Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012075332 Xt7.1-XZT70939.5.5 - 39 ESTs
                                                                       ......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-XZT70939.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTAGCCATCTTTAGTGCTGGCATAGATTTTTACATTGTTAACATAGTTGGGTTCTGAAATGTAAACCTCTTTGAGGGTGCGATAACTCGTGTGTGTTGCAAAGTCCGCCCTATAGTTAATGGGTTATAAAATGAAGTGACACTTGTAGTGCAGTGACACTTGTATCTTACTGTTCTGAGGATACTACATGGCTAGATCTAAGATCCCAACTGTGCCCCTGGCTAGTGGGAAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCAGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTTCAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008226911                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCTTTAGTGCTGGCATAGATTTTTACATTGTTAACATAGTTGGGTTCTGAAATGTAAACCTCTTTGAGGGTGCGATAACTCGTGTGTGTTGCAAAGTCCGCCCTATAGTTAATGGGTTATAAAATGAAGTGACACTTGTAGTGCAGTGACACTTGTATCTTACTGTTCTGAGGATACTACATGGCTAGATCTAAGATCCCAACTGTGCCCCTGGCTAGTGGGAAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCAGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTTCAxxxAxAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            2     2     2     2     2     2     2     2     2     2     4     4     4     4     5     5     5     5     5     5     5     5     5     6     5     6     5     6     5     6     6     7     8     9     9    11    10    13    10    13    11    14    13    14    13    15    13    15    13    15    14    15    14    15    14    15    14    15    14    15    15    16    15    16    15    16    15    16    15    16    13    16    15    16    15    16    15    16    15    16    14    16    14    16    14    16    14    16    13    15    13    15    14    16    14    16    14    16    14    16    15    17    17    19    17    19    17    19    18    20    18    19    18    19    18    19    19    21    20    22    20    22    20    22    19    20    19    20    19    20    19    20    20    21    21    23    22    24    21    22    21    22    23    24    23    24    25    26    25    26    25    26    24    24    23    24    24    25    17    25    17    25    17    25    17    25    17    25    16    25    15    24    15    25    15    23    16    23    18    25    17    25    18    25    18    25    18    25    15    22    14    22    15    22    15    22    15    22    15    22    15    22    15    22    15    22    15    22    15    22    14    22    15    22    15    22    15    22    13    22    13    22    15    22    15    22    15    22    15    21    14    21    15    21    13    20    11    20    12    20    13    20    13    19    13    19    13    19    13    18    12    18    13    14    12    12    12    12    12    12    10    12    10    10    10    10     9    10     2     3     2     3
  5   1   2  SIG                                      Xt7.1-XZT70939.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTAGCCATCTTTAGTGCTGGCATAGATTTTTACATTGTTAACATAGTTGGGTTCTGAAATGTAAACCTCTTTGAGGGTGCGATAACTCGTGTGTGTTGCAAAGTCCGCCCTATAGTTAATGGGTTATAAAATGAAGTGACACTTGTAGTGCAGTGACACTTGTATCTTACTGTTCTGAGGATACTACATGGCTAGATCTAAGATCCCAACTGTGCCCCTGGCTAGTGGGAAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCAGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTTCAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CABA1746.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAATGAAGTGACACTTGTAGTGCAGTGACACTTGTATCTTACTGTTCTGAGGATACTACATGGCTAGATCTAAGATCCCAACTGTGCCCCTGGCTAGTGGGCAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCTGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTCAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTTCACTG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----------AA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           T-----------
                                               BLH ATG     187     436                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                               BLH MIN     178     104                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                               BLH OVR     187     767                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                               EST CLI     191       6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                               ORF LNG     187      39                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                                                       PROTEIN --- Ci ---- 2e-026     BAD38616.1 aldo-keto reductase 1a [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Mm ==== 2e-041     NP_067448.1 aldo-keto reductase family 1, member A4 (aldehyde reductase); aldehydereductase; aldo-keto reductase family 1, member A1 (aldehyde reductase) [Musmusculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Sp ==== 1e-041     XP_792112.1 PREDICTED: similar to aldo-keto reductase family 1, member A1 [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Hs ==== 4e-042     NP_006057.1 aldo-keto reductase family 1, member A1; aldehyde reductase; alcoholdehydrogenase [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Gg ---- 4e-043     NP_001006539.1 similar to Alcohol dehydrogenase [NADP+] (Aldehyde reductase) (Aldo-keto reductase family 1 member A1) [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Sc ---- 4e-044     NP_014763.1 Galactose-induced transcript; Gcy1p [Saccharomyces cerevisiae] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 3e-046     NP_647839.1 CG12766-PA [Drosophila melanogaster] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Ce ==== 5e-065     NP_495578.2 ZK1290.5 [Caenorhabditis elegans] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Dr ---- 3e-118     NP_001017779.1 hypothetical protein LOC550476 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 1e-160     AAH77838.1 MGC80525 protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === ?? ==== 1e-160     NP_001086970.1 MGC80525 protein [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xt ==== 3e-171     AAH89068.1 Unknown (protein for IMAGE:7004153) [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-XZT70939.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAG------------------TAG------------------TAG------------ATGTAA------------------TAA---------------------------TAG---ATG---------ATG---TGA------TAG---------------------------TGA---------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------ATG------------------------------------------------------------------TGA------------TGA---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---TGA---------------TAA---------------TGA---------TAA---------TGA---------------TAG------TAA---------------------TAG------------------------------------------------------------------TGA---------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   2  SIG                                      Xt7.1-XZT70939.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTAGCCATCTTTAGTGCTGGCATAGATTTTTACATTGTTAACATAGTTGGGTTCTGAAATGTAAACCTCTTTGAGGGTGCGATAACTCGTGTGTGTTGCAAAGTCCGCCCTATAGTTAATGGGTTATAAAATGAAGTGACACTTGTAGTGCAGTGACACTTGTATCTTACTGTTCTGAGGATACTACATGGCTAGATCTAAGATCCCAACTGTGCCCCTGGCTAGTGGGAAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCAGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTTCAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008291144                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCTTTAGTGCTGGCATAGATTTTTACATTGTTAACATAGTTGGGTTCTGAAATGTAAACCTCTTTGAGGGTGCGATAACTCGTGTGTGTTGCAAAGTCCGCCCTATAGTTAATGGGTTATAAAATGAAGTGACACTTGTAGTGCAGTGACACTTGTATCTTACTGTTCTGAGGATACTACATGGCTAGATCTAAGATCCCAACTGTGCCCCTGGCTAGTGGGAAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCAGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTTCAxxxAxAAAAAAAAAAAAAAAAAAA
  0   1   1           Gas  FL                     TGas111d15.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAATGTAAACCTCTTTGAGGGTGCGATAACTCGTGTGTGTTGCAAAGTCCGCCCTATAGTTAATGGGTTATAAAATGAAGTGACACTTGTAGTGCAGTGACACTTGTATCTTACTGTTCTGAGGATACTACATGGCTAGATCTAAGATCCCAACTGTGCCCCTGGCTAGTGGGAAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCAGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATATCAATTATCCTATGGTATCTAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTTCACTGAAAAAAAAAAAAAAAAAA
  0   1   1           Brn4 FLsh                        CAAL6299.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGATAACTCGTGTGTGTTGCAAAGTCCGCCCTATAGTTAATGGGTTATAAAATGAAGTGACACTTGTAGTGCAGTGACACTTGTATCTTACTGTTCTGAGGATACTACATGGCTAGATCTAAGATCCCAACTGTGCCCCTGGCTAGTGGGAAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCAGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTTCACTGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           AbdN FL                     IMAGE:7004153.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGATACTACATGGCTAGATCTAAGATCCCAACTGTGCCCCTGGCTAGTGGGCAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCTGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATTCTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTTCACTGAAAAAAAAAAAAAAAAAAAAAAAAAAGG
  5   1   2   12  ext Gas7 5g3  in                         XZG59058.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAAGCGTAGCCATCTTTAGTGCTGGCATAGATTTTTACATTGTTAACATAGTTGGGTTCTGAAATGTAAACCTCTTTGAGGGTGCGATAACTCGTGTGTGTTGCAAAGTCCGCCCTATAGTTAATGGGTTATAAAATGAAGTGACACTTGTAGTGCAGTGACACTTGTATCTTACTGTTCTGAGGATACTACATGGCTAGATCTAAGATCCCAACTGTGCCCCTGGCTAGTGGGAAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCAGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAG
  5   1   3        nb Gas  5g                        TGas048o02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTAGCCATCTTTAGTGCTGGCATAGATTTTTACATTGTTAACATAGTTGGGTTCTGAAATGTAAACCTCTTTGAGGGTGCGATAACTCTTGTGTGTTGCAAAGTCCGCCCTATAGTTAATGGGTTATAAAATGAAGTGACACTTGTAGTGCAGTGACACTTGTATCTTACTGTGGTGAGGATACTACATGGCTAGATCTAAGATCCCAACTGTGCCCCTGGCTAGTGGGAAGCACATTCCTCTTCTAAGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCACGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATAC
  5   1   2   10  ext Ova1 5g3  in                         CABE5814.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGAAATGTAAACCTCTTTGAGGGTGCGATAACTCGTGTGTGTTGCAAAGTCCGCCCTATAGTTAATGGGTTATAAAATGAAGTGACACTTGTAGTGCAGTGACACTTGTATCTTACTGTTCTGAGGATACTACATGGCTAGATCTAAGATCCCAACTGTGCCCCTGGCTAGTGGGAAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCAGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAAGAATA
  5   1   3        nb Gas  FL                        TGas111d15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAATGTAAACCTCTTTGAGGGTGCGATAACTCGTGTGTGTTGCAAAGTCCGCCCTATAGTTAATGGGTTATAAAATGAAGTGACACTTGTAGTGCAGTGACACTTGTATCTTACTGTTCTGAGGATACTACATGGCTAGATCTAAGATCCCAACTGTGCCCCTGGCTAGTGGGAAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCAGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATG
  5   1   3   22   nb Gas7 5g                              XZG39817.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATAACTCGTGTGTGTTGCAAAGTCCGCCCTATAGTTAATGGGTTATAAAATGAAGTGACACTTGTAGTGCAGTGACACTTGTATCTTACTGTTCTGAGGATACTACATGGCTAGATCTAAGATCCCAACTGTGCCCCTGGCTAGTGGGCAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCTGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGTATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCA
  5   1   2       add AbdN FL                            IMAGE:7004153                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGATACTACATGGCTAGATCTAAGATCCCAACTGTGCCCCTGGCTAGTGGGCAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCTGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATTCTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCCAAGAGGAGAGAATCCAGGGAGAACTGTTGAGGTGTTTGGGTTTTGTGTTTAGCAACATGAAGAACGTTTTTTGGGCTCTAAAATGGCCCTTGGAATGGAAGGGCCCGCTCATTATTTTTCCCTGGGGGATCCCTTCCCAAAAATTTCCTGGTTAGT
  5   1   0       chi Brn4 FLsh                            CAAL6299.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGATAACTCGTGTGTGTTGCAAAGTCCGCCCTATAGTTAATGGGTTATAAAATGAAGTGACACTTGTAGTGCAGTGACACTTGTATCTTACTGTTCTGAGGATACTACATGGCTAGATCTAAGATCCCAACTGTGCCCCTGGCTAGTGGGAAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCAGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATCTGTAGCTGTCACAGGTTTTTAACTTCA
  5   1   2       ext Gas       in                   TGas079l09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGATCTAAGATCCCAACTGTGCCCCTGGCTAGTGGGAAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCAGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAATTGCAAAA
  5   1   2       add Spl1      in                         CABK2540.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATTCGCTCGACTAGTACATTGGTTCTGAGCGAATCTTTGGGAAACTTTCTGCTGCAGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCAGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTA
  5   1   3        nb Liv1      in                         CAAR5565.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAAGATCCCAACTGTGCCCCTGGCTAGTGGGAAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCAGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCATATTCTGTAGCTGTCACAGGTTTTTA
  5   1   3        nb Gas7      in                         XZG63695.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAACTGTGCCCCTGGCTAGTGGGAAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCAGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCCTGGATCCCT
  5   1   3        nb Gas       in                   TGas139p20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACTGTGCCCCTGGCTAGTGGGAAGCACATTCCTCTTCTAGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCACGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCGTGCAAGAGACTAGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAG
  5   1   4      seed Fat1      in                         CABC1291.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCTGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACT
  5   1   3        nb TbA                            TTbA080p03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTCATGTTGGAGGATATTGCCACAATGGCACTACTCTATGGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCTGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAA
  3   1   2       add Spl1      in                         CABK2540.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATATCAATTATCCTATGGTATCTAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTT
  5   1   2       ext HdA       in                  THdA028m18.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAGCTGTGTATGGAGATGTTTGNTGGATTAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGAATTAAACTACTTTCTTAATTTACTGGAATGGCTGAATTCTGAAANTAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTTAAAAAGTCTATGCT
  5   1   3        nb Tad5      in                         XZT70939.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAATTTACTGGAATGGCTGATTTCTGAAATAAGTATTTTACTGAAAGCA
  3  -1   3        nb Kid1      in                         CABA8087.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATG
  5  -1   3        nb Kid1      in                         CABA8087.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATCCCTTTCAGAGACCACAGGAACTGTGGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTATTTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTTCACTGAAAAAAAACCTCGTGCCGAATTGA
  3   1   2       ext Ova1 5g3  in                         CABE5814.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATATCAATTATCCTATGGTATCTAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTTCACTG
  3   1   4      seed Fat1      in                         CABC1291.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTTCACT
  3   1   3        nb Liv1      in                         CAAR5565.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAATCACCCTGTATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATATCAATTATCCTATGGTATCTAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTTCACTGAC
  3   1   3        nb Tad5      in                         XZT70939.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCACCCTGTAATTCAAAAAATGCAAAAAAATTAGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGTTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACCCAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTTC
  3   1   3        nb Gas7      in                         XZG63695.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATATCAATTATCCTATGGTATCTAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTTCACTG
  3   1   2       ext Gas7 5g3  in                         XZG59058.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCTGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTTC
  3   1   2       ext HdA       in                   THdA028m18.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTGTGAGGTGTTTGGTTTTGTGTTAGCAGATGAGGACGTTTTGGCTCTAAATGCCTTGCATGATGGCCGTCATATTTCCGGGGATCCCTCCAATATTCTGTAGCTGTCACAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAATTTCCCTGAACAGTAACCGCAAATTCATCCATTTGACCTACCCACTGTGGAGAGGGTGAATCCAGACATGTTGAGCCCTGCAGTCGTTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCCCAAAAGGATGAACAGTGTACCAAGTCCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTTTCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGGGGGGATTAAAACTACTTTTTTAAATTTACGGGAAGGGCGGAATTTTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTTTATGCTCATTGGCATTAGGGGTACCATTCTCACAGTTTTTTAAATGTTCCATTTTATCAGGATATTACACTTATTGTCCCCCAATGAAATAACAATGTAACATGAAATAAAGGGGAAGGGGTCCTTCCCTGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas       in                    TGas139p20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGATCCCTCCAATATTTGGTAGTTGTCACAGGTTTTTAATTTCCAGTTGGAACAGGAGCACAGGGATGGTATAACTTCCCGGAACAGTAACCGCAAATTCATCCATTTGACCTACCCACTGGGGGGGGGGGGAATCCAGACATGTTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGTGGCCTGTTTGGTCAGCAAAGCACTGGCAAAAAATCCATTTTGGTCCCACAAAAGGATGAACAGTGTCCCAAGTCCCTTATGAATAAAAGCTGTGTATGGAGGGTTGGGGGAATATCAATTATCTTATGGTATTTAAGCCTTTTAGGTAGGGATAAACCTAAATTGCATTGCTATATACTTGAACTAAAAATGTGCGGATTAAAACTACTTTTTTAAATTTATTGGAAGGGCTGAATTTTGAAAAAAGTATTTTTCTGAAAGCAATTTTATATTTGGTATTTTTAAAAAGTTTATGTTCATTGGCATTAGGGGGACCATTCTCCCAGTTTTTTAAATGTTCCATTTTATCAGGATATTACACTTATTGTCCCCCAATGAAATAACAATGTAACATGAAATAAATGGGAAGGTGTCCTTCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       ext Gas       in                    TGas079l09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGTTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATATCAATTATCCTATGGTATTTAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTTTTAAATTTACTGGAAGGGCTGAATTTTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTTTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACCCAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTTCACTGACaaaaaaaaaaaaaggaaaaaaaaaaaaaagaaaaaaaaaaaaaaaaaaa
  3  -1   3        nb Kid1      in                         CABA7252.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCCAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACA
  5  -1   3        nb Kid1      in                         CABA7252.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACA
  5   1   2  SIG                                      Xt7.1-CABA1746.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAATGAAGTGACACTTGTAGTGCAGTGACACTTGTATCTTACTGTTCTGAGGATACTACATGGCTAGATCTAAGATCCCAACTGTGCCCCTGGCTAGTGGGCAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCTGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTCAAAAAAAAAAA
                                                  Xt7.1-CHK-1008291146                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGTGACACTTGTAGTGCAGTGACACTTGTATCTTACTGTTCTGAGGATACTACATGGCTAGATCTAAGATCCCAACTGTGCCCCTGGCTAGTGGGCAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAxxTxxxGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCTGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTxxAxxxAAAAAAAAAAAA
  5   1   4      seed Mus1 5g3  in                         CABH8753.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAATGAAGTGACACTTGTAGTGCAGTGACACTTGTATCTTACTGTTCTGAGGATACTACATGGCTAGATCTAAGATCCCAACTGTGCCCCTGGCTAGTGGGCAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCTGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAAGAGGAGAG
  5   1   2       ext Egg       in                   TEgg004n08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTAGATCTAAGATCCCAACTGTGCCCCTGGCTAGTGGGCAGCACATTCCTCTTCTAGGTCTGGGAATGTCTCATGTTGGAGGATATTGCCACAATGCACTACTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATACGGAAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCTGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTAT
  5   1   2       ext Kid1      in                         CABA1746.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTCACCACCAAACTTTGGCCTGGAGACTATGGGTATGAGAATGCCATACAAGCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTCATGCATTGGCCTGATGCCCAAATACCAGGTAAGAGTGCCAGGGAGGCACGTGCGGAGACTTGGCAAGCATTGGAGGAGCTGAATGAAAGAGGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCC
  5   1   3        nb Tad5                                 XZT54705.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAATCTGTCGCTCTATTGGTGTTAGTAACTTTTTAATCCATCACTTGGATCAATTGAAGGAAGACTGCAATATGGTACCTCATCTTAACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTA
  3   1   4      seed Mus1 5g3  in                         CABH8753.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACCAGGTGGAGTATCATCCCTTTCAGAGACCACAGGAAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTTTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTTCACTGAC
  3   1   2       ext Kid1      in                         CABA1746.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTGGAGTATCATCCCTTTCAGAGACCACAGGAACTTGTGGATTATTGTAGAAGGAATAATATTGTGTNTGAGGGATACTGTCCTCTGGCCAAAGGACAAGCCCTGAATCACCCTGTAATTCAAAAAATTGCAAAAAATTATGGAAAAACCCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACATGAAATAAATGGGAATGTGTCCTTCACTGACAAAAC
  3   1   2       ext Egg       in                    TEgg004n08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCAGCTCAAGTCTGTATCCGCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACATGAAATAAATGGGAATGGTCCTTCAAAAAAAAAAAAAAAAAA
  5   1   3        nb Bone      in                        CBTC6212.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACGTGAAATAAATGGGAATGTGTCCTTCACTG
  3   1   3        nb Bone      in                        CBTC6212.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTGGAGTATCCAGAATGGTATTGTAACCATCCCAAAGTCAACCAAAGAGGAGAGAATCCAGGAGAACTGTGAGGTTTTTAACTTCCAGTTGGAACAGGAGCACATGGATTGTATAACTTCCCTGAACAGTAACCGCAAACTCATCCATTTGACCTACCCACTGTGGAGAGGCTGAATCCAGACATGCTGAGCCCTGCAGTCGCTGCACATTTCAACCATTGGCTGCCTGTTTGGTCAGCAAAGCACTGGCAAACAATGCATTTTGGTCCCACAAAAGGATGAACAGTGTACCAAGTGCCTTATGAATAAAAGCTGTGTATGGAGTGTTGGTGGAATAGCAATTATCCTATGGTATCAAAGCCTTTTAGGTAGTGATAAACCTAAACTGCATTGCTATATACTTGAACTAAAAATGTGCTGATTAAAACTACTTTCTTAAATTTACTGGAATGGCTGAATTCTGAAATAAGTATTTTACTGAAAGCAATTTTATACTTAGTATTTTTAAAAAGTCTATGCTCATTGGCATTAGTGGTACCATTCTCACAGTTTCTTAAATGTTCCATTTTATCATGATATTACACTTATTGTCACACAATGAAATAACAATGTAACGTGAAATAAATGGGAATGTGTCCTTCACTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)