Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TNeu072k21.3.5                       61 END     1           2        1                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012075413 Xt7.1-XZG59853.3 - 43 ESTs
                                                                       ........-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG59853.3                   CCGGATGTGTGCGACTTGGTACGGTCTTCCAGGCTCAGCAATAGGAATCTGGAGAGGGAAAGGAAGAGAAGGGGTGAGGCCCCAGAAGCTACAGCGTTTTAGGGATTCTGTCCTACATACTCACAACCGCCAGGTATCCCAGAACGCCTTCTAGAGGACATGCCGACACAGAGGGACAACACCATGTCCCAGCCATCAGATCATTCCCACCAGGTCCGGGTCAAAGCGTATTTTAAGGGTGACATCATGATTACACATTTCGAACCCTCTATAACCTTTGATGGGCTGTGCAATGAGGTGCGGGACATGTGCTCTTTTGAAAACGACCAGCCTTTCACCATGAAGTGGATTGATGAAGAAGGAGATCCATGCACAGTTTCCTCTCAGTTGGAACTGGAAGAAGCTTTCCGTCTGTATGAATTGAATAAGGATTCTGAGCTGCTTATCCACGTGTTCCCATGTATACCAGAGAGGCCTGGCATGCCCTGCGCAGGGGAAGACAAGTCCATATATCGACGTGGAGCCAGAAGATGGAGAAAACTCTATTGTGCAAATGGTCACACTTTCCAGGCCAAGAGATTTAACAGGCGAGCGCACTGCGCCATCTGCACTGACCGAATATGGGGGCTGGGACGTCAGGGCTATAAATGCATCAACTGTAAACTGCTTGTTCATAAGAAATGTCACAAGCTTGTTTCCATTGAATGTGGCCGACACACAATAGCGGAACCTGTTATACCAATGGATCCACCAGGCATGCACTCTGATCACAGCGAACCAGAACTGCCATACAGACCAAGAAGCCAAGACAATCTAGATCAAGTTGGTGAAGAGAAAGAGGCAATGAACAGCAGGGAGAGTGGAAAGACCCCGTCTAGCCTGGGACTGCAAGACTTTGACCTTATGCGGGTCATTGGAAGAGGCAGCTATGCTAAAGTTCTGCTTGTCCGGTTAAAGAAAACAGAGAGAATCTATGCAATGAAAGTTGTCAAAAAGGAGCTTGTTAATGATGATGAGGATATTGACTGGGTGCAGACAGAGAAGCATGTGTTCGAGCAGGCCTCAAACCACCCTTTCCTAGTTGGGCTACACTCCTGCTTCCAGACAGAGAGCAGGCTATTTTTTGTAATTGAATATGTGAATGGTGGGGATCTGATGTTTCACATGCAGCGCCAAAGGAAGCTTCCCGAGGAGCATGCAAGGTTTTATTCTGCAGAAATCAGTCTGGCATTAAACTACCTTCACGAGCGTGGTATTATTTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAA
                                                  Xt7.1-CHK-1008226400                         GTGTGCGACTTGGTACGGTCTTCCAGGCTCAGCAATAGGAATCTGGAGAGGGAAAGGAAGAGAAGGGGTGAGGCCCCAGAAGCTACAGCGTTTTAGGGATTCTGTCCTACATACTCACAACCGCCAGGTATCCCAGAACGCCTTCTAGAGGACATGCCGACACAGAGGGACAACACCATGTCCCAGCCATCAGATCATTCCCACCAGGTCCGGGTCAAAGCGTATTTTAAGGGTGACATCATGATTACACATTTCGAACCCTCTATAACCTTTGATGGGCTGTGCAATGAGGTGCGGGACATGTGCTCTTTTGAAAACGACCAGCCTTTCACCATGAAGTGGATTGATGAAGAAGGAGATCCATGCACAGTTTCCTCTCAGTTGGAACTGGAAGAAGCTTTCCGTCTGTATGAATTGAATAAGGATTCTGAGCTGCTTATCCACGTGTTCCCATGTATACCAGAGAGGCCTGGCATGCCCTGCGCAGGGGAAGACAAGTCCATATATCGACGTGGAGCCAGAAGATGGAGAAAACTCTATTGTGCAAATGGTCACACTTTCCAGGCCAAGAGATTTAACAGGCGAGCGCACTGCGCCATCTGCACTGACCGAATATGGGGGCTGGGACGTCAGGGCTATAAATGCATCAACTGTAAACTGCTTGTTCATAAGAAATGTCACAAGCTTGTTTCCATTGAATGTGGCCGACACACAATAGCGGAACCTGTTATACCAATGGATCCACCAGGCATGCACTCTGATCACAGCGAACCAGAACTGCCATACAGACCAAGAAGCCAAGACAATCTAGATCAAGTTGGTGAAGAGAAAGAGGCAATGAACAGCAGGGAGAGTGGAAAGACCCCGTCTAGCCTGGGACTGCAAGACTTTGACCTTATGCGGGTCATTGGAAGAGGCAGCTATGCTAAAGTTCTGCTTGTCCGGTTAAAGAAAACAGAGAGAATCTATGCAATGAAAGTTGTCAAAAAGGAGCTTGTTAATGATGATGAGGATATTGACTGGGTGCAGACAGAGAAGCATGTGTTCGAGCAGGCCTCAAACCACCCTTTCCTAGTTGGGCTACACTCCTGCTTCCAGACAGAGAGCAGGCTATTTTTTGTAATTGAATATGTGAATGGTGGGGATCTGATGTTTCACATGCAGCGCCAAAGGAAGCTTCCCGAGGAGCATGCAAGGTTTTATTCTGCAGAAATCAGTCTGGCATTAAACTACCTTCACGAGCGTGGTATTATTTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAGAAA
                                                      consensus depths                        2     2     2     2     4     4     4     4     4     4     4     4     9    10    11    11    11    11    11    11    11    11    12    12    13    13    13    13    13    13    14    14    14    14    14    14    14    14    15    15    15    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    15    15    15    15    15    15    14    14    14    14    14    14    12    12    10    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    11    11    11    11    11    11    11    11     9     9     9     9     9     9    10    10     9     9     9     9     9     9     9     9     9    10     8     9     6     7     7     7     6     6     6     6     5     6     6     6     5     6     4     5     4     5     4     5     4     5     4     6     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     6     7     6     7     6     8     6     8     6     8     6     8     6     8     6     8     7     9     7     9     7     9     8    11     9    12     9    12    10    12    11    13    11    13    11    14    13    15    16    18    16    18    19    21    20    21    20    21    23    24    23    24    23    24    23    24    23    24    23    24    23    24    21    22    21    22    20    21    20    21    20    21    21    22    21    22    21    22    21    22    22    22    21    21    21    21    21    21    21    21    20    20    20    20    20    20    20    20    20    20    20    20    20    20    19    20    19    20    19    20    19    19    19    19    19    19    19    19    19    19    19    19    19    19    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    17    17    17    17    17    17    17    17    17    17    17    17    17    17    14    16    14    15    14    15    13    13
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --------G---
                                               BLH ATG     159    1926                   
                                               BLH MIN     135     310                   
                                               BLH MPR     126     310                   
                                               BLH OVR     159      14                   
                                               EST CLI      61      12                   
                                               ORF LNG     159       3                   
                                                                                                                                                                                                                                                                                PROTEIN === Ce ==== 0          NP_495011.1 protein kinase C, iota/lambda/zeta type, component of a PDZ-mediated proteincomplex PAR-6/PAR-3/PKC-3 required for establishing embryonic polarity (68.0 kD)(pkc-3) [Caenorhabditis elegans] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 0          XP_780275.1 PREDICTED: similar to Protein kinase C, iota type (nPKC-iota) (Atypical protein kinase C-lambda/iota) (aPKC-lambda/iota) (PRKC-lambda/iota) isoform 1 [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                       PROTEIN -== Dm ==== 0          NP_524892.2 atypical protein kinase C CG10261-PA [Drosophila melanogaster] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                       PREDICTED - Gg ---- 0          XP_417561.2 PREDICTED: similar to Protein kinase C zeta type (nPKC-zeta) [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                PROTEIN === Dr ==== 0          NP_571930.1 protein kinase C, iota [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                              PROTEIN --- Mm ---- 0          NP_032883.1 protein kinase C, lambda [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                              PROTEIN --- Hs ---- 0          NP_002731.3 protein kinase C, iota; atypical protein kinase C-lambda/iota; aPKC-lambda/iota[Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 0          AAA75362.1 protein kinase C subspecies zeta [Xenopus laevis]  =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                        PROTEIN === ?? ==== 0          NP_001084068.1 protein kinase C subspecies lambda/iota [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 0          CAJ82563.1 protein kinase C, iota [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG59853.3                                                                                                                      TAG---------------------------------------------------------ATG---------------------ATG------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  0   1   1           Gas  FL                     TGas097o15.FL-Sanger                                                                                     AGAAGGGGTGAGGCCCCAGAAGCTACAGCGTTTTAGGGATTCTGTCCTACATACTCACAACCGCCAGGTATCCCAGAACGCCTTCTAGAGGACATGCCGACACAGAGGGACAACACCATGTCCCAGCCATCAGATCATTCCCACCAGGTCCGGGTCAAAGCGTATTTTAAGGGTGACATCATGATTACACATTTCGAACCCTCTATAACCTTTGATGGGCTGTGCAATGAGGTGCGGGACATGTGCTCTTTTGAAAACGACCAGCCTTTCACCATGAAGTGGATTGATGAAGAAGGAGATCCATGCACAGTTTCCTCTCAGTTGGAACTGGAAGAAGCTTTCCGTCTGTATGAATTGAATAAGGATTCTGAGCTGCTTATCCACGTGTTCCCATGTATACCAGAGAGGCCTGGCATGCCCTGCGCAGGGGAAGACAAGTCCATATATCGACGTGGAGCCAGAAGATGGAGAAAACTCTATTGTGCAAATGGTCACACTTTCCAGGCCAAGAGATTTAACAGGCGAGCGCACTGCGCCATCTGCACTGACCGAATATGGGGGCTGGGACGTCAGGGCTATAAATGCATCAACTGTAAACTGCTTGTTCATAAGAAATGTCACAAGCTTGTTTCCATTGAATGTGGCCGACACACAATAGCGGAACCTGTTATACCAATGGATCCACCAGGCATGCACTCTGATCACAGCGAACCAGAACTGCCATACAGACCAAGAAGCCAAGACAATCTAGATCAAGTTGGTGAAGAGAAAGAGGCAATGAACAGCAGGGAGAGTGGAAAGACCCCGTCTAGCCTGGGACTGCAAGACTTTGACCTTATGCGGGTCATTGGAAGAGGCAGCTATGCTAAAGTTCTGCTTGTCCGGTTAAAGAAAACAGAGAGAATCTATGCAATGAAAGTTGTCAAAAAGGAGCTTGTTAATGATGATGAGGATATTGACTGGGTGCAGACAGAGAAGCATGTGTTCGAGCAGGCCTCAAACCACCCTTTCCTAGTTGGGCTACACTCCTGCTTCCAGACAGAGAGCAGGCTATTTTTTGTAATTGAATATGTGAATGGTGGGGATCTGATGTTTCACATGCAGCGCCAAAGGAAGCTTCCCGAGGAGCATGCAAGGTTTTATTCTGCAGAAATCAGTCTGGCATTAAACTACCTTCACGAGCGTGGTATTATTTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCGCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg  5g3  in                   TEgg064p04.p1kSP6 CCCGGGCCCCGGGCTCCCCCGGATGTGTGCGACTTGGTACGGTCTTCCAGGCTCAGCAATAGGAATCTGGAGAGGGAAAGGAAGAGAAGGGGTGAGGCCCCAGAAGCTACAGCGTTTTAGGGATTCTGTCCTACATACTCACAACCGCCAGGTATCCCAGAACGCCTTCTAGAGGACATGCCGACACAGAGGGACAACACCATGTCCCAGCCATCAGATCATTCCCACCAGGTCCGGGTCAAAGCGTATTTTAAGGGTGACATCATGATTACACATTTCGAACCCTCTATAACCTTTGATGGGCTGTGCAATGAGGTGCGGGACATGTGCTCTTTTGAAAACGACCAGCCTTTCACCATGAAGTGGATTGATGAAGAAGGAGATCCATGCACAGTTTCCTCTCAGTTGGAACTGGAAGAAGCTTTCCGTCTGTATGAATTGAATAAGGATTCTGAGCTGCTTATCCACGTGTTCCCATGTATACCAGAGAGGCCTGGCATGCCCTGCGCAGGGGAAGACAAGTCCATATATCGACGTGGAGCCAGAAGATGGAGAAAACTCTATTGTGCAAATGGTCACACTTTCCAGGCCAAGAGATTTAACAGGCGAGCGCACTGCGCCATCTGCACTGACCG
  5   1   2       bld Egg  5g                        TEgg034a24.p1kSP6       CTGGCCCCTCCCCCGGATGTGTGCGACTTGGTACGGTCTTCCAGGCTCAGCAATAGGAATCTGGAGAGGGAAAGGAAGAGAAGGGGTGAGGCCCCAGAAGCTACAGCGTTTTAGGGATTCTGTCCTACATACTCACAACCGCCAGGTATCCCAGAACGCCTTCTAGAGGACATGCCGACACAGAGGGACAACACCATGTCCCAGCCATCAGATCATTCCCACCAGGTCCGGGTCAAAGCGTATTTTAAGGGTGACATCATGATTACACATTTCGAACCCTCTATAACCTTTGATGGGCTGTGCAATGAGGTGCGGGACATGTGCTCTTTTGAAAACGACCAGCCTTTCACCATGAAGTGGATTGATGAAGAAGGAGATCCATGCACAGTTTCCTCTCAGTTGGAACTGGAAGAAGCTTTCCGTCTGTATGAATTGAATAAGGATTCTGAGCTGCTTATCCACGTGTTCCCATGTATACCAGAGAGGCCTGGCATGCCCTGCGCAGGGGAAGACAAGTCCATATATCGACGTGGAGCCAGAAGATGGAGACAACTCTATTGTGCAAATGGTCACACTTTCCAGGCCAAGAGATTTAAC
  5   1   2       bld Gas  5g3  in                   TGas108o05.p1kSP6                                  CCCGGGCGGTCTTCCAGGCTCAGCAATAGGAATCTGGAGAGGGAAAGGAAGAGAAGGGGTGAGGCCCCAGAAGCTACAGCGTTTTAGGGATTCTGTCCTACATACTCACAACCGCCAGGTATCCCAGAACGCCTTGTAGAGGACATGCCGACACAGAGGGACAACACCATGTCCCAGCCATCAGATCATTCCCACCAAGTCCGGGTCAAAGCGTATTTTAAGGGTGACATCATGATTACACATTTCGAACCCTCTATAACCTTTGATGGGCTGTGCAATGAGGTGCGGGACATGTGCTCTTTTGAAAACGACCAGCCTTTCACCATGAAGTGGATTGATGAAGAAGGAGATCCATGCACAGTTTCCTCTCAGTTGGAACTGGAAGAAGCTTTCCGTCTGTATGAATTGAATAAGGATTCTGAGCTGCTTATCCACGTGTTCCCATGTATACCAGAGAGGCCTGGCATGCCCTGCGCAGGGGAAGACAAGTCCATATATCGACGTGGAGCCAGAAGATGGAGAAAACTCTATTGTGCAAATGGTCACACTTTCCAGGCCAAGAGATTTAACAGGCGAGCGCACTGCGCCATCTGCACTGACCGAATATGGGGGGCTGGGACG
  5   1   2       bld Te5       in                         CAAO2670.5p                                        CGGTCTTCCAGGCTCAGCAATAGGAATCTGGAGAGGGAAAGGAAGAGAAGGGGTGAGGCCCCAGAAGCTACAGCGTTTTAGGGATTCTGTCCTACATACTCACAACCGCCAGGTATCCCAGAACGCCTTCTAGAGGACATGCCGACACAGAGGGACAACACCATGTCCCAGCCATCAGATCATTCCCACCAGGTCCGGGTCAAAGCGTATTTTAAGGGTGACATCATGATTACACATTTCGAACCCTCTATAACCTTTGATGGGCTGTGCAATGAGGTGCGGGACATGTGCTCTTTTGAAAACGACCAGCCTTTCACCATGAAGTGGATTGATGAAGAAGGAGATCCATGCACAGTTTCCTCTCAGTTGGAACTGGAAGAAGCTTTCCGTCTGTATGAATTGAATAAGGATTCTGAGCTGCTTATCCACGTGTTCCCATGTATACCAGAGAGGCCTGGCATGCCCTGCGCAGGGGAAGACAAGTCCATATATCGACGTGGAGCCAGAAGATGGAGAAAACTCTATTGTGCANATGGTCACACTTTCCAGGCCAAGAGATTTAACAGGCGAGCGCACTGCGCCATCTGCACTGACCGAATAT
  5   1   2   12  bld Gas7 PIPE in                         XZG59853.5p ...............................................................................GGAAGAGAAGGGGTGAGGCCCCAGAAGCTACAGCGTTTTAGGGATTCTGTCCTACATACTCACAACCGCCAGGTATCCCAGAACGCCTTCTAGAGGACATGCCGACACAGAGGGACAACACCATGTCCCAGCCATCAGATCATTCCCACCAGGTCCGGGTCAAAGCGTATTTTAAGGGTGACATCATGATTACACATTTCGAACCCTCTATAACCTTTGATGGGCTGTGCAATGAGGTGCGGGACATGTGCTCTTTTGAAAACGACCAGCCTTTCACCATGAAGTGGATTGATGAAGAAGGAGATCCATGCACAGTTTCCTCTCAGTTGGAACTGGAAGAAGCTTTCCGTCTGTATGAATTGAATAAGGATTCTGAGCTGCTTATCCACGTGTTCCCATGTATACCAGAGAGGCCTGGCATGCCCTGCGCAGGGGAAGACAAGTCCATATATCGACGTGGAGCCAGAAGATGGAGAAAACTCTATTGTGCAAATGGTCACACTTTCCAGGCCAAGAGATTTAACAGGCGAGCGCACTGCGCCATCTGCACTGACCGAATATGGGGGCTGGGACGTCAGGGCTATAAATGCATCAACTGTAAACTGCTTGTTCATAAGAAATGTCACAAGCTTGTTTCCATTGAATGTGGCCGACACACAATAGCGGAACCTGTTATACCAATGGATCCACCAGGCATGCACTCTGATCACAGCGAACCAGAACTGCCATACAGACCAAGAAGCCAAGACAATCTAGATCAAGTTGGTGAAGAGAAAGAGGCAATGAACAGCAGGNAGAGTGGAAAGACCCCGTCTAGCCTGGGAC
  5   1   2       bld Gas  5g3  in                   TGas072i05.p1cSP6                                                                                   AGAGAAGGGGTGAGGCCCCAGAAGCTACAGCGTTTTAGGGATTCTGTCCTACATACTCACAACCGCCAGGTATCCCAGAACGCCTTCTAGAGGACATGCCGACACAGAGGGACAACACCATGTCCCAGCCATCAGATCATTCCCACCAGGTCCGGGTCAAAGCGTATTTTAAGGGTGACATCATGATTACACATTTCGAACCCTCTATAACCTTTGATGGGCTGTGCAATGAGGTGCGGGACATGTGCTCTTTTGAAAACGACCAGCCTTTCACCATGAAGTGGATTGATGAAGAAGGAGATCCATGCACAGTTTCCTCTCAGTTGGAACTGGAAGAAGCTTTCCGTCTGTATGAATTGAATAAGGATTCTGAGCTGCTTATCCACGTGTTCCCATGTATACCAGAGAGGCCTGGCATGCCCTGCGCAGGGGAAGACAAGTCCATATATCGACGTGGAGCCAGAAGATGGAGAAAACTC
  5   1   2       bld Gas  5x3  out                  TGas054c18.p1cSP6                                                                                     AGAAGGGGTGAGGCCCCAGAAGCTACAGCGTTTTAGGGATTCTGTCCTACATACTCACAACCGCCAGGTATCCCAGAACGCCTTCTAGAGGACATGCCGACACAGAGGGACAACACCATGTCCCAGCCATCAGATCATTCCCACCAGGTCCGGGTCAAAGCGTATTTTAAGGGTGACATCATGATTACACATTTCGAACCCTCTATAACCTTTGATGGGCTGTGCAATGAGGTGCGGGACATGTGCTCTTTTGAAAACGACCAGCCTTTCACCATGAAGTGGATTGATGAAGAAGGAGATCCATGCACAGTTTCCTCTCAGTTGGAACTGGAAGAAGCTTTCCGTCTGTATGAATTGAATAAGGATTCTGAGCTGCTTATCCACGTGTTCCCATGTATACCAGAGAGGCCTGGCATGCCCTGCGCAGGGGAAGACAAGTCCATATATCGACGTGGAGCCAGAAGATGGAGAAAACTCTATTGTGCAAATGGTCACACTTTCCAGGCCAAGAGATTTAACAGGCGAGCGCACTGCGCCATCTGCACTGACCG
  5   1   2       bld Gas  FL   in                   TGas097o15.p1kSP6                                                                                     AGAAGGGGTGAGGCCCCAGAAGCTACAGCGTTTTAGGGATTCTGTCCTACATACTCACAACCGCCAGGTATCCCAGAACGCCTTCTAGAGGACATGCCGACACAGAGGGACAACACCATGTCCCAGCCATCAGATCATTCCCACCAGGTCCGGGTCAAAGCGTATTTTAAGGGTGACATCATGATTACACATTTCGAACCCTCTATAACCTTTGATGGGCTGTGCAATGAGGTGCGGGACATGTGCTCTTTTGAAAACGACCAGCCTTTCACCATGAAGTGGATTGATGAAGAAGGAGATCCATGCACAGTTTCCTCTCAGTTGGAACTGGAAGAAGCTTTCCGTCTGTATGAATTGAATAAGGATTCTGAGCTGCTTATCCACGTGTTCCCATGTATACCAGAGAGGCCTGGCATGCCCTGCGCAGGGGAAGACAAGTCCATATATCGACGTGGAGCCAGAAGATGGAGAAAACTCTATTGTGCAAATGGTCACACTTTCCAGGCCAAGAGATTTAACAGGCGAGCGCACTGCGCCATCTGCACTGACCGAATATGGGGGCTGGGACGTCAGGGCTATAAATGCATCAACTGTAAACTGCTTGTTCATAAGAAATGTCACAAGCTTGTTTCCATTGAATGTGGCCGACACACAATAGCGGAACCTGTTATACCAATGGATCCACCAGGCATGCACTCTGATCACAGCGAACCAGAACTGCCATACAGACCAAGAAGCCAAGACAATCTAGATCAAGTTG
  5   1   2       bld Gas  5g                        TGas034n04.p1kSP6                                                                                       GATTCCCCGGNGCCCANAAGCTACAGCGTTTTAGGGATTCTGTCCTACATACTCACAACCGCCAGGTATCCCAGAACGCCTTCTAGAGGACATGCCGACACAGAGGGACAACACCATGTCCCAGCCATCAGATCATTCCCACCAGGTCCGGGTCAAAGCGTATTTTAAGGGTGACATCATGATTACACATTTCGAACCCTCTATAACCTTTGATGGGCTGTGCAATGAGGTGCGGGACATGTGCTCTTTTGAAAACGACCAGCCTTTCACCATGAAGTGGATTGATGAAGAAGGAGATCCATGCACAGTTTCCTCTCAGTTGGAACTGGAAGAAGCTTTCCGTCTGTATGAATTGAATAAGGATTCTGAGCTGCTTATCCACGTGTTCCCATGTATACCAGAGAGGCCTGGCATGCCCTGCGCAGGGGAAGACAAGTCCATATATCGACGTGGAGCCAGAAGATGGAGAAAACTCTATTGTGCAAATGGTCACACTTTCCAGGCCAAGAGATTTAACAGGCGAGCGCACTGCGCCATCTGCACTGACCGAATATGGGGGCTGGGACGTCAGGGCTATAAATGCATCAACTGTAAACTGCTTGTTCATAAGAAATGTCACAAGCTTGTTTCCATTGAATGTGGCCGACACACAATAGCGGAACCTGTTATACCAATGGATCCACCAGGCATGCACTCTGATCACA
  5   1   2       bld Gas  5g                        TGas015a22.p1kSP6                                                                                           GGTGAGGCCCCAGAAGCTACAGCGTTTTAGGGATTCTGTCCTACATACTCACAACCGCCAGGTATCCCAGAACGCCTTCTAGAGGACATGCCGACACAGAGGGACAACACCATGTCCCAGCCATCAGATCATTCCCACCAGGTCCGGGTCAAAGCGTATTTTAAGGGTGACATCATGATTACACATTTCGAACCCTCTATAACCTTTGATGGGCTGTGCAATGAGGTGCGGGACATGTGCTCTTTTGAAAACGACCAGCCTTTCACCATGAAGTGGATTGATGAAGAAGGAGATCCATGCACAGTTTCCTCTCAGTTGGAACTGGAAGAAGCTTTCCGTCTGTATGAATTGAATAAGGATTCTGAGCTGCTTATCCACGTGTTCCCATGTATACCAGAGAGGCCTGGCATGCCCTGCGCAGGGGAAGACAAGTCCATATATCGACGTGGAGCCAGAAGATGGAGAAAACTCTATTGTGCAAATGGTCACACTTTCCAGGCCAAGAGATTTAACAGGCGAGCGCACTGCGCCATCTGCACTGACCGAATATGGGGGCTGGGACGTCAGGGCTATAAATGCATCAACTGTAAACTGCTTGTTCATAAGAAATGTCACAAGCTTGTTTCCATTGAATGTGGCCGACACACAATAGCGGAACCTGTTATACCAATGGATCCACCAGGCATGCACTCTGATCAC
  5   1   2   14  bld Brn4 5g3  in                         CAAL5689.5p .................................................................................................CCCCAGAAGCTACAGCGTTTTAGGGATTCTGTCCTACATACTCACAACCGCCAGGTATCCCAGAACGCCTTCTAGAGGACATGCCGACACAGAGGGACAACACCATGTCCCAGCCATCAGATCATTCCCACCAGGTCCGGGTCAAAGCGTATTTTAAGGGTGACATCATGATTACACATTTCGAACCCTCTATAACCTTTGATGGGCTGTGCAATGAGGTGCGGGACATGTGCTCTTTTGAAAACGACCAGCCTTTCACCATGAAGTGGATTGATGAAGAAGGAGATCCATGCACAGTTTCCTCTCAGTTGGAACTGGAAGAAGCTTTCCGTCTGTATGAATTGAATAAGGATTCTGAGCTGCTTATCCACGTGTTCCCATGTATACCAGAGAGGCCTGGCATGCCCTGCGCAGGGGAAGACAAGTCCATATATCGACGTGGAGCCAGAAGATGGAGAAAACTCTATTGTGCAAATGGTCACACTTTCCAGGCCAAGAGATTTAACAGGCGAGCGCACTGCGCCATCTGCACTGACCGAATATGGGGGCTGGGACGTCAGGGCTATAAATGCATCAACTGTAAACTGCTTGTTCATAAGAAATGTCACAAGCTTGTTTCCATTGAATGTGGCCGACACACAATAGCGGAACCTGTTATACCAATGGATCCACCAGGCATGCACTCTGATCACAGCGAACCAGAACTGCCATACAGACCAAGAAGCCAAGACAATCTAGATCAAGTTGGTGAAGAGAAAGAGGCAATGAACAGCAGGGAGAGTGGAAAGACCCCGTCTAGCCTGGGACTGCAAGACTTTGACCTTATGCGGGTCAT
  5   1   2   10  bld Spl1 5g3  in                         CABK1520.5p ......................................................................................................................................................GGTATCCCAGAACGCCTTCTAGAGGACATGCCGACACAGAGGGACAACACCATGTCCCAGCCATCAGATCATTCCCACCAGGTCCGGGTCAAAGCGTATTTTAAGGGTGACATCATGATTACACATTTCGAACCCTCTATAACCTTTGATGGGCTGTGCAATGAGGTGCGGGACATGTGCTCTTTTGAAAACGACCAGCCTTTCACCATGAAGTGGATTGATGAAGAAGGAGATCCATGCACAGTTTCCTCTCAGTTGGAACTGGAAGAAGCTTTCCGTCTGTATGAATTGAATAAGGATTCTGAGCTGCTTATCCACGTGTTCCCATGTATACCAGAGAGGCCTGGCATGCCCTGCGCAGGGGAAGACAAGTCCATATATCGACGTGGAGCCAGAAGATGGAGAAAACTCTATTGTGCAAATGGTCACACTTTCCAGGCCAAGAGATTTAACAGGCGAGCGCACTGCGCCATCTGCACTGACCGAATATGGGGGCTGGGACGTCAGGGCTATAAATGCATCAACTGTAAACTGCTTGTTCATAAAAAATGTCACAAGCTTGTTTCCATTGAATGTGGCCGACACACAATAGCGGAACCTGTTATACCAATGGATCCACCAGGCATGCACTCTGATCACAGCGAACCAGAACTGCCATACAGACCAAGAAGCCAAGACAATCTAGATCAAGTTGGTGAAGAGAAAGAGGCAATGAACAGCAGGGAGAGTGGAAAGACCCCGTCTAGCCTGGGACTGCAAGACTTTG
  5   1   2   12  bld Gas7 5g3  in                         XZG41334.5p ...........................................................................................................................................................CCCAGAACGCCTTCTAGAGGACATGCCGACACAGAGGGACAACACCATGTCCCAGCCATCAGATCATTCCCACCAGGTCCGGGTCAAAGCGTATTTTAAGGGTGACATCATGATTACACATTTCGAACCCTCTATAACCTTTGATGGGCTGTGCAATGAGGTGCGGGACATGTGCTCTTTTGAAAACGACCAGCCTTTCACCATGAAGTGGATTGATGAAGAAGGAGATCCATGCACAGTTTCCTCTCAGTTGGAACTGGAAGAAGCTTTCCGTCTGTATGAATTGAATAAGGATTCTGAGCTGCTTATCCACGTGTTCCCATGTATACCAGAGAGGCCTGGCATGCCCTGCGCAGGGGAAGACAAGTCCATATATCGACGTGGAGCCAGAAGATGGAGAAAACTCTATTGTGCAAATGGTCACACTTTCCAGGCCAAGAGATTTAACAGGCGAGCGCACTGCGCCATCTGCACTGACCGAATATGGGGGCTGGGACGTCAGGGCTATAAATGCATCAACTGTAAACTGCTTGTTCATAAGAAATGTCACAAGCTTGTTTCCATTGAATGTGGCCGACACACAATAGCGGAACCTGTTATACCAATGGATCCACCAGGCATGCACTCTGATCACAGCGAACCAGAACTGCCATACAGACCAAGAAGCCAAGACAATCTAGATCAAGTTGGTGAAGAGAAAGAGGCAATGAACAGCAGGGAGAGTGGAAAGACCCCGTCTAGCCTGGGACTGCAAGACTTTGACCTTATGCGGGTCATTGGAAGAGGCAGCTATGCTAAAGTTCTGCTTG
  5   1   2       bld Gas                            TGas039g01.p1kSP6                                                                                                                                                                                                 GACAACACCATGTCCCAGCCATCAGAACATTCCCACCAGGTCCGGGTCAAAGCGTATTTTAAGGGTGACATCATGATTACACATTTCGAACCCTCTATAACCTTTGATGGGCTGTGCAATGAGGTGCGGGACATGTGCTCTTTTGAAAACGACCAGCCTTTCACCATGAAGTGGATTGATGAAGAAGGAGATCCATGCACAGTTTCCTCTCAGTTGGAACTGGAAGAAGCTTTCCGTCTGTATGAATTGAATAAGGATTCTGAGCTGCTTATCCACGTGTTCCCATGTATACCAGAGAGGCCTGGCATGCCCTGCGCAGGGGAAGACAAGTCCATATATCGACGTGGAGCCAGAAGATGGAGAAAACTCTATTGTGCAAATGGTCACACTTTCCAGGCCAAGAGATTTAACAGGCGAGCGCACTGCGCCATCTGCACTGACCGAATATGGGGGCTGGGACGTCAGGGCTATAAATGCATCAACTGTAAACTGCTTGTTCATAAGAAATGTCACAAGCTTGTTTCCATTGAATGTGGCCGACACACAATAGCGGAACCTGTTATACCAATGGATCCACCAGGCATGCACTCTGATCACAGCGAACCAGAACTGCCATACAGACCAAGAAGCCAAGACAATCTAGATCAAGTTGGTGAAGAGAAAAGAGCAATGAACAGCAGGGAGAGTGGAAAGACCCCGTCTAGCCTGGGACTGC
  5   1   2       bld Gas7      in                         XZG21854.5p                                                                                                                                                                                                                                                CAAAGCGTATTTTAAGGGTGACATCATGATTACACATTTCGAACCCTCTATAACCTTTGATGGGCTGTGCAATGAGGTGCGGGACATGTGCTCTTTTGAAAACGACCAGCCTTTCACCATGAAGTGGATTGATGAAGAAGGAGATCCATGCACAGTTTCCTCTCAGTTGGAACTGGAAGAAGCTTTCCGTCTGTATGAATTGAATAAGGATTCTGAGCTGCTTATCCACGTGTTCCCATGTATACCAGAGAGGCCTGGCATGCCCTGCGCAGGGGAAGACAAGTCCATATATCGACGTGGAGCCAGAAGATGGAGAAAACTCTATTGTGCAAATGGTCACACTTTCCAGGCCAAGAGATTTAACAGGCGAGCGCACTGCGCCATCTGCACTGACCGAATATGGGGGCTGGGACGTCAGGGCTATAAATGCATCAACTGTAAACTGCTTGTTCATAAGAAATGTCACAAGCTTGTTTCCATTGAATGTGGCCGACACACAATAGCGGAACCTGTTATACCAATGGATCCACCAGGCATGCACTCTGATCACAGCGAACCAGAACTGCCATACAGACCAAGAAGCCAAGACAATCTAGATCAAGTTGGTGAAGAGAAAGAGGCAATGAACAGCAGGGAGAGTGGAAAGACCCCGTCTAGCCTGGGGCTGCAAGACTTTGACCTTATGCGGGTCATTGGAAGAGGCAGCTATGCTAAAGTTCTGCTTGTCCGGGTAAAGAAAACAGAGAGAATCTATG
  5   1   2       bld Gas7      in                         XZG50876.5p                                                                                                                                                                                                                                                                            ATTACACATTTCGAACCCTCTATAACCTTTGATGGGCTGTGCAATGAGGTGCGGGACATGTGCTCTTTTGAAAACGACCAGCCTTTCACCATGAAGTGGATTGATGAAGAAGGAGATCCATGCACAGTTTCCTCTCAGTTGGAACTGGAAGAAGCTTTCCGTCTGTATGAATTGAATAAGGATTCTGAGCTGCTTATCCATGTGTTCCCATGTATACCAGAGAGGCCTGGCATGCCCTGCGCAGGGGAAGACAAGTCCATATATCGACGTGGAGCCAGAAGATGGAGAAAACTCTATTGTGCAAATGGTCACACTTTCCAGGCCAAGAGATTTAACAGGCGAGCGCACTGCGCCATCTGCACTGACCGAATATGGGGGCTGGGACGTCAGGGCTATAAATGCATCAACTGTAAACTGCTTGTTCATAAGAAATGTCACAAGCTTGTTTCCATTGAATGTGGCCGACACACAATAGCGGAACCTGTTATACCAATGGATCCACCAGGCATGCACTCTGATCACAGCGAACCAGAACTGCCATACAGACCAAGAAGCCAAGACAATCTAGATCAAGTTGGTGAAGAGAAAGAGGCAATGAACAGCAGGGAGAGTGGAAAGACCCCGTCTAGCCTGGGACTGCAAGACTTTGACCTTATGCGGGTCATTGGAAGAGGCAGCTATGCTAAAGTTCTGCTTGTCCGGTTAAAGAAACAGAGAGAATCTATGCAATGAAAGTTGTCAAAAAGGAGCTTGTTAATGATGATGAGGATATTGACTGGGTGCAGACAG
  3   1   0       chi TpA       out                  TTpA076m19.q1kaT7                                                                                                                                                                                                                                                                                   ACGTGGAGCCAGAAGATGGAGAAAACTCTATTGTGCAAATGGTCACACTTTCCAGGCCAAGAGATTTAACAGGGTGATTATAAATATAATTTTTCAAGGGATTCTTTTACCTTTCTTGATAACACAGGTTTTTATTACCTTTCTTAAGAGCTTGATAAAACCTCTGTGGCACAATAGTGATTTTTTGATTGATAAAGAAAAAGTATATTTGAGAAAAAGAGCATCCTACACAGGGCAAATTAACGTATGTGTGGGTGGGTGTTATACTATGAAGCCTGTTGGCCTGGAAGTGTTTGGATTGGTGTTGATGCCATGTATAATTTTTTTCCAGCGAGCGCAATGCGCCATCTGCATCTGACCGAATATGGGGGATGGGACGTCAGGGCTATAAATGCATCAACTGTAAACTGCTTGTTCATAAAAAATGTCACAAGCTTGTTTCCATTGAATGTGGCCGACACACAATACCGGTAAGTAATATGTGCCACCGTGACTGATGCCTTAGATTATTTCCTAAGGGCACATTTTTATTTGTGGGCAATTAGCATACACAGCACTCTATATATTTTTATCTGAATATATGGGGGACAACCCCAACATAAAATATTTTTCCAAATTCTTACCATGCGAAAACTAACAGAAAAATCCCTGTTATATATTTCGCTGCTAGGACAAAAAAAAAAAAAAAAAA
  5   1   2       bld Brn4      in                        CAAL22783.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGCTTGTTTCCATTGAATGTGGCCGACACACAATAGCGGAACCTGTTATACCAATGGATCCACCAGGCATGCACTCTGATCACAGCGAACCAGAACTGCCATACAGACCAAGAAGCCAAGACAATCTAGATCAAGTTGGTGAAGAGAAAGAGGCAATGAACAGCAGGGAGAGTGGAAAGACCCCGTCTAGCCTGGGACTGCAAGACTTTGACCTTATGCGGGTCATTGGAAGAGGCAGCTATGCTAAAGTTCTGCTTGTCCGGTTAAAGAAAACAGAGAGAATCTATGCAATGAAAGTTGTCAAAAAGGAGCTTGTTAATGATGATGAGGATATTGACTGGGTGCAGACAGAGAAGCATGTGTTCGAGCAGGCCTCAAACCACCCTTTCCTAGTTGGGCTACACTCCTGCTTCCAGACAGAGAGCAGGCTATTTTTTGTAATTGAATATGTGAATGGTGGGGATCTGATGTTTCACATGCAGCGCCAAAGGAAGCTTCCCGAGGAGCATGCAAGGTTTTATTCTGCAGAAATCAGTCTGGCATTAAACTACCTTCACGAGCGTGGTATTATTTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCGCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAAGTCACCTTTTGATATCGTTGGGAGCTC
  5   1   2       bld HeRe      in                     EC2CAA29DG11.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAGACAATCTAGATCAAGTTGGTGAAGAGAAAGAGGCAATGAACAGCAGGGAGAGTGGAAAGACCCCGTCTAGCCTGGGACTGCAAGACTTTGACCTTATGCGGGTCATTGGAAGAGGCAGCTATGCTAAAGTTCTGCTTGTCCGGTTAAAGAAAACAGAGAGAATCTATGCAATGAAAGTTGTCAAAAAGGAGCTTGTTAATGATGATGAGGATATTGACTGGGTGCAGACAGAGAAGCATGTGTTCGAGCAGGCCTCAAACCACCCTTTCCTAGTTGGGCTACACTCCTGCTTCCAGACAGAGAGCAGGCTATTTTTTGTAATTGAATATGTGAATGGTGGGGATCTGATGTTTCACATGCAGCGCCAAAGGAAGCTTCCCGAGGAGCATGCAAGGTTTTATTCTGCAGAAATCAGTCTGGCATTAAACTACCTTCACGAGCGTGGTATTATTTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTTTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAG
  5   1   2       bld Gas8      in                          st97n05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTGCGAATAAACCTTGCATGCTCCTCGGGAAGCTTACTTTGACCTTATGCGGGTCATTGGAAGAGGCAGCTATGCTAAAGTTCTGCTTGTCCGGTTAAAGAAAACAGAGAGAATCTATGCAATGAAAGTTGTCAAAAAGGAGCTTGTTAATGATGATGAGGATATTGACTGGGTGCAGACAGAGAAGCATGTGTTCGAGCAGGCCTCAAACCACCCTTTCCTAGTTGGGCTACACTCCTGCTTCCAGACAGAGAGCAGGCTATTTTTTGTAATTGAATATGTGAATGGTGGGGATCTGATGTTTCACATGCAGCGCCAAAGGAAGCTTCCCGAGGAGCATGCAAGGTTTTATTCTGCAGAAATCAGTCTGGCATTAAACTACCTTCACGAGCGTGGTATTATTTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCA
  5   1   2       bld Gas7      in                         XZG38757.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACGNNCGTCCGCCGGTTAAAGAAAACAGAGAGAATCTATGCAATGAAAGTTGTCAAAAAGGAGCTTGTTAATGATGATGAGGATATTGACTGGGTGCAGACAGAGAAGCATGTGTTCGAGCAGGCCTCAAACCACCCTTTCCTAGTTGGGCTACACTCCTGCTTCCAGACAGAGAGCAGGCTATTTTTTGTAATTGAATATGTGAATGGTGGGGATCTGATGTTTCACATGCAGCGCCAAAGGAAGCTTCCCGAGGAGCATGCAAGGTTTTATTCTGCAGAAATCAGTCTGGCATTAAACTACCTTCACGAGCGTGGTATTATTTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTC
  5   1   2       bld Neu                            TNeu128d09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCTCCCTGAGCGCCTTTGGCACAACCAACCCAATTGAGCCGCGGACTTCTGCTCCTTGGAACACATAGACAAATCCAAATTCAGCAACAGGTGATGGGGGCTATTTTTTGTAATTGAATATGTGAATGGTGGGGATCTGATGTTTCACATGCAGCGCCAAAGGAAGCTTCCCGAGGAGCATGCAAGGTTTTATTGGGGAGAAATCATCTGGCATTAAACTACCTTCACGAGCGTGGTATTATTTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTC
  5   1   2       bld Gas7                                 XZG12805.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCTACACTCCTGCTTCCTGACAGAGAGCAGGCTATTTTTTGTAATTGAATATGTGAATGGTGGGGATCTGATGTTTCACATGCAGCGCCAAAGGAAGCTTCCCGAGGAGCATGCAAGGTTTTATTCTGCAGAAATCAGTCTGGCATTAAACTACCTTCACGAGCGTGGTATTATTTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGGGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTT
  5   1   2       bld Egg                            TEgg129c11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTGTAATTGAATATGTGAATGGTGGGGATCTGATGTTTCACATGCAGCGCCAAAGGAAGCTTCCCGAGGAGCATGCAAGGTTTTATTCTGCAGAAATCAGTCTGGCATTAAACTACCTTCACGAGCGTGGTATTATTTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGGAATTTG
  5   1   2       bld Gas7                                  XZG8086.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGGGATCTGATGTTTCCATGCAGCGCCAAAGGAAGCTTCCCGAGGAGCATGCAAGGTTTTATTCTGCAGAAATCAGTCTGGCATTAAACTACCTTCACGAGCGTGGTATTATTTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCGCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCA
  3   1   2       bld Gas  FL   in                    TGas097o15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGAAATCAGTCTGGCATAAACTACCTTCACGAGCGTGGTATTATTATAGAGATTTAAAGCTAGACAATGTCTTATTGGTTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCGCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  5g3  in                    TGas072i05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATTATTTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATNATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCGCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTAAAGCTCTGGATCGGAAAATGGGATAGTTTA
  3   1   2       bld Gas7 PIPE in                         XZG59853.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCGCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTTAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAG
  3   1   2       bld Gas  5g3  in                    TGas108o05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGAGATTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAGAAAAAAAAAAAAAAAAAAGCTAGGTCGACGC
  3   1   2       bld Gas7      in                         XZG38757.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGAGGGGGTGAGGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACG
  3   1   2       bld Spl1 5g3  in                         CABK1520.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCATGTGTAAAGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAG
  3   1   2       bld Gas8      in                          st97n05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGCCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTAAAGCTCTGGATCG
  3   1   2       bld Brn4 5g3  in                         CAAL5689.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCGCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAG
  5   1   2      seed Gas7                                 XZG49461.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAGAAAAAAAAAAGACATCTCCGGGTTCG
  3   1   2       bld Brn4      in                        CAAL22783.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCGCTTGGGGTCTTGATGTNTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAG
  3   1   2       bld Gas7 5g3  in                         XZG41334.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCGCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAG
  3   1   2       bld Gas                             TGas097n02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACA
  3   1   2       bld Gas7      in                         XZG50876.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTNTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAG
  3   1   2       bld Gas7      in                         XZG21854.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAG
  3   1   2       bld HeRe      in                     EC2CAA29DG11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTTTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAACAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGCCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCGCAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGC
  3   1   2       bld Te5       in                         CAAO2670.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGGATTATGGTTTCAGCGTTGATTGGTGGGCGCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAG
  3   1   2       bld Egg  5g3  in                    TEgg064p04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       ?                     TGas054c20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAGAAAAAAAACGCAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)