Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAN10593.3                           5 END     1           3       20                (no blast hit)
     2   1.0    0Xt7.1-CBSU6609.3                            3 END     1           3       33                (no blast hit)

 This cluster: approximate FL confidence score = 88%

 1012075341 Xt7.1-CABI8399.5.5 - 31 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABI8399.5.5 AAAAGCTAAGACAAGGAGCCGGTTTTCAGAGGGGGTCCGGTGAGATTTATGTTGCAGTTGTGCGGTTAGGGGAAGCATTTATAGCGGGATGTAAAAGAGGGCGAAAAATATTTAGAGCTAATAAACTGGTAAAGCGCTTACATCGACAAGGAGCCGGTTTTCAGAGGGGGTCCGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCAAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTTAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAAATTGTCTGTTACTTCTGATATTAGCCATTTTCCTCATTGTATCACTTTTTTACTATCCTTGCTTTGTTTTCAGCCCTGTTATAAAGCACACTCCCTTTCTCTCCTTTCATTTTCATAATACCTCATTCACATCAATCACTTACCAGAATACATTTATATATAAAGTAAATTGAATGTTTTTGTTTTTAAATACTTTTCAGGCTCTTTTGACGATTATCTTAAATCAGTTATAATGTGAATGTGATTCCAATGTCTCTGCTGTCAGCTGTGCTATATAAACCATGCACAGAAAATTGCCCTGTTTGACATAGGTTAGTTATCTGAGAAATTGTAAAATGTGCCTGCTCTTACTAAATGGTTTTTACTGCAAATATGTTTTTTAGATAAAACTATATTTTAAGAAA
                                                  Xt7.1-CHK-1008228003       TAAGACAAGGAGCCGGTTTTCAGAGGGGGTCCGGTGAGATTTATGTTGCAGTTGTGCGGTTAGGGGAAGCATTTATAGCGGGATGTAAAAGAGGGCGAAAAATATTTAGAGCTAATAAACxxxxxxxxxxxxxxCxxxGACAAGGAGCCGGTTTTCAGAGGGGGTCCGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCAAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTTAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAAATTGTCTGTTACTTCTGATATTAGCCATTTTCCTCATTGTATCACTTTTTTACTATCCTTGCTTTGTTTTCAGCCCTGTTATAAAGCACACTCCCTTTCTCTCCTTTCATTTTCATAATACCTCATTCACATCAATCACTTACCAGAATACATTTATATATAAAGTAAATTGAATGTTTTTGTTTTTAAATACTTTTCAGGCTCTTTTGACGATTATCTTAAATCAGTTATAATGTGAATGTGATTCCAATGTCTCTGCTGTCAGCTGTGCTATATAAACCATGCACAGAAAATTGCCCTGTTTGACATAGGTTAGTTATCTGAGAAATTGTAAAATGTGCCTGCTCTTACTAAATGGTTTTTACTGCAAATATGTTTTTTAGATAAAACTATATTTT
                                                      consensus depths      2     2     4     4     4     4     5     5     5     5     5     5     5     5     5     7     5     9     5     9     5    12     6    14     7    15     7    16     9    18    19    19    19    19    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    21    21    22    22    23    23    23    23    23    23    23    23    22    23    23    23    26    26    26    26    28    28    28    28    28    28    28    28    27    27    26    26    25    26    26    26    25    26    25    26    23    24    21    22    21    22    21    22    20    21    19    20    19    20    18    20    18    19    18    19    15    16    14    16    15    17    15    17    15    17    15    16    15    16    16    16    15    15    12    13    12    13    12    13    12    13    12    12    12    12    12    12    12    12    12    12    11    11    11    11    11    11    11    11    11    11    10    11    11    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     9    11     9    11     3     3
  5   1   2  SIG                                      Xt7.1-XZT63000.5 AAAAGCTAAGACAAGGAGCCGGTTTTCAGAGGGGGTCCGGTGAGATTTATGTTGCAGTTGTGCGGTTAGGGGAAGCATTTATAGCGGGATGTAAAAGAGGGCGAAAAATATTTAGAGCTAATAAACTGGTAAAGCGCTTACATCTTACCCTACTGCGGTGTTATATACGCAAAGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCAAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTCAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAAATTGTCTGTTACTTCTGATATTAGCCATTTTCCTCATTGTATCACTTTTTTACTATCCTTGCTTTGTTTTCAGCCCTGTTATAAAGCACACTCCCTTTCTCTCCTTTCATTTTCATAATACCTCATTCACATCAATCACTTACCAGAATACATTTATATATAAGTAAATTGAATGTTTTTGTTTTTAAATACTTTTCAGGCTCTTTTGACGATTATCTTAAATCAGTTATAATGTGAATGTGATTCCAATGTCTCTGCTGTCAGCTGTGCTATATAAACCATGCACAGAAAATTGCCCTGTTTGACATAGGTTAGTTATCTGAGAAATTGTAAAATGTGCCTGCTCTTACTAAATGGTTTTTACTGCAAATATGTTTTTTAGATAAAACTAT
  5   1   2  SIG                                      Xt7.1-CABI8399.5                                                                                  CAACGGTTGCACAGCAACAGGCGGAGTCTACCAAAGTGAGAATTAGAAGGGGCAAAAAGCTAAGACAAGGAGCCGGTTTTCAGAGGGGGTCCGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCAAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTTAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAAATTGTCTGTTACTTCTGATATTAGCCATTTTCCTCATTGTATCACTTTTTTACTATCCTTGCTTTGTTTTCAGCCCTGTTATAAAGCACACTCCCTTTCTCTCCTTTCATTTTCATAATACCTCATTCACATCAATCACTTACCAGAATACATTTATATATAAAGTAAATTGAATGTTTTTGTTTTTAAATACTTTTCAGGCTCTTTTGACGATTATCTTAAATCAGTTATAATGTGAATGTGATTCCAATGTCTCTGCTGTCAGCTGTGCTATATAAACCATGCACAGAAAATTGCCCTGTTTGACATAGGTTAGTTATCTGAGAAATTGTAAAATGTGCCTGCTCTTACTAAATGGTTTTTACTGCAAATATGTTTTTTAGATAAAACTATATTTTAAG
                                                                   VAR                                                                                                 AACAGGCGGAGTCTACCAAAGTGAGAATTAGAAGGGGCAAAAAGCTAA
                                                                   VAR                                                                                                                                                 TTACCCTACTGCGGTGTTATATACGCAAAGTAATGG
                                                                   SNP                                                                                                                                                                                                                                                                                                                         ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------C---
                                               BLH ATG     176     189 
                                               BLH MIN     176      68 
                                               BLH MPR       2      68 
                                               BLH OVR     176     169 
                                               EST CLI     111       3 
                                               ORF LNG     176       5 
                                                                         PREDICTED - Gg ---- 3e-013     XP_414829.2 PREDICTED: similar to B9 [Gallus gallus] ---------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                     PROTEIN --- Xt ---- 3e-015     AAH91609.1 Unknown (protein for MGC:97731) [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PROTEIN === Dm ==== 2e-030     NP_608998.1 CG9227-PA [Drosophila melanogaster] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PREDICTED = Ce ==== 1e-043     NP_500186.1 putative protein of bilaterial origin (4D70) [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PREDICTED = Sp ==== 4e-072     XP_781811.1 PREDICTED: similar to putative protein of bilaterial origin (4D70) [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PREDICTED = Mm ==== 7e-076     NP_742160.1 hypothetical protein MGC41256 [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PREDICTED = Hs ==== 8e-077     NP_085055.1 hypothetical protein MGC4093 [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PROTEIN === Dr ==== 3e-080     NP_001002394.1 zgc:92713 [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 4e-103     AAH73648.1 MGC82986 protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PROTEIN === ?? ==== 4e-103     NP_001085984.1 MGC82986 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABI8399.5.5                                                                                                                                                                                 ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------------------------------------------TGA---------------------------------------TGA---------------------------------TAA---------------ATG------------------------------------------TAATGA---------------------TAATAA---TGA---------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------TAA---------------------------------------------------------------------ATGTGAATGTGA---------------------------------------------------------------------TAG---------------TAA---------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   2  SIG                                      Xt7.1-XZT63000.5 AAAAGCTAAGACAAGGAGCCGGTTTTCAGAGGGGGTCCGGTGAGATTTATGTTGCAGTTGTGCGGTTAGGGGAAGCATTTATAGCGGGATGTAAAAGAGGGCGAAAAATATTTAGAGCTAATAAACTGGTAAAGCGCTTACATCTTACCCTACTGCGGTGTTATATACGCAAAGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCAAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTCAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAAATTGTCTGTTACTTCTGATATTAGCCATTTTCCTCATTGTATCACTTTTTTACTATCCTTGCTTTGTTTTCAGCCCTGTTATAAAGCACACTCCCTTTCTCTCCTTTCATTTTCATAATACCTCATTCACATCAATCACTTACCAGAATACATTTATATATAAGTAAATTGAATGTTTTTGTTTTTAAATACTTTTCAGGCTCTTTTGACGATTATCTTAAATCAGTTATAATGTGAATGTGATTCCAATGTCTCTGCTGTCAGCTGTGCTATATAAACCATGCACAGAAAATTGCCCTGTTTGACATAGGTTAGTTATCTGAGAAATTGTAAAATGTGCCTGCTCTTACTAAATGGTTTTTACTGCAAATATGTTTTTTAGATAAAACTAT
                                                  Xt7.1-CHK-1008293300       TAAGACAAGGAGCCGGTTTTCAGAGGGGGTCCGGTGAGATTTATGTTGCAGTTGTGCGGTTAGGGGAAGCATTTATAGCGGGATGTAAAAGAGGGCGAAAAATATTTAGAGCTAATAAACTGGTAAAGCGCTTACATCTTACCCTACTGCGGTGTTATATACGCAAAGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCAAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTCAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAAATTGTCTGTTACTTCTGATATTAGCCATTTTCCTCATTGTATCACTTTTTTACTATCCTTGCTTTGTTTTCAGCCCTGTTATAAAGCACACTCCCTTTCTCTCCTTTCATTTTCATAATACCTCATTCACATCAATCACTTACCAGAATACATTTATATATAAGTAAATTGAATGTTTTTGTTTTTAAATACTTTTCAGGCTCTTTTGACGATTATCTTAAATCAGTTATAATGTGAATGTGATTCCAATGTCTCTGCTGTCAGCTGTGCTATATAAACCATGCACAGAAAATTGCCCTGTTTGACATAGGTTAGTTATCTGAGAAATTGTAAAATGTGCCTGCTCTTACTAAATGGTTTTTACTGCAAATATGTTTTTTAGATAA
  5   1   3   14   nb Te4  5g3  out                       CAAN10204.5p AAAAGCTAAGACAAGGAGCCGGTTTTCAGAGGGGGTCCGGTGAGATTTATGTTGCAGTTGTGCGGTTAGGGGAAGCATTTATAGCGGGATGTAAAAGAGGGCGAAAAATATTTAGAGCTAATAAACTGGTAAAGCGCTTACATCTTACCCTACTGCGGTGTTATATACGCAAAGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTG
  5   1   4   12 seed Tad5 5g3  in                         XZT63000.5p AAAAGCTAAGACAAGGAGCCGGTTTTCAGAGGGGGTCCGGTGAGATTTATGTTGCAGTTGTGCGCTTAGGGGAAGCATTTATAGCGGGATGTAAAAGAGGGCGAAAAATATTTAGAGCTAATAAACTGGTAAAGCGCTTACATCTTACCCTACTGCGGTGTTATATACGCAAAGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCGTCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCNAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTC
  5   1   3   34   nb Te4  5x3  out                       CAAN10593.5p .....CTAAGACAAGGACCCGGTTTTCAGAGGGGGTCCGGTGAGATTTATGTTGCAGTTGTGCGGTTAGGGGAAGCATTTATAGCGGGATGTAAAAGAGGGCGAAAAATATTTAGAGCTAATAAACTGGTAAAGCGCTTACATCTTACCCTACTGCGGTGTTATATACGCAAAGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGT
  5   1   3        nb Egg0 5g                              dad80c09.y3                                   CCGGGGTGAGATTTATGTTGCAGTTGTGCGGTTAGGGGAAGCATTTCTAGCGGGATGTAAAAGAGGGCGAAAAATATTTAGAGCTAATAAACTGGTAAAGCGCTTACATCTTACCCTACTGCGGTGTTATATACGCAAAGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGCGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATTCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGGCACAACTTAAGT
  5   1   3        nb Gas  5g                        TGas001m07.p1kSP6                                                                                                                                  TAAAGCGCTTACATCTTACCCTACTGCGGTGTTATATACGCAAAGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAATGACATATGCACTGAAATAATC
  3   1   4      seed Tad5 5g3  in                         XZT63000.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCAAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTCAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAAATTGTCTGTTACTTCTGATATTAGCCATTTTCCTCATTGTATCACTTTTTTACTATCCTTGCTTTGTTTTCAGCCCTGTTATAAAGCACACTCCCTTTCTCTCCTTTCATTTTCATAATACCTCATTCACATCAATCACTTACCAGAATACATTTATATATAAGTAAATTGAATGTTTTTGTTTTTAAATACTTTTCAGGCTCTTTTGACGATTATCTTAAATCAGTTATAATGTGAATGTGATTCCAATGTCTCTGCTGTCAGCTGTGCTATATAAACCATGCACAGAAAATTGCCCTGTTTGACATAGGTTAGTTATCTGAGAAATTGTAAAATGTGCCTGCTCTTACTAAATGGTTTTTACTGCAAATATGTTTTTTAGATAAAACTATATTTT
  5   1   2  SIG                                      Xt7.1-CABI8399.5                                                                                  CAACGGTTGCACAGCAACAGGCGGAGTCTACCAAAGTGAGAATTAGAAGGGGCAAAAAGCTAAGACAAGGAGCCGGTTTTCAGAGGGGGTCCGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCAAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTTAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAAATTGTCTGTTACTTCTGATATTAGCCATTTTCCTCATTGTATCACTTTTTTACTATCCTTGCTTTGTTTTCAGCCCTGTTATAAAGCACACTCCCTTTCTCTCCTTTCATTTTCATAATACCTCATTCACATCAATCACTTACCAGAATACATTTATATATAAAGTAAATTGAATGTTTTTGTTTTTAAATACTTTTCAGGCTCTTTTGACGATTATCTTAAATCAGTTATAATGTGAATGTGATTCCAATGTCTCTGCTGTCAGCTGTGCTATATAAACCATGCACAGAAAATTGCCCTGTTTGACATAGGTTAGTTATCTGAGAAATTGTAAAATGTGCCTGCTCTTACTAAATGGTTTTTACTGCAAATATGTTTTTTAGATAAAACTATATTTTAAG
                                                  Xt7.1-CHK-1008293298                                                                                        TTGCACAGCAACAGGCGGAGTCTACCAAAGTGAGAATTAGAAGGGGCAAAAAGCTAAGACAAGGAGCCGGTTTTCAGAGGGGGTCCGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCAAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTTAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAAATTGTCTGTTACTTCTGATATTAGCCATTTTCCTCATTGTATCACTTTTTTACTATCCTTGCTTTGTTTTCAGCCCTGTTATAAAGCACACTCCCTTTCTCTCCTTTCATTTTCATAATACCTCATTCACATCAATCACTTACCAGAATACATTTATATATAAAGTAAATTGAATGTTTTTGTTTTTAAATACTTTTCAGGCTCTTTTGACGATTATCTTAAATCAGTTATAATGTGAATGTGATTCCAATGTCTCTGCTGTCAGCTGTGCTATATAAACCATGCACAGAAAATTGCCCTGTTTGACATAGGTTAGTTATCTGAGAAATTGTAAAATGTGCCTGCTCTTACTAAATGGTTTTTACTGCAAATATGTTTTTTAGATAAAACTATATTTTAAGAAAAAG
  5   1   1           Egg  FL                     TEgg074d17.FL-Sanger                                                                                                                                                                GCAGAGCCGGACACATAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCAAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTCAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAAATTGTCTGTTACTTCTGATATTAGCCATTTTCCTCATTGTATCACTTTTTTACTATCCTTGCTTTGTTTTCAGCCCTGTTATAAAGCACACTCCCTTTCTCTCCTTTCATTTTCATAATACCTCATTCACATCAATCACTTACCAGAATACATTTATATATAAAGTAAATTGAATGTTTTTGTTTTTAAATACTTTTCAGGCTCTTTTGACGATTATCTTAAATCAGTTATAATGTGAATGTGATTCCAATGTCTCTGCTGTCAGCTGTGCTATATAAACCATGCACAGAAAATTGCCCTGTTTGACATAGGTTAGTTATCTGAGAAATTGTAAAATGTGCCTGCTCTTACTAAATGGTTTTTACTGCAAATATGTTTTTTAGATAAAACTATATTTTAAGAAAAAGAAAAAAAAAAAAAAAAAA
  5   1   0       chi AbdN 5g                            IMAGE:7023467      CTAAGACAAGGAGCCGGTTTTCAGAGGGGGTCCGGTGAGATTTATGTTGCAGTTGTGCGGTTAGGGGAAGCATTTATAGCGGGATGTAAAAGAGGGCGAAAAATATTTAGAGCTAATAAACTGGTAAAGCGCTTACATCTTACCCTACTGCGGTGTTATATACGCAAAGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCGTCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCANGGACTTTTGAACGATACGGGGGTGGAGTGGTTCTTGATTTTTGCAGAAGTGCTAAAGAACTTGTTCCCCTGGTTTTTCCAAATGAATTATTTTTTGGTGCCACAGGGAACATATGCACCTGAAAATAAATCCAGCAAAGAACATTTTTTATTGGAAATTAACCTTGGTGAACCACCCTCAAAACCAGAAAATCCCTGGCGTCACGAAATATTTAAATGGAAGCCCCCCTTTTTTTTTTCAAAACCCCTTTCTTTCAATATAAACAACTTGC
  5   1   2   12  ext Gas7 5g3  in                         XZG40304.5p .........................................................................GCTGTATGCAACGGTTGCACAGCAACAGGCGGAGTCTACCAAAGTGAGAATTAGAAGGGGCAAAAAGCTAAGACAAGGAGCCGGTTTTCAGAGGGGGTCCGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCANACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCT
  5   1   3   14   nb Te5  5g3  in                        CAAO10166.5p .................................................................................CAACGGTTGCACAGCAACAGGCGGAGTCTACCAAAGTGAGAATTAGAAGGGGCAAAAAGCTAAGACAAGGAGCCGGTTTTCAGAGGGGGTCCGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCANACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTNCACCCTTCTTAAT
  5   1   3        nb TpA  5g3  in                   TTpA067h21.p1kSP6                                                                                      GGTTGCACAGCAACAGGCGGAGTCTACCAAAGTGAGAATTAGAAGGGGCAAAAAGCTAAGACAAGGAGCCGGTTTTCAGAGGGGGTCCGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCGTCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCANACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTCAATAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTGACATTTATCCTCCCTCNNCTTCTACTAACATCTCTTACACTTTCCC
  5   1   3   32   nb Gas7 5g                              XZG13647.5p ................................................................................................CACAGGCGGAGTCTACCAAAGTGAGAATTAGAAGGGGCAAAAAGCTAAGCCAAGGAGCCGGTTTTCAGAGGGGGTCCGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCGAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATATGGGGTGGAGTGTTCTTGATTTTGCAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCCCAAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTTCTCA
  5   1   2       add Gas  5g                        TGas038h02.p1kSP6                                                                                                                tgtctgcagnatgactcactctctcccttcctggggaactgcctgcatgcagAGCCGGACACATAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAA
  5   1   3   10   nb Ovi1 5g3  in                         CABI8942.5p .....................................................................................................................TGAGAATTAGAAGGGGCAAAAAGCTAAGACAAGGAGCCGGTTTTCAGAGGGGGTCCGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCANACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTTAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAATTGTCTNGTACTTCTGATATTAGCCATTTTCCTCATTGTATCAC
  5   1   2   12  ext Tad5 5g3  in                         XZT70519.5p .....................................................................................................................CCCACGCGTCCGGGGGCAAAAAGCTAAGACAAGGAGCCGGTTTTCAGAGGGGGTCCGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCANACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTTAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCNCTTCTACTAACATCTCTTACACTTTCCCAAAATG
  5   1   2       add Tad0 5g                            IMAGE:6983951                                                                                                                                    AGAGCAAGGGGCTGAGTACCGGGGTCCGGAATTCCNCGGGATGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCAAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTAACCCTTCTTATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAC
  5   1   3        nb Te5       in                         CAAO2356.5p                                                                                                                                        AAAAGCTAAGACAAGGAGCCGGTTTTCAGAGGGGGTCCGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCANACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCCTTCTAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTC
  5   1   2       add Neu  5g                        TNeu032b16.p1kSP6                                                                                                                                                  CTAAGACAAGGAGCCGGTTTTCAGAGGGGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGAT
  5   1   2       ext Egg  FL   in                  TEgg074d17.p1kSP6w                                                                                                                                                                 CAGAGCCGGACACATAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTAT
  5   1   3        nb Gas  5g                        TGas037o20.p1kSP6                                                                                                                                                                         GGTCCGTAATGGCAGAGGTTCACATCATAGGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCAAACAGAATCCTGCTC
  5   1   3        nb Egg                            TEgg128o16.p1kSP6                                                                                                                                                                            CCGTAATGGCAGAGGTTCACATCATAAGGCAAATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCATCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGTGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATT
  5   1   4      seed Ovi1      in                         CABI8399.5p                                                                                                                                                                                                           AATTATTGGGGCTAGTGGCTTCCCCCAACACAGCCTGTTTTGCAAATGGGGAGTACACACAGGTGGAGCCTGGAAGCTACTTTCTGGGGTTGTGGAAGGCCAGACACAAGTAGATCGTCCACAAAATGATGACATGGCATTCTGGTCTCACCCTATTGACATGCACTTTGCTACTAAAGGATTACAAGGTTGGCCAAAACTTCACCTTCAAGTCTGGCATCAGGACACATTTGGTCGTAATGAACTTTATGGTTACAGCTTCCTCCACATCCCTTCCACCCCTGGTACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCAAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTCAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAAATTGTCTGTTACTTCTGATATTAGCCATTTTCCTCATTGTATCACTTTTTTACTATCCTTGCTTTGTTTTCAGCCCCTGTATAAAGCACACTCCCTTTCTCTCCTTTCATTTTCA
  3   1   3        nb Ovi1 5g3  in                         CABI8942.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTCACTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCAAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTTAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAAATTGTCTGTTACTTCTGATATTAGCCATTTTCCTCATTGTATCACTTTTTTACTATCCTTGCTTTGTTTTCAGCCCTGTTATAAAGCACACTCCCTTTCTCTCCTTTCATTTTCATAATACCTCATTCACATCAATCACTTACCAGAATACATTTATATATAAAGTAAATTGAATGTTTTTGTTTTTAAATACTTTTCAGGCTCTTTTGACGATTATCTTAAATCAGTTATAATGTGAATGTGATTCCAATGTCTCTGCTGTCAGCTGTGCTATATAAACCATGCACAGAAAATTGCCCTGTTTGACATAGGTTAGTTATCTGAGAAATTGTAAAATGTGCCTGCTCTTACTAAATGGTTTTTACTGCAAATATGTTTTTTAGATAAAACTATATTTAAAAAAAAACCTCTC
  3   1   2       ext Egg  FL   in                    TEgg074d17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCATTGCTTAGCCCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCAAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTCAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAAATTGTCTGTTACTTCTGATATTAGCCATTTTCCTCATTGTATCACTTTTTTACTATCCTTGCTTTGTTTTCAGCCCTGTTATAAAGCACACTCCCTTTCTCTCCTTTCATTTTCATAATACCTCATTCACATCAATCACTTACCAGAATACATTTATATATAAAGTAAATTGAATGTTTTTGTTTTTAAATACTTTTCAGGCTCTTTTGACGATTATCTTAAATCAGTTATAATGTGAATGTGATTCCAATGTCTCTGCTGTCAGCTGTGCTATATAAACCATGCACAGAAAATTGCCCTGTTTGACATAGGTTAGTTATCTGAGAAATTGTAAAATGTGCCTGCTCTTACTAAATGGTTTTTACTGCAAAAATGTTTTTTAGATAAAACTATATTTTAAGAAAAAGAAAAAAAAAAAAAAAAAA
  5   1   3        nb Neu5      in                          ANHP818.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAACCTGGCGACCCCTGGGAACATGGCAGGAGCAAATATGTCAGATGTTTGTTGGCGGCGGCCCACAACTTAAGTCATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCAAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTTAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAAATTGTCTGTTACTTCTGATATTAGCCATTTTCCTCATTGTATCACTTTTTTACTATCCTTGCTTTGTTTTCAGCCCTGTTATAAAGCACACTCCCTTTCTCTCCTTTCATTTTCATAATACCTCATTCACATCAATCACTTACCAGAATACATTTATATATAAAGTAAATTGAATGTTTTTGTTTTTAAATACTTTTCAGGCTCTTTTGACGATTATCTTAAATCAGTTATAATGTGAATGTGATTCCAATGTCTCTGCTGTCAGCTGTGCTATATAAACCATGCACAGAAAATTGCCCTGTTTGACATAGGTTAGTTATCTGAGAAATTGTAAAATGTGCCTGCTCTTACTAAATGGTTTTTACTGCAAATATGTTTTTTAGATAAAACTATATTTTAAGAAAAAAAAAAAAAAAAAAACTCGAG
  3   1   3        nb Neu5      in                          ANHP818.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATCCAGCCTGATTTATGGAGGGTTTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCAAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTTAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAAATTGTCTGTTACTTCTGATATTAGCCATTTTCCTCATTGTATCACTTTTTTACTATCCTTGCTTTGTTTTCAGCCCTGTTATAAAGCACACTCCCTTTCTCTCCTTTCATTTTCATAATACCTCATTCACATCAATCACTTACCAGAATACATTTATATATAAAGTAAATTGAATGTTTTTGTTTTTAAATACTTTTCAGGCTCTTTTGACGATTATCTTAAATCAGTTATAATGTGAATGTGATTCCAATGTCTCTGCTGTCAGCTGTGCTATATAAACCATGCACAGAAAATTGCCCTGTTTGACATAGGTTAGTTATCTGAGAAATTGTAAAATGTGCCTGCTCTTACTAAATGGTTTTTACTGCAAATATGTTTTTTAGATAAAACTATA
  3   1   2       ext Gas7 5g3  in                         XZG40304.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCAAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTTAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAAATTGTCTGTTACTTCTGATATTAGCCATTTTCCTCATTGTATCACTTTTTTACTATCCTTGCTTTGTTTTCAGCCCTGTTATAAAGCACACTCCCTTTCTCTCCTTTCATTTTCATAATACCTCATTCACATCAATCACTTACCAGAATACATTTATATATAAAGTAAATTGAATGTTTTTGTTTTTAAATACTTTTCAGGCTCTTTTGACGATTATCTTAAATCAGTTATAATGTGAATGTGATTCCAATGTCTCTGCTGTCAGCTGTGCTATATAAACCATGCACAGAAAATTGCCCTGTTTGACATAGGTTAGTTATCTGAGAAATTGTAAAATGTGCCTGCTCTTACTAAATGGTTTTTACTGCAAATATGTTTTTTAGATAAAACTATATTTTAAG
  3   1   3        nb Te5       in                         CAAO2356.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAGCCTGATTTATGGAGGGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCAAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTTAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAAATTGTCTGTTACTTCTGATATTAGCCATTTTCCTCATTGTATCACTTTTTTACTATCCTTGCTTTGTTTTCAGCCCTGTTATAAAGCACACTCCCTTTCTCTCCTTTCATTTTCATAATACCTCATTCACATCAATCACTTACCAGAATACATTTATATATAAAGTAAATTGAATGTTTTTGTTTTTAAATACTTTTCAGGCTCTTTTGACGATTATCTTAAATCAGTTATAATGTGAATGTGATTCCAATGTCTCTGCTGTCAGCTGTGCTATATAAACCATGCACAGAAAATTGCCCTGTTTGACATAGGTTAGTTATCTGAGAAATTGTAAAATGTGCCTGCTCTTACTAAATGGTTTTTACTGCAAATATGTTTTTTAGATAAAACTATATTTTAGG
  3   1   2       ext Tad5 5g3  in                         XZT70519.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGTCTGATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCAAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTTAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAAATTGTCTGTTACTTCTGATATTAGCCATTTTCCTCATTGTATCACTTTTTTACTATCCTTGCTTTGTTTTCAGCCCTGTTATAAAGCACACTCCCTTTCTCTCCTTTCATTTTCATAATACCTCATTCACATCAATCACTTACCAGAATACATTTATATATAAAGTAAATTGAATGTTTTTGTTTTTAAATACTTTTCAGGCTCTTTTGACGATTATCTTAAATCAGTTATAATGTGAATGTGATTCCAATGTCTCTGCTGTCAGCTGTGCTATATAAACCATGCACAGAAAATTGCCCTGTTTGACATAGGTTAGTTATCTGAGAAATTGTAAAATGTGCCTGCTCTTACTAAATGGTTTTTACTGCAAATATGTTTTTTAGATAAAACTATATTTTTGG
  3   1   3        nb Te5  5g3  in                        CAAO10166.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATCGCTACCGTCTGCAAACAGTGGCCATGGGGCAAGTACATCTCCAATTAACGGTCATACTCAGGAACTTTGAACGATACGGGGTGGAGTGTTCTTGATTTTGCAGAGTGCTAAGAACTTGTTCCTGGTTTTCCAAATGATTATTTTTGGTGCCAAGGACATATGCACTGAAATAATCAGCAAGACATTTTATGGAATTACTTGTGAACACCTCAAACAGAATCCTGCTCAGTATTTAATGAGCCCCTTTTCTCAACCCTTCTTAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAAATTGTCTGTTACTTCTGATATTAGCCATTTTCCTCATTGTATCACTTTTTTACTATCCTTGCTTTGTTTTCAGCCCTGTTATAAAGCACACTCCCTTTCTCTCCTTTCATTTTCATAATACCTCATTCACATCAATCACTTACCAGAATACATTTATATATAAAGTAAATTGAATGTTTTTGTTTTTAAATACTTTTCAGGCTCTTTTGACGATTATCTTAAATCAGTTATAATGTGAATGTGATTCCAATGTCTCTGCTGTCAGCTGTGCTATATAAACCATGCACAGAAAATTGCCCTGTTTGACATAGGTTAGTTATCTGAGAAATTGTAAAATGTGCCTGCTCTTACTAAATGGTTTTTACTGCAAATATGTTTTTTAGATAAAACTATATTTTAAG
  3   1   3        nb TpA  5g3  in                   TTpA067h21.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTGACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAAATTGTCTGTTACTTCTGATATTAGCCATTTTCCTCATTGTATCACTTTTTTACTATCCTTGCTTTGTTTTCAGCCCTGTTATAAAGCACACTCCCTTTCTCTCCTTTCATTTTCATAATACCTCATTCACATCAATCACTTACCAGAATACATTTATATATAAAGTAAATTGAATGTTTTTGTTTTTAAATACTTTTCAGGCTCTTTTGACGATTATCTTAAATCAGTTATAATGTGAATGTGATTCCAATGTCTCTGCTGTCAGCTGTGCTATATAAACCATGCACAGAAAATTGCCCTGTTTGACATAGGTTAGTTATCTGAGAAATTGTAAAATGTGCCTGCTCTTACTAAATGGTTTTTACTGCAAAATATGTTTTTTAGATAAAACTATATTTTAAGAAAAAAAAAAAAAAAAAAAAA
  3   1   4      seed Ovi1      in                         CABI8399.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATAAACCTGATACTTCATATCTCTTCTGTACCATAATCTGGTAACATTTATCCTCCTCCCCTTCTACTAACATCTCTTACACTTTCCCAAATTGTCTGTTACTTCTGATATTAGCCATTTTCCTCATTGTATCACTTTTTTACTATCCTTGCTTTGTTTTCAGCCCTGTTATAAAGCACACTCCCTTTCTCTCCTTTCATTTTCATAATACCTCATTCACATCAATCACTTACCAGAATACATTTATATATAAAGTAAATTGAATGTTTTTGTTTTTAAATACTTTTCAGGCTCTTTTGACGATTATCTTAAATCAGTTATAATGTGAATGTGATTCCAATGTCTCTGCTGTCAGCTGTGCTATATAAACCATGCACAGAAAATTGCCCTGTTTGACATAGGTTAGTTATCTGAGAAATTGTAAAATGTGCCTGCTCTTACTAAATGGTTTTTACTGCAAATATGTTTTTTAGATAAAACTATATTTTAAGAAAAAGAAATGGTAAGCGAGTATTCTTTGCTGTAGGAAATAATGTTGCAATTTGTAAGCCACAAGAAGGCTCTGTAGGTAACTAGAATTATGCTATTATTTAAATATTACAATTAACGGGGAGAACCCATTTAATAAGGATTTAAAAAAATATATATGCTAAAAGTTGGGTAACAAGTAGCGTTAGTCAGTGAGTAACTAAACAAGCAAATATGAATTTGGCTAGTAAATAAACTACATAATTATGGAGTTATGTAATAAAAGTTGCAGAGATTGCTACAGGTTTGTACAAAAAAAGCCTCTCGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)