACTGAGGGACATTCGAAGTCAATATGAGACTATTGCTG
  5   1   2       bld In62 5g                         IMAGE:8954067.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTATTTTTCTCCTTTTTCTTTATTTTTTATAAAACGTCCGTATTCCCTTGCTTCATCATTGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGGGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCAACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGTGGAGAGGGACAACCTCGCTGAAGACCTTGCTTTTCTGAAGCAAAGGCTGGATGAAGAGGTTCACAAGCGGGAAGATGCAGAGAATAATCTAGTTTTGTTTAGAAAGGATGTGGATGATGCCACACTGTCTCGCCTGGAGCTGGAGAGGAAGATTTGAGTCTTTGATGGATGAAATTGAATTTCTGAAGAAGCTTCATGAGGAGGAACTCATTGATGTACAAGTGACAGTACAGGCACAGCCAATACACATGGAAAATTGAGCTGCTAAACAGCCTGACCTGACTCTGCACTGAGGACATTCGAAGTCATATGAGACTTTTGCTGCTAGAACTTACAAGAGTTCAGAAGATTGTACAGTTCTAAGTTTGCTGATTCTCCTCGGATGGCGGCACTTCGCACAGTGTAAAGCTTCTGTGCCGCACAAAGCCAAGGCCGAGACAT
  5   1   2   20  bld Eye  5g                              CCAX1605.b1 ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCAAAGAATCAGGTATCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGGCACTTCGGGAAGCCCTTCTCCTGGTCCCCTCCCAGCC
  5   1   2   20  bld Tbd1 5g                             CBXT22236.b1 ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCAAAGAATCAGGTATCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGGGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTTCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGTGGAGAGGGACAACCTCGCTGAAGACCTTGCTTTTTCTGAAGCAAACGCTGGATGAAGAGGT
  5   1   2       bld TbA  5x3  out                  TTbA016k22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAGAATCAGGTATCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGGGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCAACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGTGGAGAGGGACAACCTCGCTGAAGACCTTGCTTTTCTGAAGCAAAGGCTGGATGAAGAGGTTCACAAGCGGGAAGATGCAGAGAATAATCTAGTTTTGTTTAGAAAGGATGTGGATGATGCCACACTGTCTCGCCTGGAGCTGGAGAGGAAGATTGAGTCTTTGATGGATGAAATTGAATTTCTGAAGAAGCTTCATGAGGAGGAACTCAATGATGTACAAGTGACAGTACAGGCACAGCCAATACACATGGAAATTGAAGCTGCTAAACAGCCCGACCTGACCTCTGCACTGAGGGACATTCGAAGTCAATATGAGACTATTGCTGCTAAGAACTTTACAGAGTCAGAAGAGTGGTACAAGTCCAAGTTTGCTGATCTCTC
  5   1   2       bld Tbd0 5g                            IMAGE:6979110                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAGAATCAGGTATCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGGGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCAACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGTGGAGAGGGACAACCTCGCTGAAGACCTTGCTTTTCTGAAGCAAAGGCTGGATGAAGAGGTTCACAAGCGGGAAGATGCAGAGAATAATCTAGTTTTGTTTAGAAAGGATGTGGATGATGCCACACTGTCTCGCCTGGAGCTGGAGAGGAAGATTGAGTCTTTGATGGATGAAATTGATTTCTGAAGAAGCTCATGAGGAGGACTCATGATGTACAGTGACATACAGCACAGCCATAACATGAAATTGAGCTGCAACAGCCGACTGACTN
  5   1   2       bld TbA  5g3  in                   TTbA080k15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAGAATCAGGTATCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGCGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGTGGAGAGGGACAACCTCGCTGAAGACCTTGCTTTTCTGAAGCAAAGGCTGGATGAAGAGGTTCACAAGCGGGAAGATGCAGAGAATAATCTAGTTTTGTTTAGAAAGGATGTGGATGATGCCACACTGTCTCGCCT
  5   1   2   24  bld Brn4 5g   out                       CAAL22171.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAAGAATCAGGTATCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGCGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGTGGAGAGGGACAACCTCGCTGAAGACCTTGCTTTTCTGAAGCAAAGGCTGGATGAAGAGGTTCACAAGCGGGAAGATGCAGAGAATAATCTAGTTTTGTTTAGAAAGGATGTGGATGATGCCACACTGTCTCGCCTGGAGCTGGAGAGGAAGATTGAGTCTTTGATGGATGAAATTGAATTTCTGAAGAAGCTTCATGAGGAGGAACTCAATGATGTACAAGTGACAGTACAGGCACAGCCAATACACATGGAAATTGAAGCTGCTAAACAGCCCGACCTGACCTCTGCACTGAGGGACATT
  5   1   2       bld Neu  5g3  in                   TNeu114p13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGAATCAGGTATCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGGGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAAC
  5   1   2       bld Neu  5g                        TNeu020l17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAGATCAGGTATCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGGGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCAACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGTGGAGAGGGACAACCTCGCAGAAGACCTTGCTTTTCTGAAGCAAAGGCTGGATGAAGAGGTTCACAAGCGGGAAGATGCAGAGAATAATCTAGTTNTGTTTAGAAAGGATGTGGATGATGCCACACTGTCT
  5   1   2   10  bld Tbd1 5g3  in                        CBXT16433.b1 .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGAATCAGGTATCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGCGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGTGGAGAGGGACAACCTCGCTGAAGACCTTGCTTTTCTGAAGCAAAGGCTGGATGAAGAGGTTCACAAGCGGGAAGATGCAGAGAATAATCTAGTTTTGTTTAGAAAGGATGTGGATGATGCCACACTGTCTCGCCTGGAGCTGGAGAGGAAGATTGAGTCTTTGATGGATGAAATTGAATTTCTGAAGAAGCTTCATGAGGAGGAACTCAATGATGTACAAGTGACAGTACAGGCACAGCCAATACACATGGAAATTGAAGCTGCTAAACA
  5   1   2   12  bld Tad5 5g3  in                         XZT68815.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AATCAGGTATCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGCGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGTGGAGAGGGACAACCTCGCTGAAGACCTTGCTTTTCTGAAGCAAAGGCTGGATGAAGAGGTTCACAAGCGGGAAGATGCAGAGAATAATCTAGTTTTGTTTAGAAAGGATGTGGATGATGCCACACTGTCTCGCCTGGAGCTGGAGAGGAAGATTGAGTCTTTGATGGATGAAATTGAATTTCTGAAGAAGCTTCATGAGGAGGAACTCAATGATGTACAAGTGACAGTACAGGCACAGCCAATACACATGGAAAATGAAGCTGCTAAACAGCCCCGACTGACCTCTGCACTGAGGGACATT
  5   1   2       bld In63 5g                         IMAGE:8957532.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGATCTCATTTTTGCTGATTATTTATTATAAAAAAAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGGGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCAACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGTGGAGAGGGACAACCTCGCAGAAGACCTTGCTTTTCTGAAGCAAAGGCTGGATGAAGAGGTTCACAAGCGGGAAGATGCAGAGAATAATCTAGTTTTGTTTAGAAAGGATGTGGATGATGCCACACTGTCTCGCCTGGAGCTGGAGAGGAAGATTGAGTCTTTGATGGATGAAATTGAATTTCTGAAGAAGCTTCATGAGGAGGAACTCAATGATGTACAAGTGACAGTACAGCACAGTCATACACATGGAAATTGAAGCTGCTAACAGCCGACTGACTCTGCACTGAGACATTCGAGTCATATGAACTATGCTGCTAGACCTACAGAGTCAGAAGAGTGTACAAGTTCCAGGTTTGCTGA
  5   1   2       bld Gas8 5g3  in                          st98c11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTCTAATATCCAGCTGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGCGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGTGGAGAGGGACAACCTCGCTGAAGACCTTGCTTTTCTGAAGCAAAGGCTGGATGAAGAGGTTCACAAGCGGGAAGATGCAGAGAATAATCTAGTTTTGTTTAGAAAGGATGTGGATGATGCCACACTGTCTCGCCTGGAGCTG
  5   1   2       bld Gas8 5g3  in                          st97c11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTAGCGCCTGGGAATCCCTTGCTCATCATGAGTCACTCTGGTCTGAGAAGCACCTCCACATCCTACCGCCGCACTTTTGGGGGTCCTCTCCTGTCCCCTGTGTCCTACTCCTCATCCTCCAGGCTATCCACCTCCAGGCACTTCGGAAGCCCTTCTCCTGGTCCCTCCAGCCGCTCATCCTCTTCAGCCTTTAGGGTAAGGTCCAGTACCCCTGTCCGAGTGTCGTTGGACCGCGTGGACTTCTCGGTGGCTGAGGCTGTTAACCAAGAATTCCTGACCACCCGCAGTAATGAGAAAGCTGAACTACAGGAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCCACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGTGGAGAGGGACAACCTCGCTGAAGACCTTGCTTTTCTGAAGCAAAGGCTGGATGAAGAGGTTCACAAGCGGGAAGA
  5   1   2       bld TpA       in                   TTpA052g06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCCCCGCAGTAATGAGAAAGCTGAACTACAGGCAGCTCAATGACCGATTTGCTAGCTTCATAGAAAAAGTCCGCTACCTGGAGCAGCAGAATGCAGTGCTGGTGACTGAGATCAACCAAGCAAGGTCCAAAGAGCCAACCAGGGCTTCAGACCTGTGCCAGCAGGAGCTGAGGGAACTGCGCAGGCAGTTGGAGCTACTGGGCAAGGACAGGGACCGCATCCAGGTGGAGAGGGACAACCTCGCTGAAGACCTTGCTTTTCTGAAGCAAAGGCTGGATGAAGAGGTTCACAAGCGGGAAGATGCAGAGAATAATCTAGTTTTGTTTACAAAGGATGTGGATGATGCCACACTGATCTCGCCTGGAGCTGGAGAGGAAGATTGAGTCTTTGATGGATGAAATTGAATTTCTGAAGAAGCTTCATGAGGAGGAACTCAATGATGTACAAGTGACAGTACAGGCACAGCCAATACACATGGAAATTGAAGCTGCTAAACAGCCTGACCTGACCTCTGCACTGAGGGACATTCGAAGTCAATATGAGACTATTGCTGCTAAGAACTTACAAGAGTCAGAAGAGTGGTACAAGTCCAAGTTTGCTGATCTCTCAGATGCGGCAACTCGCAACAGTGAAGCTCTGACGACAGCCAAGCAGGACATGAATGAATCTCGACGACAGATCCGAAGCCTGACATGTGAGATTGATGGTCT
  5   1   2       bld Gas7      in                         XZG31674.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGAAGAGGTTCACAAGCGGGAAGATGCAGAGAATAATCTAGTTTTGTTTAGAAAGGATGTGGATGATGCCACACTGTCTCGCCTGGAGCTGGAGAGGAAGATTGAGTCTTTGATGGATGAAATTGAATTTCTGAAGAAGCTTCATGAGGAGGAACTCAATGATGTACAAGTGACACTACAGGCACAGCCAATACACATGGAAATTGAAGCTGCTAAACAGCCCGACCTGACCTCTGCACTGAGGGACATTCGAAGTCAATATGAGACTATTGCTGCTAAGAACTTACAAGAGTCAGAAGAGTGGTACAAGTCCAAGTTTGCTGATCTCTCAGATGCGGCAACTCGCAACAGTGAAGCTCTGCGACAAGCCAAGCAGGACATGAATGAATCTCGACGACAGATCCAAAGCCTGACATGTGAGATTGATGGTCTGAAGGGAACAAATGAGGCACTGCTGCGTCAGATGAAAGATATGGAGGAGCAGTTTGGAGTGGAGGCATCTAACTACCAGGACACAATTGGAAGACTGGAGCAAGAAGTGCAGCATATGAAGGAGGAAATGTCACGACATCTGAGGGAGTACCAAGACCTACTGAATGTCAAGATGGCTTTAGATATTGAAATTGCAACTTACAGAAAGCTCCTAGAAGGAGAGGAGAGCAGGATTGCTGTCCCAATTCACTCTCTGACATCTCTCATTATTAAAAGTCCAGCTCCTGAAGTCGATCGCAGCACTGAGGCGCACACCA
  5   1   2       bld Tad5                                 XZT33506.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGATGTGGATGATGCCACACTGTCTCGCCTGGAGCTGGAGAGGAAGATTGAGTCTTTGATGGATGAAATTGAATTTCTGAAGAAGCTTCATGAGGAGGAACTCAATGATGTACAAGTGACAGTACAGGCACAGCCAATACACATGGAAATTGAAGCTGCTAAACAGCCCGACCTGACCTCTGCACTGAGGGACATTCGAAGTCAATATGAGACTATTGCTGCTAAGAACTTACAAGAGTCAGAAGAGTGGTACAAGTCCAAGTTTGCTGATCTCTCAGATGCGGCAACTCGCAACAGTGAAGCTCTGCGACAAGCCAAGCAGGACATGAATGAATCTCGACGACAGATCCAAAGCCTGACATGTGAGATTGATGGTCTGAAGGGAACAAATGAGGCACTGCTGCGTCAGATGAAAGATATGGAGGAGCAGTTTGGAGTGGAGGCATCTAACTACCAGGACACAATTGGAAGACTGGAGCAAGAAGTGCAGCATATGAAGGAGGAAATGTCACGACATCTGAGGGAGTACCAAGACCTACTGAATGTCAAGATGGCTTTAGATATTGAAATTGCAACTTACAGAAAGCTCCTAGAAGGAGAGGAGAGCAGGATTGCTGTCCCAATCCACTCTCTGACATCTCTCAGTATTAAAAGTCCAGCTCCTGAAGTCGATCGCAGCACTGAGGCGCACACCAGAAAAACGGTTGTCATTAAAACTATTGAGACCCGGGATGGAGAGCAGGTTGTCACTGAGTCTCGGAAAGAGCAGTCCTCAGAAGGAGAGAAGTGATCTAGTACGCAGTGCTTGGAGAGACTGATCCAGTTCCCTTGCAATACCTCTTCATGGACGGAAAAACTGTGCTTTTCTAATTTGATGATACTAGGGGTCATC
  5   1   2       bld Tad5      in                         XZT72206.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCGATTCAATTCGTCGACCCACGCGTCCGGCTAAGAACTTACAAGAGTCAGAAGAGTGGTACAAGTCCAAGTTTGCTGATCTCTCAGATGCGGCAACTCGCAACAGTGAAGCTCTGCGACAAGCCAAGCAGGACATGAATGAATCTCGACGACAGATCCAAAGCCTGACATGTGAGATTGATGGTCTGAAGGGAACAAATGAGGCACTGCTGCGTCAGATGAAAGATATGGAGGAGCAGTTTGGAGTGGAGGCATCTAACTACCAGGACACAATTGGAAGACTGGAGCAAGAAGTGCAGCATATGAAGGAGGAAATGTCACGACATCTGAGGGAGTACCAAGACCTACTGAATGTCAAGATGGCTTTAGATATTGAAATTGCAACTTACAGAAAGCTCCTAGAAGGAGAGGAGAGCAGGATTGCTGTCCCAATCCACTCTCTGACATCTCTCAGTATTAAAAGTCCAGCTCCTGAAGTCGATCGCAGCACTGAGGCGCACACCAGAAAAACGGTTGTCATTAAAACTATTGAGACCCGGGATGGAGAGCAGGTTGTCACTGAGTCTCGGAAAGAGCAGTCCTCAGAAGGAGAGAAGTGATCTAGTACGCAGTGCTTGGAGAGACTGATCCAGTTCCCTTGCAATACCTCTCCATGGACGGAAAACCTGTGCTTTTCTAATTGATTGATACTAAGGGTCATCTCCACTAACACACTTCTTTCTCCCACAAAGTGTCCTTGGCATGGCATTTGGTGGCTAAGTTATCATTTATTTGGTGGAAAACCAACTTTCTCTGTGTGCCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTC
  5   1   2       bld Tbd1      in                        CBXT14822.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAAACAAATGATACAAATTTGAATAAAATATTTTCTATTCCCTGTAATAATCATAAAACAGTACCTTGATGGTTCCTATTCTTGCAGCATGATCCAAATTATGGAAATGTTGCATATCTCATACCTGTCTTTTGCACACATCCCTATAAAAGTGATTACCGATGATCATGCCCACCAAAAACATAAAGCAATAAAAAGCCACCCCACTTTTAAACAGGAGGCTCTTAAAGTTAAATCATTGTCATGGGAGTACATGTAACTTTCTGCTTCTTGTCACTTCTCAGCATTATTTCAACAGTAATATATACCATTCTCTAACTGCTTATTGTATCCTTTTTACTATACCTTTTTTAACTAATTGTTGCCACCCTTTTGTTGTGCCAGTACCCCACTCTAAACCACTGTTTTCTTAACCATGACATTATGCAGTATTTACTGTACCTACAATACTCTATGCTTTGTGGCAGCTCCTGAAGTCGATCGCAGCACTGAGGCGCACACCAGAAAAACGGTTGTCATTAAAACTATTGAGACCCGGGATGGAGAGCAGGTTGTCACTGAGTCTCGGAAAGAGCAGTCCTCAGAAGGAGAGAAGTGATCTAGTACGCAGTGCTTGGAGAGACTGATCCAGTTCCCTTGCAATACCTCTCCATGGACGGAAAACCTGTGCTTTTCTAATTGAATGATACTAAGGGTCATCTCCACTAACACACT
  5   1   2       bld Gas7                                 XZG35134.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACAAGTCCAAGTTTGCTGATCTCTCAGATGCGGCAACTCGCAACAGTGAAGCTCTGCGACAAGCCAAGCAGGACATGAATGAATCTCGACGACAGATCCAAAGCCTGACATGTGAGATTGATGGTCTGAAGGGAACAAATGAGGCACTGCTGCGTCAGATGAAAGATATGGAGGAGCAGTTTGGAGTGGAGGCATCTAACTACCAGGACACAATTGGAAGACTGGAGCAAGAAGTGCAGCATATGAAGGAGGAAATGTCACGACATCTGAGGGAGTACCAAGACCTACTGAATGTCAAGATGGCTTTAGATATTGAAATTGCAACTTACAGAAAGCTCCTAGAAGGAGAGGAGAGCAGGATTGCTGTCCCAATCCACTCTCTGACATCTCTCAGTATTAAAAGTCCAGCTCCTGAAGTCGATCGCAGCACTGAGGCGCACACCAGAAAAACGGTTGTCATTAAAACTATTGAGACCCGGGATGGAGAGCAGGTTGTCACTGAGTCTCGGAAAGAGCAGTCCTCAGAAGGAGAGAAGTGATCTAGTACGCAGTGCTTGGAGAGACTGATCCAGTTCCCTTGCAATACCTCTCCATGGACGGAAAACCTGTGCTTTTCTAATTGATTGATACTAAGGGTCATCTCCACTAACACACTTCTTTCTCCCACAAAGTGTCCTTGGCATGGCATTTGGTGGCTAAGTTATCATTTATTTGGTGGAAAACCAACTTTCTCTGTGTGCCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTCCCATTATCCACATATNTAACAGCTATTATTCACCACTGTGGACTAATGTTATAAAAC
  5   1   2       bld Tad5      in                         XZT51496.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGACGCGTGGGCATGAATGAATCTCGACGACAGATCCAAAGCCTGACATGTGAGATTGATGGTCTGAAGGGAACAAATGAGGCACTGCTGCGTCAGATGAAAGATATGGAGGAGCAGTTTGGAGTGGAGGCATCTAACTACCAGGACACAATTGGAAGACTGGAGCAAGAAGTGCAGCATATGAAGGAGGAAATGTCACGACATCTGAGGGAGTACCAAGACCTACTGAATGTCAAGATGGCTTTAGATATTGAAATTGCAACTTACAGAAAGCTCCTAGAAGGAGAGGAGAGCAGGATTGCTGTCCCAATCCACTCTCTGACATCTCTCAGTATTAAAAGTCCAGCTCCTGAAGTCGATCGCAGCACTGAGGCGCACACCAGAAAAACGGTTGTCATTAAAACTATTGAGACCCGGGATGGAGAGCAGGTTGTCACTGAGTCTCGGAAAGAGCAGTCCTCAGAAGGAGAGAAGTGATCTAGTACGCAGTGCTTGGAGAGACTGATCCAGTTCCCTTGCAATACCTCTCCATGGACGGAAAACCTGTGCTTTTCTAATTGATTGATACTAAGGGTCATCTCCACTAACACACTTCTTTCTCCCACAAAGTGTCCTTGGCATGGCATTTGGTGGCTAAGTTATCATTTATTTGGTGGAAAACCAACTTTCTCTGTGTGCCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTCCCATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGGACTTAATGTTATAA
  5   1   2       chi Tbd1      in                        CBXT10109.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCGCCCTTTTTTTTTTTTTTTAATGCACTGGTTGTACCTTTATTGTTAGATTTTTATCACTAACAAGTTTTCAGTGGTGCAAGTTCACCATACACAGAGTTAAATATATTTGCATTGCACATCTAGGCTATACAGCAAATGAATCAGAATTAGTACAAATACATGAGATATTTACATTTTGTATACTCGAGCCAACACACCTGATTATATTTACAAAATAAAACATGAAAATGACAGATAAAATGGGCATTTCTCAGCATTTGTTAATTATGTTTTGAGAATGAATCTTGGTTTCTCAACTTTTTGTTGCAGAATGGAAGTTGCAGTATTTTTAGTCCATAGTATCTTAAAGTAGTCTTCCATAATGCTGAACAATTCTCTGACACATGTGAAATTATTCATTTGGCAGACATTTGTTATTTACCTATTTGTTATTTAAGTCATACTGTGAGTACATAGTTTCACCTATTAACTTCTATAATATATTTTATCAGTCAAACGAGGTTACAGAAATAGCCCATATATTAAACCAAATCATTGCTGCATCTTGTCATCTCCACTAACACACTTCTTTCTCCCACAAAGTGTCCTTGGCATGGCATTTGGTGGCTAAGTTATCATTTATTTGGTGGAAAACCAACTTTCTCTGTGTGCCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTCCCATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAA
  3   1   2       bld Tad5      in                         XZT72206.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACAGATCCAAAGCCTGACATGTGAGATTGATGGTCTGAAGGGAACAAATGAGGCACTGCTGCGTCAGATGAAAGATATGGAGGAGCAGTTTGGAGTGGAGGCATCTAACTACCAGGACACAATTGGAAGACTGGAGCAAGAAGTGCAGCATATGAAGGAGGAAATGTCACGACATCTGAGGGAGTACCAAGACCTACTGAATGTCAAGATGGCTTTAGATATTGAAATTGCAACTTACAGAAAGCTCCTAGAAGGAGAGGAGAGCAGGATTGCTGTCCCAATCCACTCTCTGACATCTCTCAGTATTAAAAGTCCAGCTCCTGAAGTCGATCGCAGCACTGAGGCGCACACCAGAAAAACGGTTGTCATTAAAACTATTGAGACCCGGGATGGAGAGCAGGTTGTCACTGAGTCTCGGAAAGAGCAGTCCTCAGAAGGAGAGAAGTGATCTAGTACGCAGTGCTTGGAGAGACTGATCCAGTTCCCTTGCAATACCTCTCCATGGACGGAAAACCTGTGCTTTTCTAATTGATTGATACTAAGGGTCATCTCCACTAACACACTTCTTTCTCCCACAAAGTGTCCTTGGCATGGCATTTGGTGGCTAAGTTATCATTTATTTGGTGGAAAACCAACTTTCTCTGTGTGCCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTCCCATTATCCACATATTAAACAGCTATTATTCACC
  5   1   2       chi TpA       out                  TTpA058c07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTATTTCTGACAAGGAAAATAGTTACAATGTATGCTGTACTTTTGTGAGTGTAATGTTCTGCAATATTAGCTTATGGAACCTGTACTCAGTAAGTAGAGCCTTCAGGTAAACAAACAAAAACATCAAGTAAATAACACTGTTCTCCTGAAGGAAACTTTGCGGGGGGGGGGGGGGGAACACTGAGGCGCACACCAGAAAAACGGTTGTCATTAAAACTATTGAGACCCGGGATGGAGAGCAGGTTGTCACTGAGTCTCGGAAAGAGCAGTCCTCAGAAGGAGAGAAGTGATCTAGTACGCAGTGCTTGGAGAGACTGATCCAGTTCCCTTGCAATACCTCTCCATGGACGGAAAACCTGTGCTTTTCTAATTGATTGATACTAAGGGTCATCTCCACTAACACACTTCTTTCTCCCACAAAGTGTCCTTGGCATGGCATTTGGTGGCTAAGTTATCATTTATTTGGTGGAAAACCAACTTTCTCTGTGTGCCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTCCCATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAACTGGTACAAACTGAGCCTACATTAAGAGAAGATGAAAATGCCATTCTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGCTCTTTTACCAGTTATCAGTACCTTATATCTACTTTCC
  5   1   2       bld TpA       in                   TTpA058c06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGAAATGTCACGACATCTGAGGGAGTACCAAGACCTACTGAATGTCAAGATGGCTTTAGATATTGAAATTGCAACTTACAGAAAGCTCCTAGAAGGAGAGGAGAGCAGGATTGCTGTCCCAATCCACTCTCTGACATCTCTCAGTATTAAAAGTCCAGCTCCTGAAGTCGATCGCAGCACTGAGGCGCACACCAGAAAAACGGTTGTCATTAAAACTATTGAGACCCGGGATGGAGAGCAGGTTGTCACTGAGTCTCGGAAAGAGCAGTCCTCAGAAGGAGAGAAGTGATCTAGTACGCAGTGCTTGGAGAGACTGATCCAGTTCCCTTGCAATACCTCTCCATGGACGGAAAACCTGTGCTTTTCTAATTGATTGATACTAAGGGTCATCTCCACTAACACACTTCTTTCTCCCACAAAGTGTCCTTGGCATGGCATTTGGTGGCTAAGTTATCATTTATTTGGTGGAAAACCAACTTTCTCTGTGTGCCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTCCCATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAACTGGTACAAACTGAGCCTACATTAAGAGAAGATGAAAATGCCATTCTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGCTCTTTTACCAGTTATCAGTACCTTATATCTACTTTTCCTGTTCCTCTCTCT
  3   1   2       bld Neu  5g3  in                    TNeu114p13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCATTAAAACTATTGAGACCCGGGATGGAGAGCAGGTTGTCACTGAGTCTCGGAAAGAGCAGTCCTCAGAAGGAGAGAAGTGATCTAGTACGCAGTGCTTGGAGAGACTGATCCAGTTCCCTTGCAATACCTCTCCATGGACGGAAAACTTGTGCTTTTCTAATTGATTGATACTAAGGGTCATCTCCACTAACACACTTCTTTCTCCCACAAAGTGTCCTTGGCATGGCATTTGGTGGCTAAGTTATCATTTATTTGGTGGAAAACCAACTTTCTCTGTGTGCCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTCCCATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAACTGGTACAAACTGAGCCTACATTAAGAGAAGATGAAAATGCCATTCTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGCTCTTTTACCCAGTTATCAGTACCTTATATCTACTTTCCTTGTTCCTCTCTCTTCCTTCTTCAACACATATCCAGATTGTTGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGGATCTGCTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCTGTGTATTGGTTGGGACTGTGCCCCATCATGTTGTGTATATGTGCCATGTCAGCTTACTAGTCAATAAAATAATTTGCAGAAATCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 5g3  in                         XZG48908.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACCCCGGATGGAGAGCAGGTTGTCACTGAGTCTCGGAAAGAGCAGTCCTCAGAAGGAGAGAAGTGATCTAGTACGCAGTGCTTGGAGAGACTGATCCAGTTCCCTTGCAATACCTCTCCATGGACGGAAAACCTGTGCTTTTCTAATTGATTGATACTAAGGGTCATCTCCACTAACACACTTCTTTCTCCCACAAAGTGTCCTTGGCATGGCATTTGGTGGCTAAGTTATCATTTATTTGGTGGAAAACCAACTTTCTCTGTGTGCCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTCCCATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAACTGGTACAAACTGAGCCTACATTAAGAGAAGATGAAAATGCCATTCTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGCTCTTTTACCCAGTTATCAGTACCTTATATCTACTTTCCTTGTTCCTCTCTCTTCCTTCTTCAACACATATCCAGATTGGTGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGGATCTGCTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCTGTGTATTGGTTGGGACTGTGCCCCATCATGTTGTGTATATGTGCCATGTCAGCTTACTAGTCAATAAAATAATTTGCAG
  3   1   2      seed Tad5 5g3  in                         XZT68815.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCAGGTTGTCACTGAGTCTCGGAAAGAGCAGTCCTCAGAAGGAGAGAAGTGATCTAGTACGCAGTGCTTGGAGAGACTGATCCAGTTCCCTTGCAATACCTCTCCATGGACGGAAAACCTGTGCTTTTCTAATTGATTGATACTAAGGGTCATCTCCACTAACACACTTCTTTCTCCCACAAAGTGTCCTTGGCATGGCATTTGGTGGCTAAGTTATCATTTATTTGGTGGAAAACCAACTTTCTCTGTGTGCCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTCCCATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAACTGGTACAAACTGAGCCTACATTAAGAGAAGATGAAAATGCCATTCTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGCTCTTTTACCCAGTTATCAGTACCTTATATCTACTTTCCTTGTTCCTCTCTCTTCCTTCTTCAACACATATCCAGATTGGTGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGGATCTGCTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCTGTGTATTGGTTGGGACTGTGCCCCATCATGTTGTGTATATGTGCCATGTCAGCTTACTAGTCAATAAAATAATTTGCAG
  3   1   2       bld Gas8 5g3  in                          st97c11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCGGAAAGAGCAGTCNTCAGNAGGAGAGAAGTGATCTAGTACGCAGTGCTTGGAGAGACTGATCCAGTTCCCTTGCAATACCTCTCCATGGACGGAAAACCTGTGCTTTTCTAATTGATTGATACTAAGGGTCATCTCCACTAACACACTTCTTTCTCCCACAAAGTGTCCTTGGCATGGCATTTGGTGGCTAAGTTATCATTTATTTGGTGGAAAACCAACTTTCTCTGTGTGCCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTCCCATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAACTGGTACAAACTGAGCCTACATTAAGAGAAGATGAAAATGCCATTCTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGCTCTTTTACCCAGTTATCAGTACCTTATATCTACTTTCCTTGTTCCTCTCTCTTCCTTCTTCAACACATATCCAGATTGGTGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGGATCTGCTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCTGTGTATTGGTTGGGACTGTGCCCCATCATGTTGTGTATAT
  3   1   2       bld HdA  5x3  in                   THdA025o22.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAGAGCAGTCTTCAGAAGGAGAGAAGTGATCTAGTACGCAGTGCTTGGAGAGANTGATCCAGTTCCCTTGCAATACCTCTCCATGGACGGAAAACCTGTGCTTTTCTAATTGATTGATANTAAGGGTCATCTCCACTAACACACTTCTTTCTCCCACAAAGTGTCCTTGGCATGGCATTTGGTGGCTAAGTTATCATTTATTTGGTGGAAAACCAACTTTCTCTGTGTGCCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTCCCATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAACTAGTACAAACTGAGCCTACATTAAGAGAAGATGAAAATGCCATTCTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGCTCTTTTACCCAGTTATCAGTACCTTATATCTACTTTCCTTGTTCCTCTTTCTTCCTTCTTCAACACATATCCAGATTGGTGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGGATTTGTTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCTGTGTATTGGTTGGGACTGTGCCCCATCATGTTGTGTATATGTGCCATGTCAGCTTACTAGTCAATAAAATAATTTGCAGAAATCAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       chi Tbd1      in                        CBXT10109.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTATTTAAGTCATACTGTGAGTACATAGTTTCACCTATTAACTTCTATAATATATTTTATCAGTCAAACGAGGTTACAGAAATAGCCCATATATTAAACCAAATCATTGCTGCATCTTGTCATCTCCACTAACACACTTCTTTCTCCCACAAAGTGTCCTTGGCATGGCATTTGGTGGCTAAGTTATCATTTATTTGGTGGAAAACCAACTTTCTCTGTGTGCCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTCCCATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAACTGGTACAAACTGAGCCTACATTAAGAGAAGATGAAAATGCCATTCTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGCTCTTTTACCCAGTTATCAGTACCTTATATCTACTTTCCTTGTTCCTCTCTCTTCCTTCTTCAACACATATCCAGATTGGTGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGGATCTGCTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCTGTGTATTGGTTGGGACTGTGCCCCATCATGTTGTGTATATGTGCCATGTCAGCTTACTAGTCAATAAAATAATTTGCAGAAATCAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1 5g3  in                        CBXT16433.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCCTCAGAAGGAGAGAAGTGATCTAGTACGCAGTGCTTGGAGAGACTGATCCAGTTCCCTTGCAATACCTCTCCATGGACGGAAAACCTGTGCTTTTCTAATTGATTGATACTAAGGGTCATCTCCACTAACACACTTCTTTCTCCCACAAAGTGTCCTTGGCATGGCATTTGGTGGCTAAGTTATCATTTATTTGGTGGAAAACCAACTTTCTCTGTGTGCCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTCCCATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAACTGGTACAAACTGAGCCTACATTAAGAGAAGATGAAAATGCCATTCTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGCTCTTTTACCCAGTTATCAGTACCTTATATCTACTTTCCTTGTTCCTCTCTCTTCCTTCTTCAACACATATCCAGATTGGTGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGGATCTGCTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCTGTGTATTGGTTGGGACTGTGCCCCATCATGTTGTGTATATGTGCCATGTCAGCTTACTAGTCAATAAAATAATTTGCAGAAATCAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                        CBXT14822.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAAGTGATCTAGTACGCAGTGCTTGGAGAGACTGATCCAGTTCCCTTGCAATACCTCTCCATGGACGGAAAACCTGTGCTTTTCTAATTGATTGATACTAAGGGTCATCTCCACTAACACACTTCTTTCTCCCACAAAGTGTCCTTGGCATGGCATTTGGTGGTTAAGTTATCATTTATTTGGTGGAAAACCAACTTTCTCTGTGTGCCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTCCCATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAACTAGTACAAACTGAGCCTACATTAAGAGAAGATGAAAATGCCATTCTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGCTCTTTTACCCAGTTATCAGTACCTTATATGTACTTTCCTTGTTCCTCTCTCTTCCTTGTTCAACACATATCCAGATTGGGGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGGATCTGCTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCTGTGTATTGGTTGGGACTGTGCCCCATCATGT
  3   1   2       bld Gas7      in                         XZG31674.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCATGGACGGAAAACTTGTGCTTTTCTAATTGATTGATACTAAGGGTCATCTCCACTAACACACTTCTTTCTCCCACAAAGTGTCCTTGGCATGGCATTTGGTGGCTAAGTTATCATTTATTTGGTGGAAAACCAACTTTCTCTGTGTGCCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTCCCATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAACTGGTACAAACTGAGCCTACATTAAGAGAAGATGAAAATGCCATTCTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGCTCTTTTACCCAGTTATCAGTACCTTATATCTACTTTCCTTGTTCCTCTCTCTTCCTTCTTCAACACATATCCAGATTGTTGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGGATCTGCTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCTGTGTATTGGTTGGGACTGTGCCCCATCATGTTGTGTATATGTGCCATGTCAGCTTACTAGTCAATAAAATAATTTGCAGAAATC
  3   1   2       bld Tbd1 5g3  in                         CBXT9115.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGATACTAAGGGTCATCTCCACTAACACACTTCTTTCTCCCACAAAGTGTCCTTGGCATGGCATTTGGTGGCTAAGTTATCATTTATTTGGTGGAAAACCAACTTTCTCTGTGTGCCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTCCCATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAACTGGTACAAACTGAGCCTACATTAAGAGAAGATGAAAATGCCATTCTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGCTCTTTTACCCAGTTATCAGTACCTTATATCTACTTTCCTTGTTCCTCTCTCTTCCTTCTTCAACACATATCCAGATTGTTGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGGATCTGCTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCTGTGTATTGGTTGGGACTGTGCCCCATCATGTTGTGTATATGTGCCATGTCAGCTTACTAGTCAATAAAATAATTTGCAGAAATCAAAAAAAAAAAAAAA
  3   1   2       bld Gas8 5g3  in                          st98c11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCTCCACTAACACACTTCTTTCTCCCACAAAGTGTCCTTGGCATGGCATTTGGTGGCTAAGTTATCATTTATNTGGTGGAAAACCAACTTTCTCTGTGTGCCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTCCCATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAACTGGTACAAACTGAGCCTACATTAAGAGAAGATGAAAATGCCATTCTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGCTCTTTTACCCAGTTATCAGTACCTTATATCTACTTTCCTTGTTCCTCTCTCTTCCTTCTTCAACACATATCCAGATTGGTGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGGATCTGCTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCNGTGTATTGGTTGGGACTGTGCCCCATCATGTTG
  3   1   2       bld TpA       in                    TTpA058c06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCACAAAGTGTCCTTGGCATGGCATTTGGTGGCTAAGTTATCATTTATTTGGTGGAAAACCAACTTTTTTTGTGTGCCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTCCCATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGTTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAACTGGTACAAACTGAGCCTCCATTAAGAGAAGATGAAAATGCCATTTTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGTTTTTTTACCCAGTTATCAGTCCCTTATATCTACTTTCCTTGTTCCTCTTTCTTCCTTTTTCAACACATATCCAGATTGGTGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGGATTTGTTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCTGTGTATTGGTTGGGACTGTGCCCCATCATGTTGTGTATATGTGCCATGTCAGCTTACTAGTCAATAAAATAATTTGCGGAATTCaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaa
  3   1   2       bld TpA       in                    TTpA052g06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGGCATGGCATTTGGCGGCTAAGTTATCATCTATTTGGTGGAAAACCAACTTTTTCTGTGGGCCTGTACCCCAAATAGAGGTATTAATGTTAATGGTTTATCTATCGTAATGCATTGTGAGGATATATGCCTAAACATGGCAGAGGTACATCTTCCGCATTATCCACATATTAAACAGCTATTATTCACCACTGTGGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAATTGGTACAAACTGAGCCTTCTTTAAGAGAAGATGAAAATGCCATTCTTATTCAGTTATTAAACCATTACATTGAAAACCAGTACACTGAAAGCTCTTTTACCCAGTTATCAGTACCTCATATGTACTTTCCTGGTTCCTCTCTCTTCCTTCTTCAACACATATCCAGATTGGTGGTTGGCAATAGGCTTCAGCCGCTGCCCAGGCCAGGATGTGTTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCGGTGTATTGGTTGGGACTGTGCCCCATCATGTTGTGTATATGTGCCATGTCAGCTTACTAGTCAATAAAATAATTGCAGAAATCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tbd0 FL   in                    IMAGE:5335951.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGGTGGAAAACCAACTTTCTCTGTGTGCCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTCCCATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAACTAGTACAAACTGAGCCTACATTAAGAGAAGATGAAAATGCCATTCTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGCTCTTTTACCCAGTTATCAGTACCTTATATCTACTTTCCTTGTTCCTCTCTCTTCCTTCTTCAACACATATCCAGATTGGTGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGGATCTGCTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCTGTGTATTGGTTGGGACTGTGCCCCATCATGTTGTGTATATGTGCCATGTCAGCTTACTAGTCAATAAAATAATTTGCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld TbA  5g3  in                    TTbA080k15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTCCCTATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAACTGGTACAAACTGAGCCTCCATTAAGAGAAGATGAAAATGCCATTCTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGCTCTTTTACCCAGTTATCAGTACCTTATATTTACTTTCCTTGTTCCTCTTTCTTCCTTTTTCAACACATATCCAGATTGGTGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGGATTTGTTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCTGTGTATTGGTTGGGACTGTGCCCCATCATGTTGTGTATATGTGCCATGTCAGCTTACTAGTCAATAAAATAATTGCAGAAATCAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT51496.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCTGTACCCCAAATAGATGTATTAATGTTAATTGTTTATCTATCCTAATGCATTCTGAGGATCTATGCCTAAACATGGCAGATGTACATCTTCCCATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAACTGGTACAAACTGAGCCTCCATTAAGAGAAGATGAAAATGCCATTTTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGCTTTTTTACCCAGTTATCAGTACCTTATATCTACTTTCCTTGTTCCTCTTTCTTCCTTTTTCAACACATATCCAGATTGGTGGTTGGCATTAGGCTTCAGCCGCTGCCCAGGACAGGATTTGCTCAAAGATAAGACAGCTGTGAAGCAAATTTTGTGCTATTCATTCCCTGCCTCTGTGTATTGGTTGGGACTGTGCCCCATCATGTTGGGTATATGTGCCATGTCAGCTTACTAGTCAATAAAATAATTGGCGGAATTC
  5   1   2       bld BrSp      in                    EC0CBA005CB05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCATTCTGAGGATCTATGCCTAAACATGGCAGATTTACATCTTCCCATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAACTGGTACAAACTGAGCCTACATTAAGAGAAGATGAAAATGCCATTCTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGCTCTTTTACCCAGTTATCAGTACCTTATATCTACTTTCCTTGTTCCTCTCTCTTCCTTCTTCAACACATATCCAGATTGGTGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGTATCTGCTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCTGTGTATTGGTTGGGACTGTGCCCCATCATGTTGTGTATATGTGCCATGTCAGCTTACTAGTCAATAAAATAATTTGCAGAAATCA
  3   1   2       bld BrSp 5g3  in                     EC2BBA35DD05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGGATCTATGCCTAACATGGCAGATGTAATCTTCCCATTACCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAGCTGGTACAAACTGAGCCTACATTAAGAGAAGATGAAAATGCCATTCTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGCTCTTTTACCCAGTTATCAGTACCTTATATCTACTTTCCTTGTTCCTCTCTCTTCCTTCTTCAACACATATCCAGATTGGTGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGGATCTGCTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCTGTGTATTGGTTGGGACTGTGCCCCATCATGTTGTGTATATGTGCCATGTCAGCTT
  3   1   2       bld HeRe      in                     EC2CAA33BE07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATCTTCCCATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAACTGGTACAAACTGAGCCTACATTAAGAGAAGATGAAAATGCCATTCTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGCTCTTTTACCCAGTTATCAGTACCTTATATCTACTTTCCTTGTTCCTCTCTCTTCCTTCTTCAACACATATCCAGATTGGTGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGGATCTGCTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCTGTGTATTGGTTGGGACTGTGCC
  5   1   2       bld HeRe      in                     EC2CAA33BE07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCTTCCCATTATCCACATATTAAACAGCTATTATTCACCACTGTTGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAACTGGTACAAACTGAGCCTACATTAAGAGAAGATGAAAATGCCATTCTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGCTCTTTTACCCAGTTATCAGTACCTTATATCTACTTTCCTTGTTCCTCTCTCTTCCTTCTTCAACACATATCCAGATTGGTGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGGATCTGCTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCTGTGTATTGGTTGGGACTGTGCCCCATCATGTTGTGTATATGTGCCATGTCAGCTTACTAGTCAATAAAATAATTTGCAGAAATCAAAAAAGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp      in                    EC0CBA005CB05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTATCCACATATTAAACAGCTATTATTCACCACTGTGGGACTTAATGTTATAAAAACAAAGTTTATAAGTATAGCTGTGACACAATTCACATAATGGGCCCTCCGATCCCTGTGTTAGATAAACTGGTACAAACTGAGCCTACATTAAGAGAAGATGAAAATGCCATTCTTATTCAGTTATTAAACCAGTACATTGAAAACCAGTACACTGAAAGCTCTTTTACCCAGTTATCAGTACCTTATATCTACTTTCCTTGTTCCTCTCTCTTCCTTCTTCAACACATATCCAGATTGGTGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGTATCTGCTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCTGTGTATTGGTTGGGACTGTGCCCCATCATGTTGTGTATATGTGCCATGTCAGCTTACTAGTCAATAAAATAATTTGCAGAAATCACCAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Eye  5g3  in                          CCAX848.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTACTTTCCTTGTTCCTTTTTTTTCCTTTTTCAACACATATCCAGATTGGGGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGGTTTTGTTAAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCCCCCTCTGTGTATTGGTTGGGACTGTGCCCCATCATGTTGTGTATATGTGCCATGTCAGCTTATTAGTCAATAAAATAATTTGCGGAAATC
  3   1   2       bld Neu       in                    TNeu119n04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTTCCTTGTTCCTCTCTCTTCCTTCTTCAACACATATCCAGATTGGTGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGGATCTGCTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCTGTGTATTGGTTGGGACTGTGCCCCATCATGTTGTGTATATGTGCCATGTCAGCTTACTAGTCAATAAAATAATTTGCAGAAATCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu       in                   TNeu119n04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTCCTTGTTCCTCTCTCTTCCTTCTTCAACACATATCCAGATTGGTGGTTGGCACTAGGCTTCAGCCGCTGCCCAGGACAGGATCTGCTCAAAGATAAGACAGCTGTGAAGCAAATTTGGTGCTATTCATTCCCTGCCTCTGTGTATTGGTTGGGACTGTGCCCCATCATGTTGTGTATATGTGCCATGTCAGCTTACTAGTCAATAAAATAATTTGCAGAAATC

In case of problems mail me! (