Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 25 Oct 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TNeu072k21.3.5                       61 END     1           2        1                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012075413 Xt7.1-XZG59853.3 - 43 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                        2     2     2     2     4     4     4     4     4     4     4     4     9    10    11    11    11    11    11    11    11    11    12    12    13    13    13    13    13    13    14    14    14    14    14    14    14    14    15    15    15    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    15    15    15    15    15    15    14    14    14    14    14    14    12    12    10    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    11    11    11    11    11    11    11    11     9     9     9     9     9     9    10    10     9     9     9     9     9     9     9     9     9    10     8     9     6     7     7     7     6     6     6     6     5     6     6     6     5     6     4     5     4     5     4     5     4     5     4     6     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     6     7     6     7     6     8     6     8     6     8     6     8     6     8     6     8     7     9     7     9     7     9     8    11     9    12     9    12    10    12    11    13    11    13    11    14    13    15    16    18    16    18    19    21    20    21    20    21    23    24    23    24    23    24    23    24    23    24    23    24    23    24    21    22    21    22    20    21    20    21    20    21    21    22    21    22    21    22    21    22    22    22    21    21    21    21    21    21    21    21    20    20    20    20    20    20    20    20    20    20    20    20    20    20    19    20    19    20    19    20    19    19    19    19    19    19    19    19    19    19    19    19    19    19    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    17    17    17    17    17    17    17    17    17    17    17    17    17    17    14    16    14    15    14    15    13    13
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --------G---
                                               BLH ATG     159    1926                   
                                               BLH MIN     135     310                   
                                               BLH MPR     126     310                   
                                               BLH OVR     159      14                   
                                               EST CLI      61      12                   
                                               ORF LNG     159       3                   
                                                                                                                                                                                                                                                                                PROTEIN === Ce ==== 0          NP_495011.1 protein kinase C, iota/lambda/zeta type, component of a PDZ-mediated proteincomplex PAR-6/PAR-3/PKC-3 required for establishing embryonic polarity (68.0 kD)(pkc-3) [Caenorhabditis elegans] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 0          XP_780275.1 PREDICTED: similar to Protein kinase C, iota type (nPKC-iota) (Atypical protein kinase C-lambda/iota) (aPKC-lambda/iota) (PRKC-lambda/iota) isoform 1 [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                       PROTEIN -== Dm ==== 0          NP_524892.2 atypical protein kinase C CG10261-PA [Drosophila melanogaster] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                       PREDICTED - Gg ---- 0          XP_417561.2 PREDICTED: similar to Protein kinase C zeta type (nPKC-zeta) [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                PROTEIN === Dr ==== 0          NP_571930.1 protein kinase C, iota [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                              PROTEIN --- Mm ---- 0          NP_032883.1 protein kinase C, lambda [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                              PROTEIN --- Hs ---- 0          NP_002731.3 protein kinase C, iota; atypical protein kinase C-lambda/iota; aPKC-lambda/iota[Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 0          AAA75362.1 protein kinase C subspecies zeta [Xenopus laevis]  =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                        PROTEIN === ?? ==== 0          NP_001084068.1 protein kinase C subspecies lambda/iota [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 0          CAJ82563.1 protein kinase C, iota [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG59853.3                                                                                                                      TAG---------------------------------------------------------ATG---------------------ATG------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   2       bld HeRe      in                     EC2CAA29DG11.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAGACAATCTAGATCAAGTTGGTGAAGAGAAAGAGGCAATGAACAGCAGGGAGAGTGGAAAGACCCCGTCTAGCCTGGGACTGCAAGACTTTGACCTTATGCGGGTCATTGGAAGAGGCAGCTATGCTAAAGTTCTGCTTGTCCGGTTAAAGAAAACAGAGAGAATCTATGCAATGAAAGTTGTCAAAAAGGAGCTTGTTAATGATGATGAGGATATTGACTGGGTGCAGACAGAGAAGCATGTGTTCGAGCAGGCCTCAAACCACCCTTTCCTAGTTGGGCTACACTCCTGCTTCCAGACAGAGAGCAGGCTATTTTTTGTAATTGAATATGTGAATGGTGGGGATCTGATGTTTCACATGCAGCGCCAAAGGAAGCTTCCCGAGGAGCATGCAAGGTTTTATTCTGCAGAAATCAGTCTGGCATTAAACTACCTTCACGAGCGTGGTATTATTTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTTTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAG
  5   1   2       bld Gas8      in                          st97n05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTGCGAATAAACCTTGCATGCTCCTCGGGAAGCTTACTTTGACCTTATGCGGGTCATTGGAAGAGGCAGCTATGCTAAAGTTCTGCTTGTCCGGTTAAAGAAAACAGAGAGAATCTATGCAATGAAAGTTGTCAAAAAGGAGCTTGTTAATGATGATGAGGATATTGACTGGGTGCAGACAGAGAAGCATGTGTTCGAGCAGGCCTCAAACCACCCTTTCCTAGTTGGGCTACACTCCTGCTTCCAGACAGAGAGCAGGCTATTTTTTGTAATTGAATATGTGAATGGTGGGGATCTGATGTTTCACATGCAGCGCCAAAGGAAGCTTCCCGAGGAGCATGCAAGGTTTTATTCTGCAGAAATCAGTCTGGCATTAAACTACCTTCACGAGCGTGGTATTATTTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCA
  5   1   2       bld Gas7      in                         XZG38757.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACGNNCGTCCGCCGGTTAAAGAAAACAGAGAGAATCTATGCAATGAAAGTTGTCAAAAAGGAGCTTGTTAATGATGATGAGGATATTGACTGGGTGCAGACAGAGAAGCATGTGTTCGAGCAGGCCTCAAACCACCCTTTCCTAGTTGGGCTACACTCCTGCTTCCAGACAGAGAGCAGGCTATTTTTTGTAATTGAATATGTGAATGGTGGGGATCTGATGTTTCACATGCAGCGCCAAAGGAAGCTTCCCGAGGAGCATGCAAGGTTTTATTCTGCAGAAATCAGTCTGGCATTAAACTACCTTCACGAGCGTGGTATTATTTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTC
  5   1   2       bld Neu                            TNeu128d09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCTCCCTGAGCGCCTTTGGCACAACCAACCCAATTGAGCCGCGGACTTCTGCTCCTTGGAACACATAGACAAATCCAAATTCAGCAACAGGTGATGGGGGCTATTTTTTGTAATTGAATATGTGAATGGTGGGGATCTGATGTTTCACATGCAGCGCCAAAGGAAGCTTCCCGAGGAGCATGCAAGGTTTTATTGGGGAGAAATCATCTGGCATTAAACTACCTTCACGAGCGTGGTATTATTTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTC
  5   1   2       bld Gas7                                 XZG12805.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCTACACTCCTGCTTCCTGACAGAGAGCAGGCTATTTTTTGTAATTGAATATGTGAATGGTGGGGATCTGATGTTTCACATGCAGCGCCAAAGGAAGCTTCCCGAGGAGCATGCAAGGTTTTATTCTGCAGAAATCAGTCTGGCATTAAACTACCTTCACGAGCGTGGTATTATTTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGGGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTT
  5   1   2       bld Egg                            TEgg129c11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTGTAATTGAATATGTGAATGGTGGGGATCTGATGTTTCACATGCAGCGCCAAAGGAAGCTTCCCGAGGAGCATGCAAGGTTTTATTCTGCAGAAATCAGTCTGGCATTAAACTACCTTCACGAGCGTGGTATTATTTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGGAATTTG
  5   1   2       bld Gas7                                  XZG8086.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGGGATCTGATGTTTCCATGCAGCGCCAAAGGAAGCTTCCCGAGGAGCATGCAAGGTTTTATTCTGCAGAAATCAGTCTGGCATTAAACTACCTTCACGAGCGTGGTATTATTTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCGCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCA
  3   1   2       bld Gas  FL   in                    TGas097o15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGAAATCAGTCTGGCATAAACTACCTTCACGAGCGTGGTATTATTATAGAGATTTAAAGCTAGACAATGTCTTATTGGTTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCGCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  5g3  in                    TGas072i05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATTATTTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATNATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCGCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTAAAGCTCTGGATCGGAAAATGGGATAGTTTA
  3   1   2       bld Gas7 PIPE in                         XZG59853.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTATAGAGATTTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCGCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTTAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAG
  3   1   2       bld Gas  5g3  in                    TGas108o05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGAGATTAAAGCTAGACAATGTCTTATTGGATTCTGAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAGAAAAAAAAAAAAAAAAAAGCTAGGTCGACGC
  3   1   2       bld Gas7      in                         XZG38757.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGGGCACATAAAACTTACTGACTACGGCATGTGTAAGAGGGGGTGAGGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACG
  3   1   2       bld Spl1 5g3  in                         CABK1520.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCATGTGTAAAGAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAG
  3   1   2       bld Gas8      in                          st97n05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGGGGTTGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGCCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTAAAGCTCTGGATCG
  3   1   2       bld Brn4 5g3  in                         CAAL5689.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAGGCCTGGAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCGCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAG
  5   1   2      seed Gas7                                 XZG49461.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAGAAAAAAAAAAGACATCTCCGGGTTCG
  3   1   2       bld Brn4      in                        CAAL22783.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATACAACTAGTACATTCTGTGGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCGCTTGGGGTCTTGATGTNTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAG
  3   1   2       bld Gas7 5g3  in                         XZG41334.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCGCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAG
  3   1   2       bld Gas                             TGas097n02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACA
  3   1   2       bld Gas7      in                         XZG50876.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTCCAAATTATATCGCTCCTGAGATCCTACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTNTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAG
  3   1   2       bld Gas7      in                         XZG21854.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACGAGGAGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAG
  3   1   2       bld HeRe      in                     EC2CAA29DG11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAGGATTATGGTTTCAGCGTTGATTGGTGGGCTCTTGGGGTTTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAACAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGCCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCGCAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGC
  3   1   2       bld Te5       in                         CAAO2670.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGGATTATGGTTTCAGCGTTGATTGGTGGGCGCTTGGGGTCTTGATGTTTGAGATGATGGCCGGAAGGTCACCTTTTGATATCGTTGGAAGCTCAGACAATCCAGACCAAAACACAGAAGATTTTCTTTTCCAAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAG
  3   1   2       bld Egg  5g3  in                    TEgg064p04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGTCATTCTGGAAAAGCAAATCCGTATTCCAAGGTCGCTTTCAGTAAAGGCTGCAAGTGTTTTAAAAAGCTTTCTTAACAAGGATCCAAAGGATCGCCTTGGCTGTCACCCTCAGACAGGATTTGCAGATATCCAGGGACATCAGTTTTTCCGCAATGTAGACTGGGATCTTATGGAGCAAAAACAGGTGGTGCCTCCATTTAAGCCCAATATATCGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       ?                     TGas054c20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGGGGAATTTGGTTTGGATAACTTTGATGCTCAGTTCACTAATGAACCAGTGCAGCTTACCCCTGATGATGAGGATGTGGTGAGGAAGATTGACCAGTCAGAGTTTGAAGGCTTTGAATATATCAACCCACTACTGATGTCTGCTGAAGAATGTGTATAATTTATAGGACAGCTCCGCAGGACACATCAGCCTCGGCTGGCTCTGTCTCTCTTCTGCAGGGACAACTACTGTGTGAATATTATCCTGGAAAGCACAATCTGCAGTATTGCTGTACCGCTGTGTGCTAATGTATATCAGCTATTTAAAGCTCTGGATCGGTAAAATGGGATATGTTTATTGTACGAACAGAAAAAAAACGCAAAAAAAAAAAAAAAAAA

In case of problems mail me! (