Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 98%

 1012075368 Xt7.1-TEgg045f12.3 - 39 ESTs
                                                                       ........-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TEgg045f12.3                                       CAGCAGCTTACAAGCCAGCGTGTAACGGGTGGAACATTTGCTTAGAATCCTGGATTATCGCCGCGGTGCATTTGAGTTTCATTGTCCCGCAGACTTCTGAGAGCTACACGACATGTTTTAGTGGGGAGGTGTATTTATAATTACTCGAACGAAGCTTATGAACTGAGTACAGGGGTTGTACAGTGGGGACATTGCTCTACAGAGCACCATTGTTATTTGGTACTTTTAAGATAAACTCAGCTCTTTGGCTTTCTGTTTGACGAGGCTGCTCCTTGTATAGAAGTGACACTAGGAGCAGAATTATTAACTTAAAATTCCTAGGTGTTTCTTCGAGGCTATTGTATCTATATATATATATTGGCTGTGCGGACAGAAAGGAATTGCCAGCATGTTTATAGCTAGTCGGGTATAATATGGTTTAGCACAATCCTTGGGCCATGTTTTTAGTGAGGATAAAGATGTGTTTTTGACAAAATCACCTTAGTAACGATGCTTAATGTGCTGCAAGTGGAGTAAGGCATTTGATATGCAGTTCATTTGTACATATAGGTGACTCTGTGCAATGCCTTTAGGGTTAGGCTTGGAGGGTTATGGAATCATTTTAAGGAACTGTTATTTATGAACTGGGAAAGGACTGTCATTTCTCAAAGGAGATGTATATGACAAGGAGAAAGCCAGCATTGTACCTCAGGGAAGACAGCAGATCAGGATTGTTTCTGGGGTTTCTACCTAGAAAATGCAGCATCTTTAATTTGTTCCTGACTTGCTTGATTCTTGGGTTTCTGTCTATGCTCTGGCTACAACTCAGCTGTACCGGTGATGTGAGCAAAAGAGGAACTCAGGATGAAATGTCTTCCCAGAAGTCCTGCCCCCAGGTTCCTAGAACTGTGAATGAGGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGGTTCCTTTTAGGGAGCGATTTGAAGAACTCATGAGCTTTGTCCCCCATATGCACCAGTATTTGTTACAGAAAAAAATTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGACCTTTTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGATGAGTTTTACCGGAGGATAAAAGGAGCTGGACTACAGCTCTTTCGTCCTACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAACGAGACCAGAAAAGAATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCACAGTGTGAAGTATCGCGTGGAATCCCGGTCTGAGGTCACCATCAGTGGAGCCCCATGCACAGTACTGAATGTTCTCCTGGAATGTGACTTAGGGGACACACCATGGTGTGCCTTTAACTGAGGTGGAACAGCAATTTCCAGAAAGGCTTCAAAGCAGCTGCCTAGCAACTTTTTCACTCATTGACTGGATGTGTGACATTTTAGCCAATCATGAACTCAGAGACTTTTTTTTAATATAATAAATAAGACAAAATTCAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008226898                                             CTTACAAGCCAGCGTGTAACGGGTGGAACATTTGCTTAGAATCCTGGATTATCGCCGCGGTGCATTTGAGTTTCATTGTCCCGCAGACTTCTGAGAGCTACACGACATGTTTTAGTGGGGAGGTGTATTTATAATTACTCGAACGAAGCTTATGAACTGAGTACAGGGGTTGTACAGTGGGGACATTGCTCTACAGAGCACCATTGTTATTTGGTACTTTTAAGATAAACTCAGCTCTTTGGCTTTCTGTTTGACGAGGCTGCTCCTTGTATAGAAGTGACACTAGGAGCAGAATTATTAACTTAAAATTCCTAGGTGTTTCTTCGAGGCTATTGTATCTATATATATATATTGGCTGTGCGGACAGAAAGGAATTGCCAGCATGTTTATAGCTAGTCGGGTATAATATGGTTTAGCACAATCCTTGGGCCATGTTTTTAGTGAGGATAAAGATGTGTTTTTGACAAAATCACCTTAGTAACGATGCTTAATGTGCTGCAAGTGGAGTAAGGCATTTGATATGCAGTTCATTTGTACATATAGGTGACTCTGTGCAATGCCTTTAGGGTTAGGCTTGGAGGGTTATGGAATCATTTTAAGGAACTGTTATTTATGAACTGGGAAAGGACTGTCATTTCTCAAAGGAGATGTATATGACAAGGAGAAAGCCAGCATTGTACCTCAGGGAAGACAGCAGATCAGGATTGTTTCTGGGGTTTCTACCTAGAAAATGCAGCATCTTTAATTTGTTCCTGACTTGCTTGATTCTTGGGTTTCTGTCTATGCTCTGGCTACAACTCAGCTGTACCGGTGATGTGAGCAAAAGAGGAACTCAGGATGAAATGTCTTCCCAGAAGTCCTGCCCCCAGGTTCCTAGAACTGTGAATGAGGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGGTTCCTTTTAGGGAGCGATTTGAAGAACTCATGAGCTTTGTCCCCCATATGCACCAGTATTTGTTACAGAAAAAAATTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGACCTTTTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGATGAGTTTTACCGGAGGATAAAAGGAGCTGGACTACAGCTCTTTCGTCCTACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAACGAGACCAGAAAAGAATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCACAGTGTGAAGTATCGCGTGGAATCCCGGTCTGAGGTCACCATCAGTGGAGCCCCATGCACAGTACTGAATGTTCTCCTGGAATGTGACTTAGGGGACACACCATGGTGTGCCTTTAACTGAGGTGGAACAGCAATTTCCAGAAAGGCTTCAAAGCAGCTGCCTAGCAACTTTTTCACTCATTGACTGGATGTGTGACATTTTAGCCAATCATGAACTCAGAGACTTTTTTTTAATATAATAAATAAGACAAAATTCCAAAAAAAAAAAA
                                                      consensus depths                                            2     5     2     5     4     7     4     7     4     7     4     7     5     8     5     9     5    10     5    10     5    10     5    10     5    10     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11    11    11    11    11    11    11    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11     9     9     9     9     9     9     9     9    10    10    10    10     9     9    10    11    10    11    10    11    10    11    10    12    10    11    10    11     9    10     9    10     9    10    10    11    10    11    10    11    11    12    11    12    12    13    12    13    12    13    11    12    12    14    12    14    12    14    12    16    13    17    14    17    14    16    15    16    16    17    16    18    16    18    19    20    20    21    21    22    20    21    18    21    19    22    21    23    21    23    21    24    21    23    21    24    22    24    22    24    22    25    22    25    21    25    22    25    22    25    22    25    21    25    22    24    22    22    21    22    21    22    20    21    20    21    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    18    18    18    18    19    19    19    19    19    19    19    19    18    18    18    18    18    19    19    19    19    19    19    19    19    19    18    19    19    19    16    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    16    17    16    17    16    17     8    11     4     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----C-------
                                               BLH ATG     653     981                                       
                                               BLH MIN     653     160                                       
                                               BLH MPR     560     160                                       
                                               BLH OVR     653    1166                                       
                                               CDS MIN     653     160                                       
                                               ORF LNG     653      71                                       
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xt ---- 3e-028     AAH75452.1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Sp ---- 1e-047     XP_793159.1 PREDICTED: similar to Beta-1,4-galactosyltransferase 7 (Beta-1,4-GalTase 7) (Beta4Gal-T7) (b4Gal-T7) (UDP-galactose:beta-N-acetylglucosamine beta-1,4-galactosyltransferase 7) (UDP-Gal:beta-GlcNAc beta-1,4-galactosyltransferase 7), partial [Strongylocentrot ===================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 6e-062     NP_499164.1 xylosylprotein beta 1 4-galactosyltransferase 7, SQuashed Vulva SQV-3 (33.8 kD)(sqv-3) [Caenorhabditis elegans] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Cs ---- 2e-070     CAJ77188.1 beta1,4-galactosyltransferase 7 [Ciona savignyi] -----------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN -== Ci ==== 2e-072     CAJ77187.1 beta1,4-galactosyltransferase 7 [Ciona intestinalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 3e-075     NP_651319.2 beta-4-galactosyltransferase 7 CG11780-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dr ==== 1e-135     NP_001003417.1 xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I) [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Gg ==== 1e-140     NP_001035000.1 xylosylprotein beta 1,4-galactosyltransferase 7 [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Mm ==== 3e-142     NP_666157.1 xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7; xylosylproteinbeta 1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I) [Musmusculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Hs ==== 5e-146     NP_009186.1 xylosylprotein beta 1,4-galactosyltransferase 7; galactosyltransferase 1(xylosylprotein 4-beta-galactosyltransferase); beta-1,4-galactosyltransferase 7[Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 0          AAH84833.1 LOC495369 protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = ?? ==== 0          NP_001088501.1 hypothetical protein LOC495369 [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TEgg045f12.3                                                                                                                                                                                TAA------------------TGA------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------TAG---------------ATG---TAG---------------ATG------------------ATG------TGA------------------------TAA------------------------------------------------------------------------TAG---TAG------------ATG---------TAA------------------------------------------------ATG---ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------TGA---------TGA---------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  0   1   1           Egg  FL                     TEgg044b20.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCGGGGCTGTTATTTATGAACTGGGAAAGGACTGTCATTTCTCAAAGGAGATGTATATGACAAGGAGAAAGCCAGCATTGTACCTCAGGGAAGACAGCAGATCAGGATTGTTTCTGGGGTTTCTACCTAGAAAATGCAGCATCTTTAATTTGTTCCTGACTTGCTTGATTCTTGGGTTTCTGTCTATGCTCTGGCTACAACTCAGCTGTACCGGTGATGTGAGCAAAAGAGGAACTCAGGATGAAATGTCTTCCCAGAAGTCCTGCCCCCAGGTTCCTAGAACTGTGAATGAGGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGGTTCCTTTTAGGGAGCGATTTGAAGAACTCATGAGCTTTGTCCCCCATATGCACCAGTATTTGTTACAGAAAAAAATTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGACCTTTTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGATGAGTTTTACCGGAGGATAAAAGGAGCTGGACTACAGCTCTTTCGTCCTACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAACGAGACCAGAAAAGAATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCACAGTGTGAAGTATCGCGTGGAATCCCGGTCTGAGGTCACCATCAGTGGAGCCCCATGCACAGTACTGAATGTTCTCCTGGAATGTGACTTAGGGGACACACCATGGTGTGCCTTTAACTGAGGTGGAACAGCAATTTCCAGAAAGGCTTCAAAGCAGCTGCCTAGCAACTTTTTCACTCATTGACTGGATGTGTGACATTTTAGCCAATCATGAACTCAGAGACTTTTTTTTAATATAATAAATAAGACAAAATTCCAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg       in                   TEgg052d23.p1kSP6 CAGGTCGTGTTCCTGTTGGGGAGGATATGTCGACGGACCAGCAGCTTACAAGCCAGCGTGTAACGGGTGGAACATTTGCTTAGAATCCTGGATTATCGCCGCGGTGCATTTGAGTTTCATTGTCCCGCAGACTTCTGAGAGCTACACGACATGTTTTAGTGGGGAGGTGTATTTATAATTACTCGAACGAAGCTTATGAACTGAGTACAGGGGTTGTACAGTGGGGACATTGCTCTACAGAGCACCATTGTTATTTGGTACTTTTAAGATAAACTCAGCTCTTTGGCTTTCTGTTTGACGAGGCTGCTCCTTGTATAGAAGTGACACTAGGAGCAGAATTATTAACTTAAAATTCCTAGGTGTTTCTTCGAGGCTATTGTATCTATATATATATATTGGCTGTGCGGACAGAAAGGAATTGCCAGCATGTTTATAGCTAGTCG
  5   1   2       bld Neu                            TNeu002h02.p1kSP6   CGCAGGTCGTGTTCCTGTTGGGGAGGAATTGTCGACGGACCAGCAGCTTACAAGCCAGCGTGTAACGGGTGGAACATTTGCTTAGAATCCTGGATTATCGCCGCGGTGCATTTGAGTTTCATTGTCCCGCAGACTTCTGAGAGCTACACGACATGTTTTAGTGGGGAGGTGTATTTATAATTACTCGAACGAAGCTTATGAACTGAGTACAGGGGTTGTACAGTGGGGACATTGCTCTACATTGCTCTACAGAGTACTTTTAAGATAAACTCAGCTCTTTGGCTTTCTGTTTGACGAGGCTGCTCCTTGTATAGAAGTGACACTAGGAGCAGAATTATTAACTTAAAATTCCTAGGTGTTTCTTCGAGGCTATTGTATCTATATATATATATATTGGCTGTGCGGACAGAAAGGAATTGCCAGCATGTTTATAGCTAGTCGGGTATAATATGGTTTAGCACAATCCTTGGGCCATGTTTTTAGTGAGGATAAAGATGTGTTTTTGACAAAATCACCTTAGTAACGATGCTTAATGTGCTGCAAGTGGAGTAAGGCATTTGATATGCAGTTCATTTGTACATATAGGTGACTCTGTGCAATGCCT
  5   1   2   10  bld Tbd1 5g3  in                         CBXT4194.b1 ......................GTCGACGGACCAGCAGCTTACAAGCCAGCGTGTAACGGGTGGAACATTTGCTTAGAATCCTGGATTATCGCCGCGGTGCATTTGAGTTTCATTGTCCCGCAGACTTCTGAGAGCTACACGACATGTTTTAGTGGGGAGGTGTATTTATAATTACTCGAACGAAGCTTATGAACTGAGTACAGGGGTTGTACAGTGGGGACATTGCTCTACAGAGCACCATTGTTATTTGGTACTTTTAAGATAAACTCAGCTCTTTGGCTTTCTGTTTGACGAGGCTGCTCCTTGTATAGAAGTGACACTAGGAGCAGAATTATTAACTTAAAATTCCTAGGTGTTTCTTCGAGGCTATTGTATCTATATATATATATATATATTGGCTGTGCGGACAGAAAGGAATTGCCAGCATGTTTATAGCTAGTCGGGAATAATATGGTTTAGCACAATCCTTGGGCCATGTTTTTAGTGAGGATAAAGATGTGTTTTTGACAAAATCACCTTAGTAACGATGCTTAATGTGCTGCAAGTGGAGTAAGGCATTTGATATGCAGTTCATTTGTACATATAGGTGACTCTGTGCAATGCCTTTAGGGTTAGGCTTGGAGGGTTATGGAATCATTTTAAGGAACTGTTATTTATGAACTGGGAAAGGACTGTCATTTCTCAAAGGAGATGTATATGACAAGGAGAAAGCCAGCATTGTACCTCAGGGAAGACAGCAGATCAGGATTGTTTCTGGGGTTTCTACCTAGAAAATGCA
  5   1   2   10  bld Liv1 5g3  in                        CAAR11381.5p ...........................CATCGATTCAATTCGGCCGAGGTTACAAGCCAGCGTGTAACGGGTGGAACATTTGCTTAGAATCCTGGATTATCGCCGCGGTGCATTTGAGTTTCATTGTCCCGCAGACTTCTGAGAGCTACACGACATGTTTTAGTGGGGAGGTGTATTTATAATTACTCGAACGAAGCTTATGAACTGAGTACAGGGGTTGTACAGTGGGGACATTGCTCTACATTGCTCTACAGAGTACTTTTAAGATAAACTCAGCTCTTTGGCTTTCTGTTTGACGAGGCTGCTCCTTGTATAGAAGTGACACTAGGAGCAGAATTATTAACTTAAAATTCCTAGGTGTTTCTTCGAGGCTATTGTATCTATATATATATATATTGGCTGTGCGGACAGAAAGGAATTGCCAGCATGTTTATAGCTAGTCGGGTATAATATGGTTTAGCACAATCCTTGGGCCATGTTTTTAGTGAGGATAAAGATGTGTTTTTGACAAAATCACCTTAGTAACGATGCTTAATGTGCTGCAAGTGGAGTAAGGCATTTGATATGCAGTTCATTTGTACATATAGGTGACTCTGTGCAATGCCTTTAGGGTTAGGCTTGGAGGGTTATGGAATCATTTTAAGGAACTGTTATTTATGAACTGGGAAAGGACTGTCATTTCTCANAGGAGATGTATATGACAAGGAGAAAGCCAGCATTGTACCTCAGGGAAGACAGCAGATCAGGATTGTTTCTGGGGTTTCTACCTAGAAAATGCAGCATCTTTAATTTGTTCCTGACTTGCTTGATTCTTGGGTTTCTGTCTATGCTCTGGCTACAACTCAGCTGTACCGGTGATGTGAGCAAAAGAGGAACTCAGGATGAAATGTCTTCCCAGAAGTCCTGCCC
  5   1   2       bld Gas7                                 XZG26296.5p                            TGTCGACGGACCAGCAGCTTACAAGCCAGCGTGTAACGGGTGGAACATTTGCTTAGAATCCTGGATTATCGCCGCGGTGCATTTGAGTTTCATTGTCCCGCAGACTTCTGAGAGCTACACGACATGTTTTAGTGGGGAGGTGTATTTATAATTACTCGAACGAAGCTTATGAACTGAGTACAGGGGTTGTACAGTGGGGACATTGCTCTACAGAGCACCATTGTTATTTGGTACTTTTAAGATAAACTCAGCTCTTTGGCTTTCTGTTTGACGAGGCTGCTCCTTGTATAGAAGTGACACTAGGAGCAGAATTATTAACTTAAAATTCCTAGGTGTTTCTTCGAGGCTATTGTATCTATATATATATATTGGCTGTGCGGACAGAAAGCAATTGCCAGCATGTTTATAGCTAGTCGGGTATAATATGGTTTAGCACAATCCTTGGGCCATGTTTTTAGTGAGGATAAAGATGTGTTTTTGACAAAATCACCTTAGTAACGATGCTTAATGTGCTGCAAGTGGAGTAAGGCATTTGATATGCAGTTCATTTGTACATATAGGTGACTCTGTGCAATGCCTTTAGGG
  5   1   2       bld In63 5g                         IMAGE:8960974.5p                                                        TCGTGTAACGGGTGGAACATTTGCTTAGAATCCTGGATTATCGCCGCGGTGCATTTGAGTTTCATTGTCCCGCAGACTTCTGAGAGCTACACGACATGTTTTAGTGGGGAGGTGTATTTATAATTACTCGAACGAAGCTTATGAACTGAGTACAGGGGTTGTACAGTGGGGACATTGCTCTACAGAGCACCATTGTTATTTGGTACTTTTAAGATAAACTCAGCTCTTTGGCTTTCTGTTTGACGAGGCTGCTCCTTGTATAGAAGTGACACTAGGAGCAGAATTATTAACTTAAAATTCCTAGGTGTTTCTTCGAGGCTATTGTATCTATATATATATATTGGCTGTGCGGACAGAAAGGAATTGCCAGCATGTTTATAGCTAGTCGGGTATAATATGGTTTAGCACAATCCTTGGGCCATGTTTTTAGTGAGGATAAAGATGTGTTTTTGACAAAATCACCTTAGTAACGATGCTTAATGTGCTGCAAGTGGAGTAAGGCATTTGATATGCAGTTCATTTGTACATATAGGTGACTCTGTGCAATGCCTTTAGGGTTAGGCTTGGAGGGTTATGGAATCATTTTAAGGAACTGTTATTTATGAACTGGGAAAGGACTGTCATTTCTCAAAGGAGATGTATATGACAAGGAGAAAGCCAGCATTGTACCTCAGGAAGACAGCAGATCAGATTGTTTCTGGGGTTTCTACCTAGAAAATGCAGCATCTTTAATTTGTTCCTGACTTGCTTGATTCTTGGGTTTCTGTCTATGCTTCTGGCTACACTCAGCTGTACGTGATGTGAGCAAAGAGGACTCAGATGAATGTCTTCCAGAGTCTTGCCCAAGTTCTAGAACTGGAATGAGATCCTCATTGGGTCCTCACGCTTGCTTGCTGTTCTTTACGAGCGATTTGAGAACCTAGAACCTGTGCTCATATGGC
  5   1   2       bld Neu                            TNeu048b03.p1kSP6                                                         CGTGTAACGGGTGGAACATTTGCTTAGAATCCTGGATTATCGCCGCGGTGCATTTGAGTTTCATTGTCCCGCAGACTTCTGAGAGCTACACGACATGTTTTAGTGGGGAGGTGTATTTATAATTACTCGAACGAAGCTTATGAACTGAGTACAGGGGTTGTACAGTGGGGACATTGCTCTACAGAGCACCATTGTTATTTGGTACTTTTAAGATAAACTCAGCTCTTTGGCTTTCTGTTTGACGAGGCTGCTCCTTGTATAGAAGTGACACTAGGAGCAGAATTATTAACTTAAAATTCCTAGGTGTTTCTTCGAGGCTATTGTATCTATATATATATATTGGCTGTGCGGACAGAAAGGAATTGCCAGCATGTTTATAGCTAGTCGGGAATAATATGGTTTAGCACAATCCTTGGGCCATGTTTTTAGTGAGGATAAAGATGTGTTTTTGACAAAATCACCTTAGTAACGATGCTTAATGTGCTGCAAGTGGAGTAAGGCATTTGATATGCAGTTCATTTGTACATATAGGTGACTCTGTGCAATGCCTTTAGGGTTAGGCTTGGAGGGTTATGGAATCATTTTAAGGAACTGTTATTTATGAACTGGGAAAGGACTGTCATTTCTCA
  5   1   2       bld Egg  5g3  in                   TEgg007h07.p1kSP6                                                                                                     GCGGTGCATTTGAGTTTCATTGTCCCGCAGACTTCTGAGAGCTACACGACATGTTTTAGTGGGGAGGTGTATTTATAATTACTCGAACGAAGCTTATGAACTGAGTACAGGGGTTGTACAGTGGGGACATTGCTCTACAGAGCACCATTGTTATTTGGTACTTTTAAGATAAACTCAGCTCTTTGGCTTTCTGTTTGACGAGGCTGCTCCTTGTATAGAAGTGACACTAGGAGCAGAATTATTAACTTAAAATTCCTAGGTGTTTCTTCGAGGCTATTGTATCTATATATATATATTGGCTGTGCGGACAGAAAGGAATTGCCAGCATGTTTATAGCTAGTCGGGAATAATATGGTTTAGCACAATCCTTGGGCCATGTTTTTAGTGAGGATAAAGATGTGTTTTTGACAAAATCACCTTAGTAACGATGCTTAATGTGCTGCAAGTGGAGTAAGGCATTTGATATGCAGTTCATTTGTACATATAGGTGACTCTGTGCAATGCCTTTAGGGTTAGGCTTGGAGGGTTATGGAATCATTTTAAGGAACTGTTATTTATGAACTGGGAAAGGACTGTCATTTCTCAAAGGAGATGTATATGACAAGGAGAAAGCCAGCATTGTACCTCAGGGAAGACAGCAGATCAGGA
  5   1   2   22  bld Tad5 5g                              XZT71074.5p ...............................................................................................................GTTTCATTGTCCCGCAGACTTCTGAGAGCTACACGACATGTTTTAGTGGGGAGGTGTATTTATAATTACTCGAACGAAGCTTATGAACTGAGTACAGGGGTTGTACAGTGGGGACATTGCTCTACAGAGCACCATTGTTATTTGGTACTTTTAAGATAAACTCAGCTCTTTGGCTTTCTGTTTGACGAGGCTGCTCCTTGTATAGAAGTGACACTAGGAGCAGAATTATTAACTTAAAATTCCTAGGTGTTTCTTCGAGGCTATTGTATCTATATATATATATATTGGCTGTGCGGACAGAAAGGAATTGCCAGCATGTTTATAGCTAGTCGGGTATAATATGGTTTAGCACAATCCTTGGGCCATGTTTTTAGTGAGGATAAAGATGTGTTTTTGACAAAATCACCTTAGTAACGATGCTTAATGTGCTGCAAGTGGAGTAAGGCATTTGATATGCAGTTCATTTGTACATATAGGTGACTCTGTGCAATGCCTTTAGGGTTAGGCTTGGAGGGTTATGGAATCATTTTAAGGAACTGTTATTTATGAACTGGGAAAGGACTGTCATTTCTCAAAGGAGATGTATATGACAAGGAGAAAGCCAGCATTGTACCTCAGGGAAGACAGCAGATCAGGATTGTTTCTGGGGTTTCTACCTAGAAAATGCAGCATCTTTAATTTGTTCCTGACTTGCTTGATTCTTGGGTTTCTGTCTATGCTCTGGCTACAACTCAGCTGTACCGGTGATGTGAGCAAAAGAGGAACTCAGGATGAAATGTCTTCCCAGAAGTCCTGCCCCCAGGTTCCTAGAACTGTGAATGAGGATCCCTCATGGGG
  5   1   2   10  bld Ovi1 PIPE in                        CABI12003.5p .............................................................................................................................CAGACTTCTGAGAGCTACACGACATGTTTTAGTGGGGAGGTGTATTTATAATTACTCGAACGAAGCTTATGAACTGAGTACAGGGGTTGTACAGTGGGGACATTGCTCTACAGAGCACCATTGTTATTTGGTACTTTTAAGATAAACTCAGCTCTTTGGCTTTCTGTTTGACGAGGCTGCTCCTTGTATAGAAGTGACACTAGGAGCAGAATTATTAACTTAAAATTCCTAGGTGTTTCTTCGAGGCTATTGTATCTATATATATATATATTGGCTGTGCGGACAGAAAGGAATTGCCAGCATGTTTATAGCTAGTCGGGTATAATATGGTTTAGCACAATCCTTGGGCCATGTTTTTAGTGAGGATAAAGATGTGTTTTTGACAAAATCACCTTAGTAACGATGCTTAATGTGCTGCAAGTGGAGTAAGGCATTTGATATGCAGTTCATTTGTACATATAGGTGACTCTGTGCAATGCCTTTAGGGTTAGGCTTGGAGGGTTATGGAATCATTTTAAGGAACTGTTATTTATGAACTGGGAAAGGACTGTCATTTCTCAAAGGAGATGTATATGACAAGGAGAAAGCCAGCATTGTACCTCAGGGAAGACAGCAGATCAGGATTGTTTCTGGGGTTTCTACCTAGAAAATGCAGCATCTTTAATTTGTTCCTGACTTGCTTGATTCTTGGGTTTCTGTCTATGCTCTGGCTACAACTCAGCTGTACCGGTGATGTGAGCAAAAGAGGAACTCAGGATGAAATGTCTTCCCAGAAGTCCTGCCCCCAGGTTCCTAGAACTGTGAATGAGGATCCCTCATGNGGTCCTCACCGGCTTGCTTTGCT
  5   1   2   12  bld Gas7 5g3  in                         XZG50054.5p .................................................................................................................................................................................................GAACTGAGTACAGGGGTTGTACAGTGGGGACATTGCTCTACAGAGCACCATTGTTATTTGGTACTTTTAAGATAAACTCAGCTCTTTGGCTTTCTGTTTGACGAGGCTGCTCCTTGTATAGAAGTGACACTAGGAGCAGAATTATTAACTTAAAATTCCTAGGTGTTTCTTCGAGGCTATTGTATCTATATATATATATATATTGGCTGTGCGGACAGAAAGGAATTGCCAGCATGTTTATAGCTAGTCGGGTATAATATGGTTTAGCACAATCCTTGGGCCATGTTTTTAGTGAGGATAAAGATGTGTTTTTGACAAAATCACCTTAGTAACGATGCTTAATGTGCTGCAAGTGGAGTAAGGCATTTGATATGCAGTTCATTTGTACATATAGGTGACTCTGTGCAATGCCTTTAGGGTTAGGCTTGGAGGGTTATGGAATCATTTTAAGGAACTGTTATTTATGAACTGGGAAAGGACTGTCATTTCTCAAAGGAGATGTATATGACAAGGAGAAAGCCAGCATTGTACCTCAGGGAAGACAGCAGATCAGGATTGTTTCTGGGGTTTCTACCTAGAAAATGCAGCATCTTTAATTTGTTCCTGACTTGCTTGATTCTTGGGTTTCTGTCTATGCTCTGGCTACAACTCAGCTGTACCGGTGATGTGAGCAAAAGAGGAACTCAGGATGAAATGTCTTCCCAGAAGTCCTGCCCCCAGGTTCCTAGAACTGTGAATGAGGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGGTTCCTTTTAGGGAGCGATTTGAAGAACTCATGAGCTTTGTCCCCCATATGCACCAGTATTTGTTACAGAAAAAAATTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACA
  5   1   2       bld Egg  5g                        TEgg122b21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGGGGAGTAACGATGCTTAATGTGCTGCAAGTGGAGTAAGGCATTTGATATGCAGTTCATTTGTACATATAGGTGACTCTGTGCAATGCCTTTAGGGTTAGGCTTGGAGGGTTATGGAATCATTTTAAGGAACTGTTATTTATGAACTGGGAAAGGACTGTCATTTCTCAAAGGAGATGTATATGACAAGGAGAAAGCCAGCATTGTACCTCAGGGAAGACAGCAGATCAGGATTGTTTCTGGGGTTTCTACCTAGAAAATGCAGCATCTTTAATTTGTTCCTGACTTGCTTGATTCTTGGGTTTCTGTCTATGCTCTGGCTACAACTCAGCTGTACCGGTGATGTGAGCAAAAGAGGAACTCAGGATGAAATGTCTTCCCAGAAGTCCTGCCCCCAGGTTCCTAGAACTGTGAATGAGGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGGTTCCTTTTAGGGAGCGATTTGAAGAACTCATGAGCTTTGTCCCCCATATGCACCAGTATTTGTTACAGAAAAAAATTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGC
  5   1   2       bld Egg  FL   in                   TEgg044b20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGGGGCTGTTATTTATGAACTGGGAAAGGACTGTCATTTCTCAAAGGAGATGTATATGACAAGGAGAAAGCCAGCATTGTACCTCAGGGAAGACAGCAGATCAGGATTGTTTCTGGGGTTTCTACCTAGAAAATGCAGCATCTTTAATTTGTTCCTGACTTGCTTGATTCTTGGGTTTCTGTCTATGCTCTGGCTACAACTCAGCTGTACCGGTGATGTGAGCAAAAGAGGAACTCAGGATGAAATGTCTTCCCAGAAGTCCTGCCCCCAGGTTCCTAGAACTGTGAATGAGGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGGTTCCTTTTAGGGAGCGATTTGAAGAACTCATGAGCTTTGTCCCCCATATGCACCAGTATTTGTTACAGAAAAAAATTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGACCTTTTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACC
  5   1   2       bld Egg       in                   TEgg007b18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCCTAACCCGGGATGGGCATGGTGTATGCTGTTTCTTCAGGAGTCCAGGAAAGAGAAATTACGATCAGGATTGTTTCTGGGGTTTCTACCTAGAAAATGCAGCATCTTTAATTTGTTCCTGACTTGCTTGATTCTTGGGTTTCTGTCTATGCTCTGGCTACAACTCAGCTGTACCGGTGATGTGAGCAAAAGAGGAACTCAGGATGAAATGTCTTCCCAGAAGTCCTGCCCCCAGGTTCCTAGAACTGTGAATGAGGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGGTTCCTTTTAGGGAGCGATTTGAAGAACTCATGAGCTTTGTCCCCCATATGCACCAGTATTTGTTACAGAAAAAAATTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGACCTTTTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGA
  5   1   2   10  bld Ova1 5g3  in                         CABE1253.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATTTCTCAAAGGAGATGTATATGACAAGGAGAAAGCCAGCATTGTACCTCAGGGAAGACAGCAGATCAGGATTGTTTCTGGGGTTTCTACCTAGAAAATGCAGCATCTTTAATTTGTTCCTGACTTGCTTGATTCTTGGGTTTCTGTCTATGCTCTGGCTACAACTCAGCTGTACCGGTGATGTGAGCAAAAGAGGAACTCAGGATGAAATGTCTTCCCAGAAGTCCTGCCCCCAGGTTCCTAGAACTGTGAATGAGGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGGTTCCTTTTAGGGAGCGATTTGAAGAACTCATGAGCTTTGTCCCCCATATGCACCAGTATTTGTTACAGAAAAAAATTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGACCTATTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGATGAGTTTTACCGGAGGATAAAAGGAGCTGGACTACAGCTCTTTCGTCCTACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAACGAGACC
  5   1   2       bld Eye       in                         CCAX6054.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGTAAGACAGCAGATCAGGATTGTTTCTGGGGTTTCTACCTAGAAAATGCAGCATCTTTAATTTGTTCCTGACTTGCTTGATTCTTGGGTTTCTGTCTATGCTCTGGCTACAACTCAGCTGTACCGGTGATGTGAGCAAAAGAGGAACTCAGGATGAAATGTCTTCCCAGAAGTCCTGCCCCCAGGTTCCTAGAACTGTGAATGAGGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGGTTCCTTTTAGGGAGCGATTTGAAGAACTCATGAGCTTTGTCCCCCATATGCACCAGTATTTGTTACAGAAAAAAATTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGACCTATTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGGATGTGGGCGGGATCTGGATGCTCACCA
  5   1   2       bld Lun1      in                         CABD2131.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATCGATTCGTGATTCTTGGGTTTCTGTCTATGCTCTGGCTACAACTCAGCTGTACCGGTGATGTGAGCAAAAGAGGAACTCAGGATGAAATGTCTTCCCAGAAGTCCTGCCCCCAGGTTCCTAGAACTGTGAATGAGGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGGTTCCTTTTAGGGAGCGATTTGAAGAACTCATGAGCTTTGTCCCCCATATGCACCAGTATTTGTTACAGAAAAAAATTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGACCTTTTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGATGAGTTTTACCGGAGGATAAAAGGAGCTGGACTACAGCTCTTTCGTCCTACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAACGAGACCAGAAAAGAATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCACAGTGTGAAGTATCGCGTGGAATCCCGGTCTGAGGTCACCATCATTGGAGCCCCATGCACAGTACTGAATGTTCTCCTGGAATGTGACTTANGGGACACACCATGGTGTGCCTTTAACT
  5   1   2       bld Egg                            TEgg083b23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCAGCTGTACCGGTGATGTGAGCAAAAGAGGAACTCAGGATGAAATGTCTTCCCAGAAGTCCTGCCCCCAGGTTCCTAGAACTGTGAATGAGGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGGTTCCTTTTAGGGAGCGATTTGAAGAACTCATGAGCTTTGTCCCCCATATGCACCAGTATTTGTTACAGAAAAAAATTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGACCTTTTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGGCAATGGAATGTCCCATCGATTCTGGGGATGGGGTAGGGAAGATGATG
  5   1   2       bld Egg       in                   TEgg045f12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGAGCAAAAGAGGAACTCAGGATGAAATGTCTTCCCAGAAGTCCTGCCCCCAGGTTCCTAGAACTGTGAATGAGGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGGTTCCTTTTAGGGAGCGATTTGAAGAACTCATGAGCTTTGTCCCCCATATGCACCAGTATTTGTTACAGAAAAAAATTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGACCTATTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGAT
  5   1   2       bld Gas       in                   TGas142i13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCCCCAGGTTCCTATAACTGTGAATGAGGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGGTTCCTTTTAGGGAGCGATTTGAAGAACTCATTGAGCTTTGTCCCCCATATGCACCATTATTTGTTACAGAAAAAAATTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAAAGCTTCTCTGATTAATGTGGGCTTCCTGTAGAGCGGAAATGAAACGGATTACTTAGCTATGCATGATGTGGACCTTTTGCCACTTAACCTTGATTTGGACTTATGGTTTTCCAGAAAATGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCTCTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAA
  3   1   2      seed Egg       in                    TEgg045f12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCAGGTTCCTAGAACTGTGAATGAGGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGGTTCCTTTTAGGGAGCGATTTGAAGAACTCATGAGCTTTGTCCCCCATATGCACCAGTATTTGTTACAGAAAAAAATTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGACCTATTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGATGAGTTTTACCGGAGGATAAAAGGAGCTGGACTACAGCTCTTTCGTCCTACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAACGAGACCAGAAAAGAATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCACAGTGTGAAGTATCGCGTGGAATCCCGGTCTGAGGTCACCATCAGTGGAGCCCCATGCACAGTACTGAATGTTCTCCTGGAATGTGACTTAGGGGACACACCATGGTGTGCCTTTAACTGAGGTGGAACAGCAATTTCCAGAAAGGCTTCAAAGCAGCTGCCTAGCAACTTTTTCACTCATTGACTGGATGTGTGACATTTTAGCCAATCATGAACTCAGAGACTTTTTTTTAATATAATAAATAAGACAAAATTCCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas       in                   TGas053m15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGGTTCCTTTTAGGGAGCGATTTGAAGAACTCATGAGCTTTGTCCCCCATATGCACCAGTATTTGTTACAGAAAAAAATTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGACCTTTTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGATGAGTTTTACCGGAGGATAAAAGGAGCTGGACTACAGCTCTTTCGTCCTACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAACGAGACCAGAAAAGAATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCACAGTGTGAAGTATCGCGT
  3   1   2       bld Gas7 5g3  in                         XZG50054.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGGTCCTTTTAGGGAGCGATTTGAAGAACTCATGAGCTTTGTCCCCCATATGCACCAGTATTTGTTACAGAAAAAAATTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGACCTTTTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGATGAGTTTTACCGGAGGATAAAAGGAGCTGGACTACAGCTCTTTCGTCCTACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAACGAGACCAGAAAAGAATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCACAGTGTGAAGTATCGCGTGGAATCCCGGTCTGAGGTCACCATCAGTGGAGCCCCATGCACAGTACTGAATGTTCTCCTGGAATGTGACTTAGGGGACACACCATGGTGTGCCTTTAACTGAGGTGGAACAGCAATTTCCAGAAAGGCTTCAAAGCAGCTGCCTAGCAACTTTTTCACTCATTGACTGGATGTGTGACATTTTAGCCAATCATGAACTCAGAGACTTTTTTTTAATATAATAAATAAGACAAAATTCC
  3   1   2       bld Liv1 5g3  in                        CAAR11381.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCATGGGGTCCTCACCGGCTGCTTTTGCTGGTTCTTTTAGGGAGCGATTTGAAGAACTCATGAGCTTTGTCCCCCATATGCACCAGTATTTGTTACAGAAAAAAATTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGACCTTTTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGATGAGTTTTACCGGAGGATAAAAGGAGCTGGACTACAGCTCTTTCGTCCTACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAACGAGACCAGAAAAGAATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCACAGTGTGAAGTATCGCGTGGAATCCCGGTCTGAGGTCACCATCAGTGGAGCCCCATGCACAGTACTGAATGTTCTCCTGGAATGTGACTTAGGGGACACACCATGGTGTGCCTTTAACTGAGGTGGAACAGCAATTTCCAGAAAGGCTTCAAAGCAGCTGCCTAGCAACTTTTTCACTCATTGACTGGATGTGTGACATTTTAGCCAATCATGAACTCAGAGACTTTTTTTTAATATAATAAATAAGACAAAATTC
  3   1   2       bld Gas       in                    TGas142i13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTTGCTTTGCTGGTTCCTTTTAGGGAGCGATTTGAAGAACTCATGAGCTTTGTCCCCCATATGCACCAGTATTTGTTACAGAAAAAAATTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGACCTTTTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGATGAGTTTTACCGGAGGATAAAAGGAGCTGGACTACAGCTCTTTCGTCCTACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAACGAGACCAGAAAAGAATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCACAGTGTGAAGTATCGCGTGGAATCCCGGTCTGAGGTCACCATCAGTGGAGCCCCATGCACAGTACTGAATGTTCTCCTGGAATGTGACTTAGGGGACACACCATGGTGTGCCTTTAACTGAGGTGAACAGCAATTTCCAGAAAGGCTTCAAAGCAGCTGCCTAGCAACTTTTTCACTCATTGACTGGATGTGTGACATTTTAGCCAATCATGAACTCAGAGACTTTTTTTTAATATAATAAATAAGACAAAATTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ovi1 PIPE in                        CABI12003.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTGCTTTGCTGGTTCCTTTTAGGGAGCGATTTGAAGAACTCATGAGCTTTGTCCCCCATATGCACCAGTATTTGTTACAGAAAAAAATTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGACCTATTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGATGAGTTTTACCGGAGGATAAAAGGAGCTGGACTACAGCTCTTTCGTCCTACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAACGAGACCAGAAAAGAATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCACAGTGTGAAGTATCGCGTGGAATCCCGGTCTGAGGTCACCATCAGTGGAGCCCCATGCACAGTACTGAATGTTCTCCTGGAATGTGACTTAGGGGACACACCATGGTGTGCCTTTAACTGAGGTGGAACAGCAATTTCCAGAAAGGCTTCAAAGCAGCTGCCTAGCAACTTTTTCACTCATTGACTGGATGTGTGACATTTTAGCCAATCATGAACTCAGAGACTTTTTTTTAATATAATAAATAAGACAAAATTCC
  3   1   2       bld Lun1      in                         CABD2131.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATGAGCTTTGTCCNCCATATGCACCAGTATTTGTTACAGAAAAAAATTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGACCTTTTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGATGAGTTTTACCGGAGGATAAAAGGAGCTGGACTACAGCTCTTTCGTCCTACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAACGAGACCAGAAAAGAATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCACAGTGTGAAGTATCGCGTGGAATCCCGGTCTGAGGTCACCATCATTGGAGCCCCATGCACAGTACTGAATGTTCTCCTGGAATGTGACTTAGGGGACACACCATGGTGTGCCTTTAACTGAGGTGGAACAGCAATTTCCAGAAAGGCTTCAAAGCAGCTGCCTAGCAACTTTTTCACTCATTGACTGGATGTGTGACATTTTAGCCAATCATGAACTCAGAGACTTTTTTTTAATATAATAAATAAGACAAAATTCC
  3   1   2       bld Gas       in                    TGas053m15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCATATGCACCAGTATTTGTTACAGAAAAAAATTCTCCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGACCTTTTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTTTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGATGAGTTTTACCGGAGGATAAAAGGAGCTGGACTACAGCTCTTTCGTCCTACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAACGAGACCAGAAAAGAATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCACAGTGTGAAGTATCGCGTGGAATCCCGGTCTGAGGTCACCATCAGTGGAGCCCCATGCACAGTACTGAATGTTCTCCTGGAATGTGACTTAGGGGACACACCATGGTGTGCCTTTAACTGAGGTGGAACAGCAATTTCCAGAAAGGCTTCAAAGCAGCTGCCTAGCAACTTTTTCACTCATTGACTGGATGTGTGACATTTTAGCCAATCATGAACTCAGAGACTTTTTTTTAATATAATAAATAAGACAAAATTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  FL   in                    TEgg044b20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAAATTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTTTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGCCCTTTTGCCACTTACCCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGTTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGGGGGATTTTGATGCTCCCCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGATGAGTTTTCCCGGAGGATAAAAGGAGCTGGACTACAGTTCTTTCTTCCTACAGGAATAAGCCCAGGATACAAAACTTTCCGTCACATACATGCCCCTGCATGGAGGAAACGAGCCCAGAAAAGAATTGCTGTTCAGAAGCAGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCCCAGTGTGAAGTATCGCGTGGAATCCCGGTTTGAGGTCCCCATCAGTGGAGCCCCATGCACAGTACTGAATGTTTTCCTGGAATGTGACTTAGGGGACACCCCATGGTGTCCCTTTAACTGAGGGGGAACAGCAATTTCCAGAAAGGTTTCAAAGCAGCTGCCTAGCAACTTTTTCACTCATTGACGGGATGTGTGACATTTTACCCAATCATGAACTCAGAGACTTTTTTTTAATATAATAAATAAGCCAAATTTCCAAGaaaaaaaaaaaaaaaaaccaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Tbd1 5g3  in                         CBXT4194.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATTTCTCCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGACCTATTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGATGAGTTTTACCGGAGGATAAAAGGAGCTGGACTACAGCTCTTTCGTCCTACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAACGAGACCAGAAAAGAATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCACAGTGTGAAGTATCGCGTGGAATCCCGGTCTGAGGTCACCATCAGTGGAGCCCCATGCACAGTACTGAATGTTCTCCTGGAATGTGACTTAGGGGACACACCATGGTGTGCCTTTAACTGAGGCGGAACAGCAATTTCCAGAAAGGCTTCAAAGCAGCTGCCTAGCAACTTTTTCACTCATTGACTGGATGTGTGACATTTTAGCCAATCATGAACTCAGAGACTTTTTTTTAATATAATAAATAAGACAAAATTCCAAAAAAAAAAAAAAA
  3   1   2       bld Ova1 5g3  in                         CABE1253.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCATCATATTTTTATCATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGACCTATTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGATGAGTTTTACCGGAGGATAAAAGGAGCTGGACTACAGCTCTTTCGTCCTACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAACGAGACCAGAAAAGAATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCACAGTGTGAAGTATCGCGTGGAATCCCGGTCTGAGGTCACCATCAGTGGAGCCCCATGCACAGTACTGAATGTTCTCCTGGAATGTGACTTAGGGGACACACCATGGTGTGCCTTTAACTGAGGTGGAACAGCAATTTCCAGAAAGGCTTCAAAGCAGCTGCCTAGCAACTTTTTCACTCATTGACTGGATGTGTGACATTTTAGCCAATCATGAACTCAGAGACTTTTTTTTAATATAATAAATAAGACAAAATTC
  3   1   2       bld Egg       in                    TEgg052d23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATCAATCAAGTGGATCATTACAGGTTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGACTACATAGCTATGCATGATGTGGACCTATTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGATGAGTTTTACCGGAGGATAAAAGGAGCTGGACTACAGCTCTTTCGTCCTACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAACGAGACCAGAAAAGAATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCACAGTGTGAAGTATCGCGTGGAATCCCGGTCTGAGGTCACCATCAGTGGAGCCCCATGCACAGTACTGAATGTTCTCCTGGAATGTGACTTAGGGGACACACCATGGTGTGCCTTTAACTGAGGCGGAACAGCAATTTCCAGAAAGGCTTCAAAGCAGCTGCCTAGCAACTTTTTCACTCATTGACTGGATGTGTGACATTTTAGCCAATCATGAACTCAGAGACTTTTTTTTAATATAATAAATAAGACAAAATCCAAAAAAAAAA
  5   1   2       bld Gas7                                  XZG4208.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGATTATGTGGGCTTCCTGGAGAGCGGAAATGAAACGGATTACATAGCTATGCATGATGTGGACCTATTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCGGGGGATGGGGTAGGGAAGATGATGAGTTTTACCGGAGGATAAAAGGAGCTGGACTACAGCTCTTTCGTCCTACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAACGAGACCAGAAAAGAATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCACAGTGTGAAGTATCGCGTGGAATCCCGGTCTGAGGTCACCATCAGTGGAGCCCCATGCACAGTACTGAATGTTCTCCTGGAATGTGACTTAGGGGACACACCATGGTGTGCCTTTAACTGAGGTGGAACAGCAATTTCCAGAAAGGCTTCAAAGCAGCTGCCTAGCAACTTTTTCACTCATTGACTGGATGTGTGACATTTTAGCCAATCATGAACTCAGAGACTTTTTTTTAATATAATAAATAAGACAAAATTCAAAAAAAAAAANAAAAGGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg                            TEgg051m07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGGCTTCCTGGAGAGCGGAAATGAAACGGACTACATAGCTATGCATGATGTGGACCTATTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGATGAGTTTTACCGGAGGATAAAAGGAGCTGGACTACAGCTCTTTCGTCCTACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAACGAGACCAGAAAAGAATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCACAGTGTGAAGTATCGCGTGGAATCCCGGTCTGAGGTCACCATCAGTGGAGCCCCATGCACAGTACTGAATGTTCTCCTGGAATGTGACTTAGGGGACACACCATGGTGTGCCTTTAACTGAGGCGGAACAGCAATTTCCAGAAAGGCTTCAAAGCAGCTGCCTAGCAACTTTTTCACTCATTGACTGGATGTGTGACATTTTAGCCAATCATGAACTCAG
  3   1   2       bld Egg       in                    TEgg007b18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATGAAACGGATTACATAGCTATGCATGATGTGGACCTTTTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGATGAGTTTTACCGGAGGATAAAAGGAGCTGGACTACAGCTCTTTCGTCCTACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAACGAGACCAGAAAAGAATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCACAGTGTGAAGTATCGCGTGGAATCCCGGTCTGAGGTCACCATCAGTGGAGCCCCATGCACAGTACTGAATGTTCTCCTGGAATGTGACTTAGGGGACACACCATGGTGTGCCTTTAACTGAGGTGGAACAGCAATTTCCAGAAAGGCTTCAAAGCAGCTGCCTAGCAACTTTTTCACTCATTGACTGGATGTGTGACATTTTAGCCAATCATGAACTCAGAGACTTTTTTTTAATATAATAAATAAGACAAAATTCAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg007h07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCATGATGTGGACCTATTGCCACTTAACCTTGATTTGGACTATGGTTTTCCAGAGAAGGGACCATTCCACGTGGCTTCCCCAGAGCTGCACCCACTTTATCATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGATGAGTTTTACCGGAGGATAAAAGGAGCTGGACTACAGCTCTTTCGTCCTACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAACGAGACCAGAAAAGAATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCACAGTGTGAAGTATCGCGTGGAATCCCGGTCTGAGGTCACCATCAGTGGAGCCCCATGCACAGTACTGAATGTTCTCCTGGAATGTGACTTAGGGGACACACCATGGTGTGCCTTTAACTGAGGCGGAACAGCAATTTCCAGAAAGGCTTCAAAGCAGCTGCCTAGCAACTTTTTCACTCATTGACTGGATGTGTGACATTTTAGCCAATCATGAACTCAGAGACTTTTTTTTAATATAATAAATAAGACAAAATTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas0                                 dad55d03.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATGGTTTTCCAAGGAAGGGACCATTCCACGGGGCTTCCCCAGAGCTGCACCCACTTTATGATTACAAGACGTATGTGGGCGGGATTCTGATGCTCACCAAACAGCATTATGAAATGTGCAATGGAATGTCCAATCGATTCTGGGGATGGGGTAGGGAAGATGATGAGTTTTACCGGAGGATAAAAGGAGCTGGACTACAGCTCTTTCGTCCTACAGGAATAAGCACAGGATACAAAACTTTCCGTCACATACATGACCCTGCATGGAGGAAACGAGACCAGAAAAGAATTGCTGCTCAGAAGCAGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCACAGTGTGAAGTATCGCGTGGAATCCCGGTCTGAGGTCACCATCAGTGGAGCCCCATGCACAGTACTGAATGTTCTCCTGGAATGTGACTTAGGGGACACACCATGGTGTGCCTTTAACTGAGGTGGAACAGCAATTTCCAGAAAGGCTTCAAAGCAGCTGCCTAGCAACTTTTTCACTCATTGACTGGATGTGTGACATTTTAGCCAATCATGAACTCAGAGACTTTTTTTTAATATAATAAATAAGACAAAATTCCAAAAAAA
  3   1   2       bld Eye       in                         CCAX6054.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCAGAAGCCGGAGCAGTTTAAAGTGGATCGAGAGGGAGGTCTGCACAGTGTGAAGTATCCCGTGGAATCCCGGTCTGAGGTCACCATCAGTGGAGCCCCATGCACAGTACTGAATGTTCTCCTGGAATGTGACTTAGGGGACCCACCATGGTGTGCCTTTAACTGAGGTGGAACAGCAATTTCCAGAAAGGCTTCAAAGCAGCTGCCTAGCAACTTTTTCACTCATTGACTGGATGTGTGACATTTTAGCCAATCATGAACTCAGAGACTTTTTTTTAATATAATAAATAAGACAAAATTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAGGG
  5   1   2       bld Egg0                                 dad63h01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGTCTGAGGTCACCATCAGTGGAGCCCCATGCACAGTACTGAATGTTCTCCTGGAATGTGACTTAGGGGACACACCATGGTGTGCCTTTAACTGAGGTGGAACAGCAATTTCCAGAAAGGCTTCAAAGCAGCTGCCTAGCAACTTTTTCACTCATTGACTGGATGTGTGACATTTTAGCCAATCATGAACTCAGAGACTTTTTTTTAATATAATAAATAAGACAAAATTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)