Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 29 Mar 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 83%

 1012075365 Xt7.1-XZG60011.3 - 49 ESTs
                                                                       -40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG60011.3                                         GGACAAGCATGGATTCTGGGCCCGAAGAGCTGATGCCCAGGCTGCTGCCGGTTGGCAATTGTGACCTCCCAGAGGATTTTGATCCAGCGGTGCCCCCTCGGACCCCTCAGGAGTACTTGCGGAGAGTGCAGATTGAAGCAGCACGGTGTCCAGATGTTGTCATTGCACAGATTGATCCAAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCAGGGTGCCAGCCTGCTCCCGAAGGGTACTCTCCAAGCCTCCGCTGGCAGCAACAACAAGTAGCGCAGTTTTCTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGCATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTACGCACTACTGGCCTGCCTGGAGAAACCATTGCTGCCTGAAGCTCACTCTCTTATTAGGCAGTTGGCACGGAGATGCTCACAAGTCAGAGCTGGGGTGGAACATAAGGAAGATGAACGGGTGTCTGCGCTGAACCTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAACGGGATTTGGCTGATTGTGGTGACCCATCTTGATATGATTGGGCAGCTTTACCAACCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATGAAGGTGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTGACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATAAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGAACCAAGTGCTTCCTAAAACATCTGCCTTCTTTTTAATTGGCTGGCCGGGTTGAGTTATTTTTTTAATATGGAAGACTTTCCAAATCTGTCTTACAGAGGCCGCCCAAGCACAGAGTATGCATTGACTTCTTTTAGCAGATGTGTAACATTTTCTTGCATTTCTGTACATAAATTCTTTTTTTTAGATTGT
                                                  Xt7.1-CHK-1008225760                                               GCATGGATTCTGGGCCCGAAGAGCTGATGCCCAGGCTGCTGCCGGTTGGCAATTGTGACCTCCCAGAGGATTTTGATCCAGCGGTGCCCCCTCGGACCCCTCAGGAGTACTTGCGGAGAGTGCAGATTGAAGCAGCACGGTGTCCAGATGTTGTCATTGCACAGATTGATCCAAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCAGGGTGCCAGCCTGCTCCCGAAGGGTACTCTCCAAGCCTCCGCTGGCAGCAACAACAAGTAGCGCAGTTTTCTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGCATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTACGCACTACTGGCCTGCCTGGAGAAACCATTGCTGCCTGAAGCTCACTCTCTTATTAGGCAGTTGGCACGGAGATGCTCACAAGTCAGAGCTGGGGTGGAACATAAGGAAGATGAACGGGTGTCTGCGCTGAACCTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAACGGGATTTGGCTGATTGTGGTGACCCATCTTGATATGATTGGGCAGCTTTACCAACCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATGAAGGTGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTGACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATAAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGAACCAAGTGCTTCCTAAAACATCTGCCTTCTTTTTAATTGGCTGGCCGGGTTGAGTTATTTTTTTAATATGGAAGACTTTCCAAATCTGTCTTACAGAGGCCGCCCAAGCACAGAGTATGCATTGACTTCTTTTAGCAGATGTGTAACATTTTCTTGCATTTCTGTACATAAATTCTTTTTTTTTGATTGTGAAGAA
                                                      consensus depths                                              2     3     9     9    11    11    11    12    13    15    14    15    14    16    14    16    14    16    15    16    15    16    15    16    15    16    15    16    15    16    16    17    16    17    16    17    17    18    17    18    18    18    18    18    18    18    18    19    18    19    20    20    20    20    20    20    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    20    20    20    20    20    20    20    20    19    20    17    20    17    20    17    20    17    20    15    18    14    17    12    14    10    12    11    13    11    12    11    12    10    11    10    11    10    11    15    16    15    17    16    18    18    20    17    20    17    20    18    21    19    22    20    22    20    23    21    26    22    27    20    26    19    24    20    25    19    25    19    24    19    24    20    26    20    26    20    26    21    27    21    27    24    27    23    27    25    28    25    28    24    27    24    27    23    26    23    25    23    25    23    25    23    25    23    25    23    25    23    25    22    23    22    23    22    23    22    23    22    23    22    23    22    23    22    23    22    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    22    23    22    23    21    23    21    23    21    23    22    23    22    23    22    23    22    23    22    23    22    23    22    22    22    22    19    20    16    18     5     8     5     5     5     5     6     6     5     6     5     6     5     6     5     6     5     6     4     4     4     4     4     4     4     4     4     4     2     3
                                                                   SNP                                                                                         ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         C-----------
                                               BLH ATG       8     128                                         
                                               BLH OVR       8      75                                         
                                               EST CLI       8      41                                         
                                               ORF LNG       8       4                                         
                                                                                                                                         PROTEIN --- Ce ---- 1e-018     NP_001022847.1 SMN (survival of motor neuron) protein Interactor family member (smi-1) [Caenorhabditis elegans] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                       PROTEIN === Dm ==== 8e-026     NP_649092.1 CG10419-PA [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                   PREDICTED = Sp ==== 2e-047     XP_790467.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PREDICTED = Dr ==== 2e-100     NP_001017608.1 hypothetical protein LOC550271 [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                        PROTEIN --- Mm ---= 3e-118     NP_079932.1 survivor of motor neuron protein interacting protein 1 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Hs ---- 1e-119     NP_003607.1 survival of motor neuron protein interacting protein 1 [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                       PROTEIN === Gg ==== 1e-123     NP_001034391.1 survival of motor neuron protein interacting protein 1 [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PREDICTED = ?? ==== 1e-145     NP_001087945.1 hypothetical protein LOC494588 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PROTEIN === Xl ==== 2e-146     AAB82298.1 survival of motor neuron protein interacting protein 1; SIP1; SMN protein interacting protein 1 [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                       PROTEIN === Xt ==== 4e-156     AAI22059.1 Unknown (protein for MGC:147332) [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG60011.3                                                 ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------ATG------------------------------TAG------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------TAA---------------------------------------TAA------------------------------------------------------------------------------ATG---------TGA------------TAG------------------------------------------------------------------------------ATG---------TAA------------------------------------------------------TGA---TAA------------------------------------------TAA---------------------------TAA------------------------------------------------------------------TAG---ATG---------------------------TAA
                                                                   ORF                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  0   1   1           Ovi1 FL                         CABI14223.FL-MGC                                        CGGACAAGCATGGATTCTGGGCCCGAAGAGCTGATGCCCAGGCTGCTGCCGGTTGGCAACTGTGACCTCCCAGAGGATTTTGATCCAGCGGTGCCCCCTCGGACCCCTCAGGAGTACTTGCGGAGAGTGCAGATTGAAGCAGCACGGTGTCCAGATGTTGTCATTGCACAGATTGATCCAAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCAGGGTGCCAGCCTGCTCCCGAAGGGTACTCTCCAAGCCTCCGCTGGCAGCAACAACAAGTAGCGCAGTTTTCTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGCATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTACGCACTACTGGCCTGCCTGGAGAAACCATTGCTGCCTGAAGCTCACTCTCTTATTAGGCAGTTGGCACGGAGATGCTCACAAGTCAGAGCTGGGGTGGAACATAAGGAAGATGAACGGGTGTCTGCGCTGAACCTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAACGGGATTTGGCTGATTGTGGTGACCCATCTTGATATGATTGGGCAGCTTTACCAACCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATGAAGGTGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTGACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATAAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGAACCAAGTGCTTCCTAAAAAAAAAAAAAAAAAA
  5   1   2   12  bld Gas7 5g3  in                         XZG61929.5p .............CGGACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGTGGATTCTGGGCCCGAAGAGCTGATGCCCAGGCTGCTGCCGGTTGGCAATTGTGACCTCCCAGAGGATTTTGATCCAGCGGTGCCCCCTCGGACCCCTCAGGAGTACTTGCGGAGAGTGCAGATTGAAGCAGCACGGTGTCCAGATGTTGTCATTGCACAGATTGATCCAAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCAGGGTGCCAGCCTGCTCCCGAAGGGTACTCTCCAAGCCTCCGCTGGCAGCAACAACAAGTAGCGCAGTTTTCTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGAATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTACGCACTACTGGCCTGCCTGGAGAAACCATTGCTGCCTGAAGCTCACTCTCTTATTAGGCAGTTGGCACGGAGATGCTCACAAGTCAGAGCTGGGGTGGAACATAAGGAAGATGAACGGGTGTCTGCGCTGAACCTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAACGGGGATTGGCTGATT
  5   1   2       bld Ovi1 FL   in                        CABI14223.5p                             CCATCGATTCGCGGACAAGCATGGATTCTGGGCCCGAAGAGCTGATGCCCAGGCTGCTGCCGGTTGGCAACTGTGACCTCCCAGAGGATTTTGATCCAGCGGTGCCCCCTCGGACCCCTCAGGAGTACTTGCGGAGAGTGCAGATTGAAGCAGCACGGTGTCCAGATGTTGTCATTGCACAGATTGATCCAAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCAGGGTGCCAGCCTGCTCCCGAAGGGTACTCTCCAAGCCTCCGCTGGCAGCAACAACAAGTAGCGCAGTTTTCTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGCATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTACGCACTACTGGCCTGCCTGGAGAAACCATTGCTGCCTGAAGCTCACTCTCTTATTAGGCAGTTGGCACGGAGATGCTCACAAGTCAGAGCTGGGGTGGAACATAAGGAAGATGAACGGGTGTCTGCGCTGAACCTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAACGGGATTTGGCTGATTGTGGTGACCCATCTTGATATGATTGGGCAGCTTTACCAACCCCCCCTACCCTCCATCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATT
  5   1   2       bld 1030 5g                         IMAGE:7092035.5p                                  GAGAGCAGGACAAGCATGGATTCTGGGCCCGAAGAGCTGATGCCCAGGCTGCTGCCGGTTGGCAATTGTGACCTCCCAGAGGATTTTGATCCAGCGGTGCCCCCTCGGACCCCTCAGGAGTACTTGCGGAGAGTGCAGATTGAAGCAGCACGGTGTCCAGATGTTGTCATTGCACAGATTGATCCAAAGAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCAGGGTGCCAGCCTGCTCCCGAAGGGTACTCTCCAAGCCTCCGCTGGCAGCAACAACAAGTAGCGCAGTTTTCTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGAATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTAGCACTACTGGCCTGCCTGAAGAAACATTGCTGCCTGAAGCCACTCTCTTTTAGGCATTTGCACGAGATGCTACAATCAGAGCTGGGTGGACATAGGAAATAA
  5   1   2       bld Egg  5g3  in                   TEgg048m10.p1kSP6                                                 ATGGATTCTGGGCCCGAAGAGCTGATGCCCAGGCTGCTGCCGGTTGGCAATTGTGACCTCCCAGAGGATTTTGATCCAGCGGTGCCCCCTCGGACCCCTCAGGAGTACTTGCGGAGAGTGCAGATTGAAGCAGCACGGTGTCCAGATGTTGTCATTGCACAGATTGATCCAAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCAGGGTGCCAGCCTGCTCCCGAAGGGTACTCTCCAAGCCTCCGCTGGCAGCAACAACAAGTAGCGCAGTTTTCTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGCATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTACGCACTACTGGCCTGCCTGGAGAAACCATTGCTGCCTGAAGCTCA
  5   1   2       bld Egg                            TEgg110b07.p1kSP6                                                  TGGATTCTGGGCCCGAAGAGCTGATGCCCAGGCTGCTGCCGGTTGGCAATTGTGACCTCCCAGAGGATTTTGATCCAGCGGTGCCCCCTCGGACCCCTCAGGAGTACTTGCGGAGAGTGCAGATTGAAGCAGCACGGTGTCCAGATGTTGTCATTGCACAGATTGATCCAAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCAGGGTGCCAGCCTGCTCCCGAAGGGTACTCTCCAAGCCTCCGCTGGCAGCAACAACAAGTAGCGCAGTTTTCTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGAATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTACGCACTACTGGCCTGCCTGGAGAAACCATTGCTGCCTGAAGCTC
  5   1   2       bld Egg                            TEgg136d17.p1kSP6                                                  TGGATTCTGGGCCCGAAGAGCTGATGCCCAGGCTGCTGCCGGTTGGCAACTGTGACCTCCCAGAGGATTTTGATCCAGCGGTGCCCCCTCGGACCCCTCAGGAGTACTTGCGGAGAGTGCAGATTGAAGCAGCACGGTGTCCAGATGTTGTCATTGCACAGATTGATCCAAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCAGGGTGCCAGCCTGCTCCCGAAGGGTACTCTCCAAGCCTCCGCTGGCAGCAACAACAAGTAGCGCAGTTTTCTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGCATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTACGCACTACTGGCCTGCCTGGAGAACCATTGCTGCCTGAAGCT
  5   1   2       bld Gas                            TGas111e23.p1kSP6                                                  TGGATTCTGGGCCCGAAGAGCTGATGCCCAGGCTGCTGCCGGTTGGCAATTGTGACCTCCCAGAGGATTTTGATCCAGCGGTGCCCCCTCGGACCCCTCAGGAGTACTTGCGGAGAGTGCAGATTGAAGCAGCACGGTGTCCAGATGTTGTCATTGCACAGATTGATCCAAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCAGGGTGCCAGCCTGCTCCCGAAGGGTACTCTCCAAGCCTCCGCTGGCAGCAACAACAAGTAGCGCAGTTTTCTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGCATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGA
  5   1   2       bld Gas       in                   TGas132f09.p1kSP6                                                   CCGGGCTGGGCCCGAAGAGCTGATGCCCAGGCTGCTGCCGGTTGGCAATTGTGACCTCCCAGAGGATTTTGATCCAGCGGTGCCCCCTCGGACCCCTCAGGAGTACTTGCGGAGAGTGCAGATTGAAGCAGCACGGTGTCCAGATGTTGTCATTGCACAGATTGATCCAAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCAGGGTGCCAGCCTGCTCCCGAAGGGTACTCTCCAAGCCTCCGCTGGCAGCAACAACAAGTAGCGCAGTTTTCTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGCATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTACGCACTACTGGCCTGCCTGGAGAAACCATTGC
  5   1   2       bld Gas7      in                         XZG55049.5p                                                    GATTCTGGGCCCGAAGAGCTGATGCCCAGGCTGCTGCCGGTTGGCAATTGTGACCTCCCAGAGGATTTTGATCCAGCGGTGCCCCCTCGGACCCCTCAGGAGTACTTGCGGAGAGTGCAGATTGAAGCAGCACGGTGTCCAGATGTTGTCATTGCACAGATTGATCCAAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCAGGGTGCCAGCCTGCTCCCGAAGGGTACTCTCCAAGCCTCCGCTGGCAGCAACAACAAGTAGCGCAGTTTTCTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGAATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTACGCACTACTGGCCTGCCTGGAGAAACATTGCTGCCTGAAGCTCACTCTCTTATTAGGCAGTTGGCACGGAGATGCTC
  5   1   2       bld Egg                            TEgg117b22.p1kSP6                                                      TTCTGGGCCCGAAGAGCTGATGCCCAGGCTGCTGCCGGTTGGCAATTGTGACCTCCCAGAGGATTTTGATCCAGCGGTGCCCCCTCGGACCCCTCAGGAGTACTTGCGGAGAGTGCAGATTGAAGCAGCACGGTGTCCAGATGTTGTCATTGCACAGATTGATCCAAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCAGGGTGCCAGCCTGCTCCCGAAGGGTACTCTCCAAGCCTCCGCTGGCAGCAACAACAAGTAGCGCAGTTTTCTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGCATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAAAGCTGGGTCGTTGGCTTTACGCACTACTGGCCTGCCTGGA
  5   1   2       bld Egg                            TEgg117b23.p1kSP6                                                      TTCTGGGCCCGAAGAGCTGATGCCCAGGCTGCTGCCGGTTGGCAATTGTGACCTCCCAGAGGATTTTGATCCAGCGGTGCCCCCTCGGACCCCTCAGGAGTACTTGCGGAGAGTGCAGATTGAAGCAGCACGGTGTCCAGATGTTGTCATTGCACAGATTGATCCAAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCAGGGTGCCAGCCTGCTCCCGAAGGGTACTCTCCAAGCCTCCGCTGGCAGCAACAACAAGTAGCGCAGTTTTCTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGCATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAAGGAACTTTACTCCAGAGCTGGGTCGGTGGCTTTACGCACTACTGGCCTGCCTGG
  5   1   2       bld Gas                            TGas004a03.p1kSP6                                                                         TGATGCCCAGGCTGCTGCCGGTTGGCAACTGTGACCTCCCAGAGGATTTTGATCCAGCGGTGCCCCCTCGGACCCCTCAGGAGTACTTGCGGAGAGTGCAGATTGAAGCAGCACGGTGTCCAGATGTTGTCATTGCACAGATTGATCCAAAAAATTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCAGGGTGCCAGCCTGCTCCCGAAGGTACTCTCCAAGCCTCCGCTGGCAGCAACAACAAGTAGCGCAGTTTTCTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGCATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTACGCACTACTGGCCTGCCTGGAGAAACCATTGCTGCCTGAAGCTCACTCTC
  3  -1   2       bld Ovi1      in                         CABI1464.3p                                                                              CTCCTATAGGGCGAGAGGCAACTGTGACCTCCCAGAGGATTTTGATCCAGCGGTGCCCCCTCGGACCCCTCAGGAGTACTTGCGGAGAGTGCAGATTGAAGCAGCACGGTGTCCAGATGTTGTCATTGCACAGATTGATCCAAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCAGGGTGCCAGCCTGCTCCCGAAGGGTACTCTCCAAGCCTCCGCTGGCAGCAACAACAAGTAGCGCAGTTTTCTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGCATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTACGCACTACTGGCCTGCCTGGAGAAACCATTGCTGCCTGAAGCTCACTCTCTTATTAGGCAGTTGGCACGGAGATGCTCACAAGTCAGAGCTGGGGTGGAACATAAGGAAGATGAACGGGTGTCTGCGCTGAACCTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAACGGGATTTGGCTGATTGTGGTGACCCATCTTGATATGATTGGGCAGCTTTACCAACCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTTCCATT
  5   1   2       bld Gas7      in                         XZG60011.5p                                                                              CAGGCTGCTGCCGGTTGGCAATTGTGACCTCCCAGAGGATTTTGATCCAGCGGTGCCCCCTCGGACCCCTCAGGAGTACTTGCGGAGAGTGCAGATTGAAGCAGCACGGTGTCCAGATGTTGTCATTGCACAGATTGATCCAAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCAGGGTGCCAGCCTGCTCCCGAAGGGTACTCTCCAAGCCTCCGCTGGCAGCAACAACAAGTAGCGCAGTTTTCTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGAATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTACGCACTACTGGCCTGCCTGGAGAAACCATTGCTGCCTGAAGCTCACTCTCTTATTAGGCAGTTGGCACGGAGATGCTCACAAGTCAGAGCTGGGGTGGAACATAAGGAAGATGAACGGGTGTCTGCGCTGAACCTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAACGGGATTTGGCTGATTGTGGTGACCCATCTTGATATGATTGGGCAGCTTTACCAACCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCA
  3  -1   2       bld Lun1      in                         CABD5516.3p                                                                                    GCTGCCGGTTGGCAACTGTGACCTCCCAGAGGATTTTGATCCAGCGGTGCCCCCTCGGACCCCTCAGGAGTACTTGCGGAGAGTGCAGATTGAAGCAGCACGGTGTCCAGATGTTGTCATTGCACAGATTGATCCAAAAAAGTTGCGAAAGAAACAGACCGTAAGCATATCTCTGTCAGGGTGCCAGCCTGCTCCCGAAGGGTACTCTCCAAGCCTCCGCTGGCAGCAACAACAAGTAGCGCAGTTTTCTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGCATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTACGCACTACTGGCCTGCCTGGAGAAACCATTGCTGCCTGAAGCTCACTCTCTTATTAGGCAGTTGGCACGGAGATGCTCACAAGTCAGAGCTGGGGTGGAACATAAGGAAGATGAACGGGTGTCTGCGCTGAACCTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAACGGGATTTGGCTGATTGTGGTGACCCATCTTGATATGATTGGGCAGCTTTACCAACCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTTCCCTTCCATTCAGTGGTGCACCAACTACATAGTCTTTTGGATTCAGG
  5   1   2       bld Gas                            TGas019i14.p1kSP6                                                                                                                 AGAGGTCCGAGGGGGCACCGCTGGATCAAAATCCTCTGGAGTACTTGCGGAGAGTGCAGATTGAAGCAGCACGGTGTCCAGATGTTGTCATTGCACAGATTGATCCAAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCAGGGTGCCAGCCTGCTCCCGAAGGGTACTCTCCAAGCCTCCGCTGGCAGCAACAACAAGTAGCGCAGTTTTCTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGCATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTACGCACTACTGGCCTGCCTGGAGAAACCATTGCTGCCTGAAGCTCACTCTC
  5   1   2       bld Ova1      in                         CABE2664.5p                                                                                                                                                                                                                   ATTGATCCAAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCAGGGTGCCAGCCTGCTCCCGAAGGGTACTCTCCAAGCCTCCGCTGGCAGCAACAACAAGTAGCGCAGTTTTCTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGCATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTACGCACTACTGGCCTGCCTGGAGAAACCATTGCTGCCTGAAGCTCACTCTCTTATTAGGCAGTTGGCACGGAGATGCTCACAAGTCAGAGCTGGGGTGGAACATAAGGAAGATGAACGGGTGTCTGCGCTGAACCTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAACGGGATTTGGCTGATTGTGGTGACCCATCTTGATATGATTGGGCAGCTTTACCAACCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCC
  3  -1   2       bld Ova1      in                         CABE6561.3p                                                                                                                                                                                                                                                      TAGCATATCTCTGTCAGGGTGCCAGCCTGCTCCCGAAGGGTACTCTCCAAGCCTCCGCTGGCAGCAACAACAAGTAGCGCAGTTTTCTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGCATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTACGCACTACTGGCCTGCCTGGAGAAACCATTGCTGCCTGAAGCTCACTCTCTTATTAGGCAGTTGGCACGGAGATGCTCACAAGTCAGAGCTGGGGTGGAACATAAGGAAGATGAACGGGTGTCTGCGCTGAACCTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAACGGGATTTGGCTGATTGTGGTGACCCATCTTGATATGATTGGGCAGCTTTACCAACCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATGAAGGTGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGA
  5   1   2       bld Ski1      in                         CABJ2342.5p                                                                                                                                                                                                                                                                                                                          CTGGATCTTACATAAGATCATTTACCCCACAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGCATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTACGCACTACTGGCCTGCCTGGAGAAACCATTGCTGCCTGAAGCTCACTCTCTTATTAGGCAGTTGGCACGGAGATGCTCACAAGTCAGAGCTGGGGTGGTAAGAACCTTTTTTTTTTTTTTTTTTTGCCATTTAAACAATATGTATAAATGTGGTCTACTTAAAAATTGGATCATTTTTCAATATATCTACCTGGAACGTTAGTGCTTCATATTGTCTTCTCTCAGCCTAAACCAGGGGACCCCAAGCCCCTTGATATGAAAGCTCCTGTTTGTTGGAATCTTGTTAGAAAAAAGAGTGGAGAAATTTTAGGACCCAAACTTTATTGTTTATGCCCCTTCATTAGCATTTCCCTGATCTGATTGGCTAACGCGATTTCAGCCCGTCAGATCAATGACCAGCAAACAGGCTGCACTGTTGAGTAGCCCATGCGCCCCACTGCACTGTGACTGCGTCCGAATACTAAGCGATGTGGCCCTCCGGCTGTTAGAGAAAGAGAC
  5   1   2       bld Ovi1      in                         CABI4058.5p                                                                                                                                                                                                                                                                                                                                            CTGCTGTCCGTCAGAGTCTTCACAAACACAGGAGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGCATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTACGCACTACTGGCCTGCCTGGAGAAACCATTGCTGCCTGAAGCTCACTCTCTTATTAGGCAGTTGGCACGGAGATGCTCACAAGTCAGAGCTGGGGTGGAACATAAGGAAGATGAACGGGTGTCTGCGCTGAACCTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAACGGGATTTGGCTGATTGTGGTGACCCATCTTGATATGATTGGGCAGCTTTACCAACCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATGAAGGTGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCCAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTT
  5   1   2       bld Gas7      in                         XZG45505.5p                                                                                                                                                                                                                                                                                                                                                                                       GTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAGGAGAGCTGGAAGAAGTTCTGTTTGGGGGAAAGGCTATATTCTGACCTAGCAGCTGCCCTGAACAGTGACAGCCAGCATCCAGGAATTGATTATATAAAGGTTGGTTTCCCACCCTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACCGTAACAAGTGTGCTAGAATACTTAGTGAACTGGTTTGAAGAAAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTACGCACTACTGGCCTGCCTGGAGAAACCATTGCTGCCTGAAGCTCACTCTCTTATTAGGCAGTTGGCACGGAGATGCTCACAAGTCAGAGCTGGGGTGGAACATAAGGAAGATGAACGGGTGTCTGCGCTGAACCTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAACGGGATTTGGCTGATTGTGGTGACCCATCTTGATATGATTGGGCAGCTTTACCAACCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATCAAGGCGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAAGAGCAGCAGTCTCATTTATC
  5  -1   2       bld Ova1      in                         CABE6561.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAGGCAGTTGGCACGGAGATGCTCACAAGTCAGAGCTGGGGTGGAACATAAGGAAGATGAACGGGTGTCTGCGCTGAACCTATTCATCTGTCTGGTGGGCAGGTACTTTGAACAACGGGATTTGGCTGATTGTGGTGACCCATCTTGATATGATTGGGCAGCTTTACCAACCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATGAAGGTGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTGACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATAAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTT
  5  -1   2       bld Lun1      in                         CABD5516.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCGCTGAACCTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAACGGGATTTGGCTGATTGTGGTGACCCATCTTGATATGATTGGGCAGCTTTACCAACCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATGAAGGTGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCAAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTTACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATAAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGA
  3   1   2       bld Ovi1 FL   in                        CABI14223.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCGCTGAACCTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAACGGGATTTGGCTGATTGTGGTGACCCATCTTGATATGATTGGGCAGCTTTACCAACCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATGAAGGTGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTGACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATAAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGAACCAAGTGCTTCC
  3   1   2       bld Ovi1      in                         CABI4058.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCGCTGAACCTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAACGGGATTTGGCTGATTGTGGTGACCCATCTTGATATGATTGGGCAGCTTTACCAACCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATGAAGGTGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCAAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTTACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATAAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTAAATAAAGAGAACC
  3   1   2       bld Gas7      in                         XZG60011.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGCTGAACCTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAACGGGATTTGGCTGATTGTGGTGACCCATCTTGATATGATTGGGCAGCTTTACCAACCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATGAAGGCGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTGACTGTTTTCCCCTAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATCAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGAACCAAGTGCTTCCTAAAAAAAAAAAAAAAGG
  5   1   2      seed Ova1      in                        CABE13139.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAACCTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAACGGGATTTGGCTGATTGTGGTGACCCATCTTGATATGATTGGGCAGCTTTACCAACCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATGAAGGTGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTGACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATAAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGAACCAAGTGCTTCCTAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                        CABE13139.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCTGTCTGGTGGGCAGGTACTTTGANCAACGGGATTTGGCTGATTGTGGTGACCCATCTTGATATGATTGGGCAGCTTTACCAACCCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATGAAGGTGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTGACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATAAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGAACCAAGTGCTTCCT
  3   1   2       bld Ski1      in                         CABJ2342.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTGCTTAGGTACTTTGAACACNGGGATTTGGCTGATTGTGGTGACCCATCTTGATATGATTGGGCAGCTTTACCAACCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATGAAGGTGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCAAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTTACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATAAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGAACCAAGTGCTTCCT
  5   1   2       chi Tad5                                 XZT47407.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTTGAAAACGGGATTTGGCTGATTGTGGTGACCCATCTTGATATGATTGGGCAGCTTTACCAACCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATGAAGGCGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATCAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAG
  3  -1   2       bld Lun1      in                         CABD7559.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGGATTTGGCTGATTGTGGTGACCCATCTTGATATGATTGGGCAGCTTTACCAACCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATGAAGGTGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCAAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTTACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATAAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTNTGTAGGTCTTGATTTTAAATAAAG
  5   1   2       bld Gas                            TGas031e11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTGGCTGATTGTGGTGACCCATCTTGNTATGATTGGGCAGCTTTACCAACCCCCCCTACCCTCCATTCTCACANAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATCAAGGCGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTT
  3   1   2       bld Ova1      in                         CABE2664.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCTTGATATGATTGGGCAGCTTTACCACCCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATGAAGGTGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTGACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATAAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGAACCAAGTGCTTCCT
  3   1   2       bld Gas7 5g3  in                         XZG61929.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCTTTACCAACCCCCCCTACCCTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATGAAGGCGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATATTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTGACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATCAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGAACCCAAGTGCTTCCTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Thy1                                CBST5640.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCATTCTCACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATGAAGGTGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCACATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTGACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATAAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGAACCAAGTGCTTCCT
  5  -1   2       bld Lun1      in                         CABD7559.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATGAAGGTGCAAGGACAGGCATGGGTAATCCTCTAGCCTNTTAGATGTGGAGCCAAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTTACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATAAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGAACCAAGTGCTTCCTAAAACATCTGCCTTCTTTTTAATTGGCTGGCCGGGTTGAGTTATTTTTTAATATGGAAGACTTTCCAAATCTGTCTTACAGAGGCCGCCCAAGCCCTCGTGCCGATTGAATCGA
  3   1   2       bld Egg  5g3  in                    TEgg048m10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATCAAGGCGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTGACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATAAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGAACCAAGTGTTCCTAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas132f09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACAGAACATCTCTGCAATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATCAAGGCGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTGACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATAAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGAACCCAAGTGCTTCCTAAAAAAAAAGTCAAACAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7                                  XZG7012.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCATATCCATGCTATCCACTTCCCTTCCATTCCAGTGGTGCACCAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATGAAGGCGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTGACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATCAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGAACCAAGTGCTTCCTAAAACATCTGCCTTCTTTTTAATTGGCT
  3   1   2       bld Gas7                                 XZG35795.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACCAAATACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATGAAGGTGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTTTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCG
  3   1   2       bld Egg                             TEgg014o13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAACTACATAGTCTTTGGATTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATCAAGGCGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTGACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATAAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGAACCAAGTGTTCCTAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG45505.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCAGGACACTGTGTGGTTTACACCTCTTCAGTGCCAACGGCCTGGAATATCAAGGCGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTTTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCCCTTTTTTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTCCAATTTAGATTATTTATTTGCCTTTAATTTTGACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTTTGAGCTGCCTCTGTAATATGGCCTACTCATAAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGAACCAAGTGCTTCCT
  3   1   2       bld Gas7      in                         XZG55049.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGTGCCAACGGCCTGGAATATGAAGGCGCAAGGACAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTGACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATCAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGAACCAAGTGCTTCCT
  5  -1   2       bld Ovi1      in                         CABI1464.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGACCAGGCATGGGTAATCCTCTAGCCTTTTAGATGTGGAGCCGAACAAGTTGCAGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTGACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATAAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGAACCAAGTGCTTCCTAAAACATCTGCCTTCTTTTTAATTGGCTGGCCGGGTTGAGTTATTTTTTTAATATGGAAGACTTTCCAAATCTGTCTTACAGAGGCCGCCCAAGCACAGAGTATGCATTGACTTCTTTTAGCAGATGCGTAACATTTTCTTGCATTTCTGTACATAAATTCTTTTTTTTTT
  5   1   2       bld Egg                            TEgg093n23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGGGGTTGAACAACAGCTAGAGCGCTTCACTTTGCCCATCCCTGAGTTTGGCACTGACCAGTTGCACGTTGACCTCTTGCCTGCCATTGGCAGTTTAGTGTAATGTTTTCTCTTCCTGGAGCCTGAAGGAGCAGCAGTCTCATTTATCGTTTGTTTCTGTTTTTCTGTCCTTGTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCGGTGGGTTTGTGGAAACCATTTTCCATTCATTTAACCTCACCCTGCAGTTAACCCCTTCTCTGCCAGCTGTTCATCAACAAGCTGGGATGGAGCAGTTAAACCAGTCTGTAGCATGGGAAAACTGTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTGACTGTTTTCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATCAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGAACCAAGTGCTTCCTAAAACATCTGCCTTCTTTTTAATTGGCTGGCCGGGTTGAGTTATTTTTTTAATATGGAAGACTTTCCAAATCTGTCTTACAGAGGCCGCCCAAGCACAGAGTATGCATTG
  5   1   2       bld Gas7      in                         XZG35423.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGAAACTGTACAATTTAGATTATTTATTTGCCTTTAATTTTGACTGTTTTCCCCCAGTTTGCCTGTTATCTGTGTCTGAGCTGCCTCTGTAATATGGCCTACTCATAAAGCCGGGGCTGTGAAGTGGATTCAAATACTGTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAGAACCAAGTGCTTCCTAAAACATCTGCCTTCTTTTTAATTGGCTGGCCGGGTTGAGTTATTTTTTTAATATGGAAGACTTTCCAAATCTGTCTTACAGAGGCCGCCCAAGCACAGAGTATGCATTGACTTCTTTTAGCAGATGTGTAACATTTTCTTGCATTTCTGTACATAAATTCTTTTTTTTTTAGATTGTGTTCTGACCTTTTTTCTTTGCAAAAGGTTTCCAAACAAAATAGAAACTGTGTCCACTTGTGCTGCATTTACTCTATTCGGTCACTCAAGCATGGTGCAAGTAGCAAATCAACTGAAAAAGGCTACAGCGGGAGGGATTTACAAAACTGGCAGCAGCAATATATGGCATCTAATTAGAATGTTGGTGATTGAGTTTCGATGGGTTATGAAGCCAGAGTAAAACATTGATTTCAGTTTAGGGTCAGTAAATGCATGGGACTGTGCAGGGCTGGAACTATGGTTAGGCAGTGTTGGGCACCAATACTACTAGGCCCAGCTCAGGGACTTTTAAATCCCATGTTTTTGTTTACGGTTGCAACCTCATCCCTTCAATACCAGCCACATATTGAATCCACATCATGCATCTAAATTAATTGCTA
  5   1   2       bld Egg       in                   TEgg006g13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTTTTTTGGCTGGCCGGGTTGAGTTATTTTTTTAATATGGAAGACTTTCCAAATCTGTCTTACAGAGGCCGCCCAAGCACAGAGTATGCATTGACTTCTTTTAGCAGATGTGTAACATTTTCTTGCATTTCTGTACATAAATTCTTTTTTTTAGATTGTGAAGAAAAAAT
  3   1   2       bld Egg       in                    TEgg006g13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCTGGCCGGGTTGAGTTATTTTTTTAATATGGAAGACTTTCCAAATCTGTCTTACAGAGGCCGCCCAAGCACAGAGTATGCATTGACTTCTTTTAGCAGATGTGTAACATTTTCTTGCATTTCTGTACATAAATTCTTTTTTTTAGATTGTGAAGAAAAAATAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   0       add Gas7      in                         XZG35423.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTGGACCTTTTTTTTTTGCAAAAGGTTTCCAAACAAAATAGAAACGGGGTCCCCTTGGGCGGCATTTACTTTTTTGGGTCCCTCAAGCCGGGGGCAGGTGGCAAATCAACTGAAAAAGGCTCCAGCGGGGGGGGTTTCCAAAACGGGCGGCCGCAATTTTGGGCCTCTAATTAGAATGTTGGGGATTGGGTTTCGAGGGGTTTTGAACCCCGGGTAAAACCTTGTTTTCCGTTTAGGGTCCGTAAAACCAGGGGGCTGGGCAGGGCGGGAACTTTGGTTTGGCAGTGTTGGGCCCCAATTTTTTTGGGCCCCGCTCGGGGGCTTTTAAATCCCCTGTTTTTGTTTAGGGTTGCAACCTCATCCCTTCAATCCCCGCCCCATTTGGAATCCCCCCCCGGCCTTTAAATTAATTGCTACCAACCCGTCCCGGGTGGGTTTTAAGGGAAAGGGCTAAATAACTTTTGGAATACCCTTTTGCCCCCCCCGGAAATTTAACCCCCCCGGATTTGTTCCGCTTTAACCCCCTTAATTTGTACGGTTAACATTTGGGGTAGGCAATTGTTTGTAGGGTTAAGAATAAAAAAGGGTTTTTTTTTTTTCTTGCTTTGGCCTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)