Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABI7914.5                            2 END     2           6      100                ovomucin alpha-subunit [Gallus gallus]

 This cluster: approximate FL confidence score = 0%

 1012075415 Xt7.1-CABI1491.3 - 32 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABI1491.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGATTTGACTTCAGTGGGGAATGTGATTATATCTTAGCCCAGGACTTTTGCCCTGGCAATGAAAATGCAGGGAGCTTCCGAATCATCACCGAAAATATTGTATGCGGAGAGGCTGAATCCATCTGTTCTCTTGGCATCAAGATCATCTTAAAGAATGCAACAATCGAACTCTTTGAAGGTCGGGCGGAAGAATCTAAAAGAGAATCTAACAATAGCAATTTCTATACGATAGATATAATTGGACTTTTCATTGTGTTGAAAACCACTGATGGTCTCACCTTCATGTGGGACCAGAAAACCACAGCTATTGTCCAACTTTCCCAGTCATTTCAGGGACGCGTTTGTGGACTCTGTGGGAACTTTGATGGCCTCTCAGTCAATGACTTTACTTCCTCGTGGCAGTCCTTGGAGGAGAATGAGAACGTGTTTGCAGACAGCTGGAAAGTGACGCCGAGTTGTAACAGCGGCTTACGGGAAAACACTTGTCTGACAAACCCCTTTAAGTTCCCCTGGGCTCAAAAACACTGCAGCTTAATTAAAAGTGAAGTCTTTGCTCCCTGTCATGCAAAGGTTGATCCGATCCCATATTATGATTCCTGTGTCACTGACTCTTGCAGTTGTAATAATGGAGGCGATTGTGAGTGCCTGTGCACCTCTATAGCAGCCTACGCTTCTGCCTGCAGGAGAAGCAACATCTGCATTGCATGGAGGACTCCAGACATTTGCCCTGTATTCTGTGATTACTATAACAAGGATGGAAGGTGTGAATGGCACTATCAGCCTTGTGGTGCTCCTTGCCTGGTAACTTGCAGAAATCCCATGGGAAAGTGTGATAATGATACCCAGCACCTTGAAGGATGCTACCCAACCTGTAGTAATACTCATCCTTATTTTGACGAAAACACCAAACACTGTGTCCCAGTTTTGAATTGTACAACTTGTGTTCCGGAAGAAAATCTTTGCAATGAAAGATCTGCAGAGTGCCTTTGCTGCCACGAGGGAAAGACATACCGCTTCTTACAGGAGATCTCTATAATCCTGGAGGGAAAAAGCTGTGTGATTGGATATTGTGGCGCTGATGGAGACATTATTTTGACATCCAACGTCTGTGGTGTCATTACCACAGTATCTACACCTGCACGTACAAGTATTCCAGGTCCTCCTTCTACAGGAAAGATACCAACCTCTCAAGTCTTGCTTACAAGCAAGGCAACTTCTACCACATCGGTTCCCATGAAAACCTCTACTGTGCATCCTGGGATTTCAAGAACCAGTGAGAGAACCACCCATATTACAACACCTTATCGGTATTCATTAACACAAAGCTTTGTGTCATTTACTAATTATTCCAGAATATTAATTACAACTAAGGGCGTTTCATCAGCAACTACCTCCTCATTGGAAAGAAAGAGTACATCCCCAAAAACACAAAAAACTTACAGCAGAACCAGTGTGCCTATCCATATACCTGTTACTACACAAAATATCACACCAACTGCCCCAGCAACAGAAAAGACATTTACCCTACTTACAACGGCTCCAGCAACAGAAAGGACATCTACCCTACTTACAACTGTCCCAGAACTAGGAAGCAAATCTACCCTACTTACAACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACGACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGCCCCAGCTTCAGGAAGTAAATCTACTCTACTTACAACTGCCCCAGCTTCAGGAAGCAAATCTACTCTACTTACAACAATTCCAAAAGTCTCTTCTAAAAGTGCCACTACGCATGCTATTTCATCCAATGCCACAACACCTTTGAAGACTACAGTAAAGGAACTGAGTGCAAAGACCAAGTTTCCATCTACAACAACTTTAGTCTCAAAAGAAAGAGAAAATGTTACACAACTATTTACAAGAAAAACATTAACAACTTCATCACCTCATGTTACAATACCAACAGCAGGTGACTGCCAAATGATGACATATAATGAATATATAGCAAAGGGTGAATGCATCACACAGCAGAAGGTATCGGTCAGTTATTGCGCTGGACATTGCCCCACATTTGCTAGATATTCCTATGAAGCTGAAATGATGACTCGACAGTGTTCCTGTTGCGCTGAGACACATAAAAGCACCCGGAACGTTCAGTTGCACTGCCCCAACGGAACTGTGTCCCCCTATACGTACATTCACGTGGAGCTGTGTTCCTGCATGCAAGTAAAATGTTTCCAGGAAACTGTCGGCAACCCTTAAGAACAATGAACTGAGCTTTTCTTATATGTTAAAAATCCTCATATTTTTATGATTTGAGTAGGTGAGATAAACATTGCTATTAGGTTTTTATTTAGAAAGAAAAATTCATATTTTATTCAATGATATCTACCTATATTTTTGCTGAGCAGTGTTCCGCAAATGTCCAGTGCTTTGGTTTAATGAAATATAAATTAAATATATCGAGTTGATCAGGTTACATTCCTGTTGCTTTAATAAAGGCAAAATGCTTGGGTGATCATTAGAAATGGCAAATATTGACTTATGCATTATGGGAACATATCAGTCATGTTCATCAGACATTTTATTATTCATCAGTTACGCTTAAGCTGTTATTCTTATAGGAATAACAAGGAAATATAAAAGGAATAATAAGAGGGCCATAAAGAGAAACCAGACAAACCAGAAAGATGAAAATGTATATAGACTGTACTGCCGCTGCTCTGTTATTATCTCTTTATCTCTTAATAACACTTTGTATAGTCAGGGGCCTTTACATGTATAGGAATATGCAATTAAATGCTTTTTTATATAATTGCTTGGGCAGCTGAGAATGGATATTAAAGTG
                                                  Xt7.1-CHK-1008227905                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGACTTCAGTGGGGAATGTGATTATATCTTAGCCCAGGACTTTTGCCCTGGCAATGAAAATGCAGGGAGCTTCCGAATCATCACCGAAAATATTGTATGCGGAGAGGCTGAATCCATCTGTTCTCTTGGCATCAAGATCATCTTAAAGAATGCAACAATCGAACTCTTTGAAGGTCGGGCGGAAGAATCTAAAAGAGAATCTAACAATAGCAATTTCTATACGATAGATATAATTGGACTTTTCATTGTGTTGAAAACCACTGATGGTCTCACCTTCATGTGGGACCAGAAAACCACAGCTATTGTCCAACTTTCCCAGTCATTTCAGGGACGCGTTTGTGGACTCTGTGGGAACTTTGATGGCCTCTCAGTCAATGACTTTACTTCCTCGTGGCAGTCCTTGGAGGAGAATGAGAACGTGTTTGCAGACAGCTGGAAAGTGACGCCGAGTTGTAACAGCGGCTTACGGGAAAACACTTGTCTGACAAACCCCTTTAAGTTCCCCTGGGCTCAAAAACACTGCAGCTTAATTAAAAGTGAAGTCTTTGCTCCCTGTCATGCAAAGGTTGATCCGATCCCATATTATGATTCCTGTGTCACTGACTCTTGCAGTTGTAATAATGGAGGCGATTGTGAGTGCCTGTGCACCTCTATAGCAGCCTACGCTTCTGCCTGCAGGAGAAGCAACATCTGCATTGCATGGAGGACTCCAGACATTTGCCCTGTATTCTGTGATTACTATAACAAGGATGGAAGGTGTGAATGGCACTATCAGCCTTGTGGTGCTCCTTGCCTGGTAACTTGCAGAAATCCCATGGGAAAGTGTGATAATGATACCCAGCACCTTGAAGGATGCTACCCAACCTGTAGTAATACTCATCCTTATTTTGACGAAAACACCAAACACTGTGTCCCAGTTTTGAATTGTACAACTTGTGTTCCGGAAGAAAATCTTTGCAATGAAAGATCTGCAGAGTGCCTTTGCTGCCACGAGGGAAAGACATACCGCTTCTTACAGGAGATCTCTATAATCCTGGAGGGAAAAAGCTGTGTGATTGGATATTGTGGCGCTGATGGAGACATTATTTTGACATCCAACGTCTGTGGTGTCATTACCACAGTATCTACACCTGCACGTACAAGTATTCCAGGTCCTCCTTCTACAGGAAAGATACCAACCTCTCAAGTCTTGCTTACAAGCAAGGCAACTTCTACCACATCGGTTCCCATGAAAACCTCTACTGTGCATCCTGGGATTTCAAGAACCAGTGAGAGAACCACCCATATTACAACACCTTATCGGTATTCATTAACACAAAGCTTTGTGTCATTTACTAATTATTCCAGAATATTAATTACAACTAAGGGCGTTTCATCAGCAACTACCTCCTCATTGGAAAGAAAGAGTACATCCCCAAAAACACAAAAAACTTACAGCAGAACCAGTGTGCCTATCCATATACCTGTTACTACACAAAATATCACACCAACTGCCCCAGCAACAGAAAAGACATTTACCCTACTTACAACGGCTCCAGCAACAGAAAGGACATCTACCCTACTTACAACTGTCCCAGAACTAGGAAGCAAATCTACCCTACTTACAACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACGACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGCCCCAGCTTCAGGAAGTAAATCTACTCTACTTACAACTGCCCCAGCTTCAGGAAGCAAATCTACTCTACTTACAACAATTCCAAAAGTCTCTTCTAAAAGTGCCACTACGCATGCTATTTCATCCAATGCCACAACACCTTTGAAGACTACAGTAAAGGAACTGAGTGCAAAGACCAAGTTTCCATCTACAACAACTTTAGTCTCAAAAGAAAGAGAAAATGTTACACAACTATTTACAAGAAAAACATTAACAACTTCATCACCTCATGTTACAATACCAACAGCAGGTGACTGCCAAATGATGACATATAATGAATATATAGCAAAGGGTGAATGCATCACACAGCAGAAGGTATCGGTCAGTTATTGCGCTGGACATTGCCCCACATTTGCTAGATATTCCTATGAAGCTGAAATGATGACTCGACAGTGTTCCTGTTGCGCTGAGACACATAAAAGCACCCGGAACGTTCAGTTGCACTGCCCCAACGGAACTGTGTCCCCCTATACGTACATTCACGTGGAGCTGTGTTCCTGCATGCAAGTAAAATGTTTCCAGGAAACTGTCGGCAACCCTTAAGAACAATGAACTGAGCTTTTCTTATATGTTAAAAATCCTCATATTTTTATGATTTGAGTAGGTGAGATAAACATTGCTATTAGGTTTTTATTTAGAAAGAAAAATTCATATTTTATTCAATGATATCTACCTATATTTTTGCTGAGCAGTGTTCCGCAAATGTCCAGTGCTTTGGTTTAATGAAATATAAATTAAATATATCGAGTTGATCAGGTTACATTCCTGTTGCTTTAATAAAGGCAAAATGCTTGGGTGATCATTAGAAATGGCAAATATTGACTTATGCATTATGGGAACATATCAGTCATGTTCATCAGACATTTTATTATTCATCAGTTACGCTTAAGCTGTTATTCTTATAGGAATAACAAGGAAATATAAAAGGAATAATAAGAGGGCCATAAAGAGAAACCAGACAAACCAGAAAGATGAAAATGTATATAGACTGTACTGCCGCTGCTCTGTTATTATCTCTTTATCTCTTAATAACACTTTGTATAGTCAGGGGCCTTTACATGTATAGGAATATGCAATTAAATGCTTTTTTATATAATTGCTTGGGCAGCTGAGAATGGATATTAAAGTGTTTATA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     4     5     5     6     5     6     5     6     5     6     6     7     6     7     6     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     6     7     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     5     3     4     3     4     3     4     3     4     3     4     3     4     4     5     5     6     6     7     6     7     6     7     6     7     6     7     5     7     6     7     6     7     4     6     5     6     5     6     4     6     4     6     4     6     5     7     6     8     6     8     7     9     7     9     7    10     8    10     8    10     8    10     8    10     8     9     8    10     8    10     9    12    10    12    12    12    13    13    15    15    16    16    15    15    18    18    18    18    18    18    18    18    18    18    18    18    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    18    18    18    18    18    18    18    18    19    19    19    19    18    19    19    19    17    19    17    18    17    18    17    18    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    16    16    16    16    16    16    15    15    13    14    12    13    11    12    11    12    11    12    11    12    11    11    11    11    11    11    11    11    11    11     9    10     9    10     9    10
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -A-----A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------T----
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Sc ---- 3e-018     NP_012685.1 Delayed Anaerobic Gene; Dan4p [Saccharomyces cerevisiae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 2e-019     NP_001023035.2 C30H6.11 [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 2e-026     AAX12853.1 crossveinless-2 [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 1e-027     BAE93278.1 zinc finger protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 7e-049     NP_524060.2 CG7002-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 2e-053     XP_001182931.1 PREDICTED: similar to SCO-spondin [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 3e-073     CAA69604.1 integumentary mucin B.1 [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - ?? ---- 1e-075     XP_685769.1 PREDICTED: similar to Muc5b protein, partial [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 2e-089     XP_700948.1 PREDICTED: similar to mucin [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Hs ---- 6e-105     XP_001130382.1 PREDICTED: similar to Mucin-5AC (Mucin 5 subtype AC, tracheobronchial) (Tracheobronchial mucin) (TBM) (Major airway glycoprotein) [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 3e-110     NP_034974.1 mucin 5, subtypes A and C, tracheobronchial/gastric [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 2e-130     NP_989992.1 ovomucin alpha-subunit [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABI1491.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------ATG------------------------------------TAA------TGA---------------------------------------ATG---TGA---------------------------------------------------------------TGA------------------------------------ATG---------------TAATGA---------TAA------------------------------------TAATAA---------------------------------------TGA---ATG---------------------ATG---------------------------------------------------------------------TAA------TAATAA------------------------------------TGA---------TAG---------------------------------------TAATAA---------TAG---------------------------------TAAATG---------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   2       bld Ovi1      in                         CABI5450.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  NGAGGATTTTACCAAGCCAATGCCCCTGTGTATATGAAGGAAAATTTTATGAGACAGGAGTGAGCATTGATATACCCTGCAACACATGCACATGCAAGAACAGAACCTGGCATTGTACAGAAAACCTCTGCCCGCAAACTTGCACAGTATACGGGAATGGGCACTACTCCACCTTTGATGGATCCCGATTTGACTTCAGTGGGGAATGTGATTATATCTTAGCCCAGGACTTTTGCCCTGGCAATGAAAATGCAGGGAGCTTCCGAATCATCACCGAAAATATTGTATGCGGAGAGGCTGAATCCATCTGTTCTCTTGGCATCAAGATCATCTTAAAGAATGCAACAATCGAACTCTTTGAAGGTCGGGCGGAAGAATCTAAAAGAGAATCTAACAATAGCAATTTCTATACGATAGATATAATTGGACTTTTCATTGTGTTGAAAACCACTGATGGTCTCACCTTCATGTGGGACCAGAAAACCACAGCTATTGTCCAACTTTCCCAGTCATTTCAGGGACGCGTTTGTGGACTCTGTGGGAACTTTGATGGCCTCTCAGTCAATGACTTTACTTCCTCGTGGCAGTCCTTGGAGGAGAATGAGAACGTGTTTGCAGACAGCTGGAAAGTGACGCCGAGTTGTAACAGCGGCTTACGGGAAAACACTTGTCTGACAAACCCCTTTAAGTTCCCCTGGGCTCAAAAACACTGCAGCTTAATTAAAAGTGAAGTCTTTGCTCCCTGTCATGCAAAGGTTGATCCGATCCCATATTATGATTCCTGTGTCACTGACTCTTGCAGTTGTAATAATGGAGGCGATTGTGAGTGCCTGTGCACCTCTATAGCAGCCTACGCTTCTGCCTGCAGG
  5   1   2       bld Ovi1      in                         CABI4726.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGATTTGACTTCAGTGGGGAATGTGATTATATCTTAGCCCAGGACTTTTGCCCTGGCAATGAAAATGCAGGGAGCTTCCGAATCATCACCGAAAATATTGTATGCGGAGAGGCTGAATCCATCTGTTCTCTTGGCATCAAGATCATCTTAAAGAATGCAACAATCGAACTCTTTGAAGGTCGGGCGGAAGAATCTAAAAGAGAATCTAACAATAGCAATTTCTATACGATAGATATAATTGGACTTTTCATTGTGTTGAAAACCACTGATGGTCTCACCTTCATGTGGGACCAGAAAACCACAGCTATTGTCCAACTTTCCCAGTCATTTCAGGGACGCGTTTGTGGACTCTGTGGGAACTTTGATGGCCTCTCAGTCAATGACTTTACTTCCTCGTGGCAGTCCTTGGAGGAGAATGAGAACGTGTTTGCAGACAGCTGGAAAGTGACGCCGAGTTGTAACAGCGGCTTACGGGAAAACACTTGTCTGACAAACCCCTTTAAGTTCCCCTGGGCTCAAAAACACTGCAGCTTAATTAAAAGTGAAGTCTTTGCTCCCTGTCATGCAAAGGTTGATCCGATCCCATATTATGATTCCTGTGTCACTGACTCTTGCAGTTGTAATAATGGAGGCGATTGTGAGTGCCTGTGCACCTCTATAGCAGCCTACGCTTCTGCCTGCAGGAGAAGCAACATCTGCATTGCATGGAGGACTCCAGACATTTGCCGTAGGGTGACCCTACATTTTCTCTCCATAACAATTTTTATCTTAATTAATAGACATCATTAATGTACAAAAGGTAATGATGATTAATGATTCTATGTTATTATATTGCAGCT
  5   1   2       bld Ovi1                                CABI11752.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCATCTGTTCTCTTGGCATCAAGATCATCTTAAAGAATGCAACAATCGAACTCTTTGAAGGTCGGGCGGAAGAATCTAAAAGAGAATCTAACAATAGCAATTTCTATACGATAGATATAATTGGACTTTTCATTGTGTTGAAAACCACTGATGGTCTCACCTTCATGTGGGACCAGAAAACCACAGCTATTGTCCAACTTTCCCAGTCATTTCAGGGACGCGTTTGTGGACTCTGTGGGAACTTTGATGGCCTCTCAGTCAATGACTTTACTTCCTCGTGGCAGTCCTTGGAGGAGAATGAGAACGTGTTTGCAGACAGCTGGAAAGTGACGCCGAGTTGTAACAGCGGCTTACGGGAAAACACTTGTCTGACAAACCCCTTTAAGTTCCCCTGGGCTCAAAAACACTGCAGCTTAATTAAAAGTGAAGTCTTTGCTCCCTGTCATGCAAAGGTTGATCCGATCCCATATTATGATTCCTGTGTCACTGACTCTTGCAGTTGTAATAATGGAGGCGATTGTGAGTGCCTGTGCACCTCTATAGCAGCCTACGCTTCTGCCTGCAGGAGAAGCAACATCTGCATTGCATGGAGGACTCCAGACATTTGCCCTGTATTCTGTGATTACTATAACAAGGATGGAAGGTGTGAATGGCACTATCAGCCTTGTGGTGCTCCTTGCCTGGTAACTTGCAGAAATCCCATGNGAAAGTGTGATAATGATACCCAGCACCTTGAAGGATGCTACCCAACCTGTAGTAATACTCATCCTTATTTTGACGAANACACCAAACACTGTGTCCCAGTTTTTGATTGTACAACTTGTGTTCCGGA
  5   1   2       bld Ovi1      in                         CABI1491.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCGATTCGATTCGGCACGAGGCCCTTCTGTGGGACCAGAAAACCACAGCTATTGTCCAACTTTCCCAGTCATTTCAGGGACGCGTTTGTGGACTCTGTGGGAACTTTGATGGCCTCTCAGTCAATGACTTTACTTCCTCGTGGCAGTCCTTGGAGGAGAATGAGAACGTGTTTGCAGACAGCTGGAAAGTGACGCCGAGTTGTAACAGCGGCTTACGGGAAAACACTTGTCTGACAAACCCCTTTAAGTTCCCCTGGGCTCAAAAACACTGCAGCTTAATTAAAAGTGAAGTCTTTGCTCCCTGTCATGCAAAGGTTGATCCGATCCCATATTATGATTCCTGTGTCACTGACTCTTGCAGTTGTAATAATGGAGGCGATTGTGAGTGCCTGTGCACCTCTATAGCAGCCTACGCTTCTGCCTGCAGGAGAAGCAACATCTGCATTGCATGGAGGACTCCAGACATTTGCCCTGTATTCTGTGATTACTATAACAAGGATGGAAGGTGTGAATGGCACTATCAGCCTTGTGGTGCTCCTTGCCTGGTAACTTGCAGAAATCCCATGGGAAAGTGTGATAATGATACCCAGCACCTTGAAGGATGCTACCCAACCTGTAGTAATACTCATCCTTATTTTGACGAAAACACCAAACACTGTGTCCCAGTTTTGAATTGTACAACTTGTGTTCCGGAAGAAAATCTTTGCAATGAAAGATCTGCAGAGTGCCTTTGCTGCCACGAGGGAAAGACATACCGCTTCTTACAGGAGATCTCTATAATCCTGGAGGGAAAAGCTGTGTGATTGGATATTGTGGCGCTGAT
  5   1   2       bld Ovi1      in                         CABI9529.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAACTTTCCCAGTCATTTCAGGGACGCGTTTGTGGACTCTGTGGGAACTTTGATGGCCTCTCAGTCAATGACTTTACTTCCTCGTGGCAGTCCTTGGAGGAGAATGAGAACGTGTTTGCAGACAGCTGGAAAGTGACGCCGAGTTGTAACAGCGGCTTACGGGAAAACACTTGTCTGACAAACCCCTTTAAGTTCCCCTGGGCTCAAAAACACTGCAGCTTAATTAAAAGTGAAGTCTTTGCTCCCTGTCATGCAAAGGTTGATCCGATCCCATATTATGATTCCTGTGTCACTGACTCTTGCAGTTGTAATAATGGAGGCGATTGTGAGTGCCTGTGCACCTCTATAGCAGCCTACGCTTCTGCCTGCAGGAGAAGCAACATCTGCATTGCATGGAGGACTCCAGACATTTGCCCTGTATTCTGTGATTACTATAACAAGGATGGAAGGTGTGAATGGCACTATCAGCCTTGTGGTGCTCCTTGCCTGGTAACTTGCAGAAATCCCATGGGAAAGTGTGATAATGATACCCAGCACCTTGAAGGATGCTACCCAACCTGTAGTAATACTCATCCTTATTTTGACGAAAACACCAAACACTGTGTCCCAGTTTTGAATTGTACAACTTGTGTTCCGGAAGAAAATCTTTGCAATGAAAGATCTGCAGAGTGCCTTTGCTGCCACGAGGGAAAGACATACCGCTTCTTACAGGAGATCTCTATAATCCTGGAGGGAAAAAGCTGTGTGATTGGATATTGTGGCGCTGATGGAGACATTATTTTGACATCCAACGTCTGTGGTGTCATTACCACAGTATCTACACCTGCACGTACAAGTATTCCAGGGTCCTCCTTCTA
  5   1   2       bld Ovi1      in                         CABI8460.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTTTGATGGCCTCTCAGTCTTGACTTTACTTCCTCGTGGCAGTCCTTGGAGGAGAATGAGTACGTGTTTGCAGACAGCTGGAAAGTGACGCCGAGTTGTAACAGCGGCTTACGGGAAAACACTTGTCTGACAAACCCCTTTAAGTTCCCCTGGGCTCAAAAACACTGCAGCTTAATTAAAAGTGAAGTCTTTGCTCCCTGTCATGCAAAGGTTGATCCGATCCCATATTATGATTCCTGTGTCACTGACTCTTGCAGTTGTAATAATGGAGGCGATTGTGAGTGCCTGTGCACCTCTATAGCAGCCTACGCTTCTGCCTGCAGGAGAAGCAACATCTGCATTGCATGGAGGACTCCAGACATTTGCCCTGTATTCTGTGATTACTATAACAAGGATGGAAGGTGTGAATGGCACTATCAGCCTTGTGGTGCTCCTTGCCTGGTAACTTGCAGAAATCCCATGGGAAAGTGTGATAATGATACCCAGCACCTTGAAGGATGCTACCCAACCTGTAGTAATACTCATCCTTATTTTGACGAAAACACCAAACACTGTGTCCCAGTTTTGAATTGTACAACTTGTGTTCCGGAAGAAAATCTTTGCAATGAAAGATCTGCAGAGTGCCTTTGCTGCCACGAGGGAAAGACATACCGCTTCTTACAGGAGATCTCTATAATCCTGGAGGGAAAAAGCTGTGTGATTGGATATTGTGGCGCTGATGGAGACATTATTTTGACATCCAACGTCTGTGGTGTCATTACCACAGTATCTACACCTGCACGTACAAGTATTCCAGGTCCTCCTTCTACAGGAAAGATA
  5   1   2       bld Ovi1      in                         CABI6438.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTCTGTGATTACTATAACAAGGATGGAAGGTGTGAATGGCACTATCAGCCTTGTGGTGCTCCTTGCCTGGTAACTTGCAGAAATCCCATGGGAAAGTGTGATAATGATACCCAGCACCTTGAAGGATGCTACCCAACCTGTAGTAATACTCATCCTTATTTTGACGAAAACACCAAACACTGTGTCCCAGTTTTGAATTGTACAACTTGTGTTCCGGAAGAAAATCTTTGCAATGAAAGATCTGCAGAGTGCCTTTGCTGCCACGAGGGAAAGACATACCGCTTCTTACAGGAGATCTCTATAATCCTGGAGGGAAAAAGCTGTGTGATTGGATATTGTGGCGCTGATGGAGACATTATTTTGACATCCAACGTCTGTGGTGTCATTACCACAGTATCTACACCTGCACGTACAAGTATTCCAGGTCCTCCTTCTACAGGAAAGATACCAACCTCTCAAGTCTTGCTTACAAGCAAGGCAACTTCTACCACATCGGTTCCCATGAAAACCTCTACTGTGCATCCTGGGATTTCAAGAACCAGTGAGAGAACCACCCATATTACAACACCTTATCGGTATTCATTAACACAAAGCTTTGTGTCATTTACTAATTATTCCAGAATATTAATTACAACTAAGGGCGTTTCATCAGCAACTACCTCCTCATTGGAAAGAAAGAGTACATCCCCAAAAACACAAAAAACTTACAGCAGAACCAGTGTGCCTATCCATATACCTGTTACTACACAAAATATCACACCAACTGCCCCAGCAACAGAAAAGACATTTACCCTACTTACAACGGCTCCAGCAACAGAAAGGACATCTACCCTACTTACAACTGTCC
  5   1   2       bld Ovi1      in                        CABI11062.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTCCTTGCCTGGTAACTTGCAGAAATCCCATGGGAAAGTGTGATAATGATACCCAGCACCTTGAAGGATGCTACCCAACATGTAGTAATACTCATCCTTATTTTGACGAAAACACCAAACACTGTGTCCCAGTTTTGAATTGTACAACTTGTGTTCCGGAAGAAAATCTTTGCAATGAAAGATCTGCAGAGTGCCTTTGCTGCCACGAGGGAAAGACATACCGCTTCTTACAGGAGATCTCTGTAATCCTGGAGGGAAAAAGCTGTGTGATTGGATATTGTGGCGCTGATGGAGACATTATTTTGACATCCAACGTCTGTGGTGTCATTACCACAGTATCTACACCTGCACGTACAAGTATTCCAGGTCCTCCTTCTACAGGAAAGATACCAACCTCTCAAGTCTTGCTTACAAGCAAGGCAACTTCTACCACATCGGTTCCCATGAAAACCTCTACTGTGCATCCTGGGATTTCAAGAACCAGTGAGAGAACCACCCATATTACAACACCTTATCGGTATTCATTAACACAAAGCTTTGTGTCATTTACTAATTATTCCAGAATATTAATTACAACTAAGGGCGTTTCATCAGCAACTACCTCCTCATTGGAAAGAAAGAGTACATCCCCAAAAACACAAAAAACTTACAGCAGAACCAGTGTGCCTATCCATATACCTGTTACTACACAAAATATCACACCAACTGCCCCAGCAACAGAAAAGACATTTACCCTACTTACAACGGCTCCAGCAACAGAAAGGACATCTACCCTACTTACAACTGTCCCAGAACTAGGAAGCAAATCTACCCTACTTACAACTGTCCCAGGACT
  5   1   2       bld Ovi1      in                         CABI9885.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCATCGATTCGTTTGAATTGTACAACTTGTGTTCCGGAAGAAAATCTTTGCAATGAAAGATCTGCAGAGTGCCTTTGCTGCCACGAGGGAAAGACANTACCGCTTCTTACAGGAGATCTCTATAATCCTGGAGGGAAAAAGCTGTGTGATTGGATATTGTGGCGCTGATGGAGACATTATTTTGACATCCAACGTCTGTGGTGTCATTACCACAGTATCTACACCTGCACGTACAAGTATTCCAGGTCCTCCTTCTACAGGAAAGATACCAACCTCTCAAGTCTTGCTTACAAGCAAGGCAACTTCTACCACATCGGTTCCCATGAAAACCTCTACTGTGCATCCTGGGATTTCAAGAACCAGTGAGAGAACCACCCATATTACAACACCTTATCGGTATTCATTAACACAAAGCTTTGTGTCATTTACTAATTATTCCAGAATATTAATTACAACTAAGGGCGTTTCATCAGCAACTACCTCCTCATTGGAAAGAAAGAGTACATCCCCAAAAACACAAAAAACTTACAGCAGAACCAGTGTGCCTATCCATATACCTGTTACTACACAAAATATCACACCAACTGCCCCAGCAACAGAAAAGACATTTACCCTACTTACAACGGCTCCAGCAACAGAAAGGACATCTACCCTACTTACAACTGTCCCAGAACTAGGAAGCAAATCTACCCTACTTACAACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACGACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGCCCCAGCTTCAGGAAGTAAATCTACTCTACTTACAACTGCCCCAGCTT
  5   1   2       bld Ovi1      in                         CABI1874.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGATTCAATTCGGCACGAGGCTCAAGTCTTGCTTACAAGCAAGGCAACTTCTACCACATCGGTTCCCATGAAAACCTCTACTGTGCATCCTGGGATTTCAAGAACCAGTGAGAGAACCACCCATATTACAACACCTTATCGGTATTCATTAACACAAAGCTTTGTGTCATTTACTAATTATTCCAGAATATTAATTACAACTAAGGGCGTTTCATCAGCAACTACCTCCTCATTGGAAAGAAAGAGTACATCCCCAAAAACACAAAAAACTTACAGCAGAACCAGTGTGCCTATCCATATACCTGTTACTACACAAAATATCACACCAACTGCCCCAGCAACAGAAAAGACATTTACCCTACTTACAACGGCTCCAGCAACAGAAAGGACATCTACCCTACTTACAACTGTCCCAGAACTAGGAAGCAAATCTACCCTACTTACAACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACGACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACGACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGCCCCAGCTTCAGGAAGTAAATCTACTCTACTTACAACTGCCCCAGCTTCAGGAAGCAAATCTACTCTACTTACAACAAT
  5   1   2       bld Ovi1      in                         CABI6376.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTACACACCTTATCGGTATTCATTAACACAAAGCTTTGTGTCATTTACTAATTAGTTCCAGAATATTAATTACAACTAAGGGCGTTTCATCAGCAACTACCTCCTCATTGGAAAGAAAGAGTACATCCCCAAAAACACAAAAAACTTACAGCAGAACCAGTGTGCCTATCCATATACCTGTTACTACACAAAATATCACACCAACTGCCCCAGCAACAGAAAAGACATTTACCCTACTTACAACGGCTCCAGCAACAGAAAGGACATCTACCCTACTTACAACTGTCCCAGAACTAGGAAGCAAATCTACCCTACTTACAACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACGACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGCCCCAGCTTCAGGAAGTAAATCTACTCTACTTACAACTGCCCCAGCTTCAGGAAGCAAATCTACTCTACTTACAACAATTCCAAAAGTCTCTTCTAAAAGTGCCACTACGCATGCTATTTCATCCAATGCCACAACACCTTTGAAGACTACAGTAAAGGAACTGAGTGCAAAGACCAAGTTTCCATCTACAACAACTTTAGTCTCAAAAGAAAGAGAAAATGTTACACAACTATTTACAAGAAAAACATTAACAACTTCATCACCTCATGTTACAATACCAACAGCAGGTGACTGCCAAATGATGACATATAATGAATATATAGCAAAGGGTGAATGCATCACACAGC
  5   1   2       bld Ovi1                                CABI14555.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGAATTCAATATACAATATATTATCGACTGCTACAGAGCATCTCATTAACTATTCAGCCACCAGATGTCACTATACAGTATAATATTGACTGCTACAGAGCATTCCATTAACTATTCAGCCACCAGATGTCACTATACAAAagggatccccaacctttcttaatcgtgagccacagtcaaatgtaaaaagacttggggagccacacaagcatcataaaagttcatggaggtgccaaataagggctgttattggctattaggcagcctctatgCACACTATCAGCTTACAAGAAGTTCACCTTAGAATAAATAATGCTGTTTTTATTATAGAACCTAGGCTATGCATGGCATACCAACAGAACCTTCCCCTCAATCTGCTTAAAGTCAAATGCCTGCTATTTCAGCTAATAATCAGTTATTTACAAATGAATTAATCCATTTTCTTTCAAAGGTGACTGCCAAATGATGACATATAATGAATATATAGCAAAGGGTGAATGCATCACACAGCAGAAGGTATCGGTCAGTTATTGCGCTGGACATTGCCCCACATTTGCTAGATATTCCTATGAAGCTGAAATGATGACTCGACAGTGTTCCTGTTGCGCTGAGACACATAAAAGCACCCGGAACGTTCAGTTGCACTGCCCCAACGGAACTGTGTCCCCCTATACGTACATTCACGTGGAGCTGTGTTCCTGCATGCAAGTAAAATGTTTCCAGGAAACTGTCGGCAACCCTTAAGAACAATGAACTGAGCTTTTCTTATATGTTAAAAATCCTCATATTTTTATGATTTGAGTAGGTGAGATAAACATTGCTATTAG
  5   1   2       bld Ovi1      in                         CABI9056.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACGACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGCCCCAGCTTCAGGAAGTAAATCTACTCTACTTACAACTGCCCCAGCTTCAGGAAGCAAATCTACTCTACTTACAACAATTCCAAAAGTCTCTTCTAAAAGTGCCACTACGCATGCTATTTCATCCAATGCCACAACACCTTTGAAGACTACAGTAAAGGAACTGAGTGCAAAGACCAAGTTTCCATCTACAACAACTTTAGTCTCAAAAGAAAGAGAAAATGTTACACAACTATTTACAAGAAAAACATTAACAACTTCATCACCTCATGTTACAATACCAACAGCAGGTGACTGCCAAATGATGACATATAATGAATATATAGCAAAGGGTGAATGCATCACACAGCAGAAGGTATCGGTCAGTTATTGCGCTGGACATTGCCCCACATTTGCTAGATATTCCTATGAAGCTGAAATGATGACTCGACAGTGTTCCTGTTGCGCTGAGACACATAAAAGCACCCGGAACGTTCAGTTGCACTGCCCCAACGGAACTGTGTCCCCCTATACGTACATTCACGTGGAGCTGTGTTCCTGCATGCAAGTAAAATGTTTCCAGGAAACTGTCGGCAACCCTTAAGAACAATGAACTGAGCTTTTCTTATATGTTAAAAATCCTCATATTTTTATGATTTGAGTAGGTGAGATAAACATTGCTATTAGGTTTTTATTTAGAAAGAAAAATTCATATTTTATTCAATGATATCTACCTATATNTTTGCTGAGCAGTGTTCCGCAAATGTCCAGTGCTTTGGTTTAATGAATATAAATTAATATAT
  5   1   2       bld Ovi1      in                         CABI4287.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTAAGAAGCAAATCTACCCTACTTACAACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGCCCCAGCTTCAGGAAGTAAATCTACTCTACTTACAACTGCCCCAGCTTCAGGAAGCAAATCTACTCTACTTACAACAATTCCAAAAGTCTCTTCTAAAAGTGCCACTACGCATGCTATTTCAACCAATGCCACAACACCTTTGAAGACTACAGTAAAGGAACTGAGTGAAAAGACCAAGTTTCCATCTACAACAACATTAGTATCAAAAGAAAGAGAAAATGTTACACAACTATTTACAAGAAAAACATTAACAACTTCATCACCTCATGTTACAATACCAACAGCAGGTGACTGCCAAATGATGACATATAATGAATATATAGCAAAGGGTGAATGCATCACACAGCAGAAGGTATCGGTCAGTTATTGCGCTGGACATTGCCCCACATTTGCTAGATATTCCTATGAAGCTGAAATGATGACTCGACAGTGTTCCTGTTGCGCTGAGACACATAAAAGCACCCGTAACGTTCAGTTGCACTGCCCCAACGGAACTGTGTCCCCCTATACGTACATTCACGTGGAGCTGTGTTCCTGCATGCAAGTAAAATGTTTCCAGGAAACTGTCGGCAACCCTTAAGAACAATGAACTGAGCTTTTCTTATATGTTAAAAATCCTCATATTTTTATGATTTGAGTAGGTGAGATAAACATTGCTATTAGGTTTTTATTTAGAAAGAANAATTCATATTTTATTCAATGATATCTACCTATATNTTTGCTGAGCAGTGTTCCGCANATGTCCAGTGCTTTGGTTTAATGAATATAAATTAATATATCGAGTTGATCNAGGTACATTCCCTGTGC
  5   1   2       bld Ovi1      in                         CABI1392.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCGGCACGAGGCTACTTACAACTGTCCCAGGACTAAGAAGCAAATCTACCCTACTTACAACTGCCCCAGCTTCAGGAAGTAAATCTACTCTACTTACAACTGCCCCAGCTTCAGGAAGCAAATCTACTCTACTTACAACAATTCCAAAAGTCTCTTCTAAAAGTGCCACTACGCATGCTATTTCATCCAATGCCACAACACCTTTGAAGACTACAGTAAAGGAACTGAGTGCAAAGACCAAGTTTCCATCTACAACAACTTTAGTCTCAAAAGAAAGAGAAAATGTTACACAACTATTTACAAGAAAAACATTAACAACTTCATCACCTCATGTTACAATACCAACAGCAGGTGACTGCCAAATGATGACATATAATGAATATATAGCAAAGGGTGAATGCATCACACAGCAAAAGGTATCGGTCAGTTA
  3   1   2       bld Ovi1      in                         CABI6438.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATGCTATTTCATCCAATGCCACAACACCTTTGAAGACTACAGTAAAGGAACTGAGTGCAAAGACCAAGTTTCCATCTACAACAACTTTAGTCTCAAAAGAAAGAGAAAATGTTACACAACTATTTACAAGAAAAACATTAACAACTTCATCACCTCATGTTACAATACCAACAGCAGGTGACTGCCAAATGATGACATATAATGAATATATAGCAAAGGGTGAATGCATCACACAGCAGAAGGTATCGGTCAGTTATTGCGCTGGACATTGCCCCACATTTGCTAGATATTCCTATGAAGCTGAAATGATGACTCGACAGTGTTCCTGTTGCGCTGAGACACATAAAAGCACCCGGAACGTTCAGTTGCACTGCCCCAACGGAACTGTGTCCCCCTATACGTACATTCACGTGGAGCTGTGTTCCTGCATGCAAGTAAAATGTTTCCAGGAAACTGTCGGCAACCCTTAAGAACAATGAACTGAGCTTTTCTTATATGTTAAAAATCCTCATATTTTTATGATTTGAGTAGGTGAGATAAACATTGCTATTAGGTTTTTATTTAGAAAGAAAAATTCATATTTTATTCAATGATATCTACCTATATTTTTGCTGAGCAGTGTTCCGCAAATGTCCAGTGCTTTGGTTTAATGAAATATAAATTAAATATATCGAGTTGATCAGGTTACATTCCTGTTGCTTTAATAAAGGCAAAATGCTTGGGTGATCATTAGAAATGGCAAATATTGACTTATGCATTATGGGAACATATCAGTCATGTTCATCAGACATTTTATTATTCATCAGTTACGCTTAAGCTGTTATTCTTATAGGAATAACAAGG
  3   1   2       bld Ovi1      in                         CABI5450.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCAATGCCACAACACCTTTGAAGACTACAGTAAAGGAACTGAGTGCAAAGACCAAGTTTCCATCTACAACAACTTTAGTCTCAAAAGAAAGAGAAAATGTTACACAACTATTTACAAGAAAAACATTAACAACTTCATCACCTCATGTTACAATACCAACAGCAGGTGACTGCCAAATGATGACATATAATGAATATATAGCAAAGGGTGAATGCATCACACAGCAGAAGGTATCGGTCAGTTATTGCGCTGGACATTGCCCCACATTTGCTAGATATTCCTATGAAGCTGAAATGATGACTCGACAGTGTTCCTGTTGCGCTGAGACACATAAAAGCACCCGGAACGTTCAGTTGCACTGCCCCAACGGAACTGTGTCCCCCTATACGTACATTCACGTGGAGCTGTGTTCCTGCATGCAAGTAAAATGTTTCCAGGAAACTGTCGGCAACCCTTAAGAACAATGAACTGAGCTTTTCTTATATGTTAAAAATCCTCATATTTTTATGATTTGAGTAGGTGAGATAAACATTGCTATTAGGTTTTTATTTAGAAAGAAAAATTCATATTTTATTCAATGATATCTACCTATATTTTTGCTGAGCAGTGTTCCGCAAATGTCCAGTGCTTTGGTTTAATGAAATATAAATTAAATATATCGAGTTGATCAGGTTACATTCCTGTTGCTTTAATAAAGGCAAAATGCTTGGGTGATCATTAGAAATGGCAAATATTGACTTATGCATTATGGGAACATATCAGTCATGTTCATCAGACATTTTATTATTCATCAGTTACGCTTAAGCTGTTATTCTTATAGGAATAACAAGGAAATATAAAAGGAATAATAAGAGGGCCATAAAGAGAAACCAGACAAACCAAAAAAAAAA
  3   1   2       bld Ovi1      in                         CABI1874.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTACAGTAAAGGAACTGAGTGAAAAGACCAAGTTTCCATCTACAACAACATTAGTATCAAAAGAAAGAGAAAATGTTACACAACTATTTACAAGAAAAACATTAACAACTTCATCACCTCATGTTACAATACCAACAGCAGGTGACTGCCAAATGATGACATATAATGAATATATAGCAAAGGGTGAATGCATCACACAGCAGAAGGTATCGGTCAGTTATTGCGCTGGACATTGCCCCACATTTGCTAGATATTCCTATGAAGCTGAAATGATGACTCGACAGTGTTCCTGTTGCGCTGAGACACATAAAAGCACCCGTAACGTTCAGTTGCACTGCCCCAACGGAACTGTGTCCCCCTATACGTACATTCACGTGGAGCTGTGTTCCTGCATGCAAGTAAAATGTTTCCAGGAAACTGTCGGCAACCCTTAAGAACAATGAACTGAGCTTTTCTTATATGTTAAAAATCCTCATATTTTTATGATTTGAGTAGGTGAGATAAACATTGCTATTAGGTTTTTATTTAGAAAGAAAAATTCATATTTTATTCAATGATATCTACCTATATTTTTGCTGAGCAGTGTTCCGCAAATGTCCAGTGCTTTGGTTTAATGAAATATAAATTAAATATATCGAGTTGATCAGGTTACATTCCTGTTGCTTTAATAAAGGCAAAATGCTTGGGTGATCATTAGAAATGGCAAATATTGACTTATGCATTATGGGAACATATCAGTCATGTTCATCAGACATTTTATTATTCATCAGTTACGCTTAAGCTGTTATTCTTATAGGAATAACAAGGAAATATAAAAGGAATAATAAGAGGGCCATAAAGAGAAACCAGAC
  5   1   2       bld Ovi1                                CABI12391.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATCCATCGATTCGAGTTTCCATCTACAACAACATTAGTATCAAAAGAAAGAGAAAATGTTACACAACTATTTACAAGAAAAACATTAACAACTTCATCACCTCATGTTACAATACCAACAGCAGGTGACTGCCAAATGATGACATATAATGAATATATAGCAAAGGGTGAATGCATCACACAGCAGAAGGTATCGGTCAGTTATTGCGCTGGACATTGCCCCACATTTGCTAGATATTCCTATGAAGCTGAAATGATGACTCGACAGTGTTCCTGTTGCGCTGAGACACATAAAAGCACCCGTAACGTTCAGTTGCACTGCCCCAACGGAACTGTGTCCCCCTATACGTACATTCACGTGGAGCTGTGTTCCTGCATGCAAGTAAAATGTTTCCAGGAAACTGTCGGCAACCCTTAAGAACAATGAACTGAGCTTTTCTTATATGTTAAAAATCCTCATATTTTTATGATTTGAGTAGGTGAGATAAACATTGCTATTAGGTTTTTATTTAGAAAGAAAAATTCATATTTTATTCAATGATATCTACCTATATTTTTGCTGAGCAGTGTTCCGCAAATGTCCAGTGCTTTGGTTTAATGAAATATAAATTAAATATATCGAGTTGATCAGGTTACATTCCTGTTGCTTTAATAAAGGCAAAATGCTTGGGTGATCATTAGAAATGGCAAATATTGACTTATGCATTATGGGAACATATCAGTCATGTTCATCAGACATTTTATTATTCATCAGTTACGCTTAAGCTGTTATTCTTATAGGAATAACAAGGAAATATAAAAGGAATAATAAGAGGGCCATAAAGAGAAACCAGACAAACCAGAAAGATGAAAATGTATATAGACTGTACT
  3   1   2       bld Ovi1      in                         CABI1491.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAAAACATTAACAACTTCATCACCTCATGTACAATACCAACAGCAGGTGACTGCCAAATGATGACATATAATGAATATATAGCAAAGGGTGAATGCATCACACAGCAGAAGGTATCGGTCAGTTATTGCGCTGGACATTGCCCCACATNTGCTAGATATTCCTATGAAGCTGAAATGATGACTCGACAGTGTTCCTGTTGCGCTGAGACACATAAAAGCACCCGGAACGTTCAGTTGCACTGCCCCAACGGAACTGTGTCCCCCTATACGTACATTCACGTGGAGCTGTGTTCCTGCATGCAAGTAAAATGTTTCCAGGAAACTGTCGGCAACCCTTAAGAACAATGAACTGAGCTTTTCTTATATGTTAAAAATCCTCATATTTTTATGATTTGAGTAGGTGAGATAAACATTGCTATTAGGTTTTTATTTAGAAAGAAAAATTCATATTTTATTCAATGATATCTACCTATATTTTTGCTGAGCAGTGTTCCGCAAATGTCCAGTGCTTTGGTTTAATGAAATATAAATTAAATATATCGAGTTGATCAGGTTACATTCCTGTTGCTTTAATAAAGGCAAAATGCTTGGGTGATCATTAGAAATGGCAAATATTGACTTATGCATTATGGGAACATATCAGTCATGTTCATCAGACATTTTATTATTCATCAGTTACGCTTAAGCTGTTATTCTTATAGGAATAACAAGGAAATATAAAAGGAATAATAAGAGGGCCATAAAGAGAAACCAGACAAACCAGAAAGATGAAAATGTATATAGACTGTACTGCCGCTGCTCTGTTATTATCTCTTTATCTCTTAATAACACTTTGTATAGTCAGGGGCCTTTACATGTATAGGAATATGCAATTAAATGCTTTTTTATATAATTGCTTGGGCAGCTGAGAATGGATATTAAAGTGTTTATAATGCAAAAAAAAAAGCCTCTCGCCCTATAGG
  3   1   2       bld Ovi1      in                         CABI4287.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCATGTACAATACCACAGCAGGGTGACTGCCAAATGATGACATATAATGAATATATAGCAAAGGGTGAATGCATCACACAGCAGAAGGTATCGGTCAGTTATGNCGCTGGACATTGCCCCACATNTGCTAGATATTCCTATGAAGCTGAAATGATGACTCGACAGTGTTCCTGTTGCGCTGAGACACATAAAAGCACCCGTAACGTTCAGTTGCACTGCCCCAACGGAACTGTGTCCCCCTATACGTACATTCACGTGGAGCTGTGTTCCTGCATGCAAGTAAAATGTTTCCAGGAAACTGTCGGCAACCCTTAAGAACAATGAACTGAGCTTTTCTTATATGTTAAAAATCCTCATATTTTTATGATTTGAGTAGGTGAGATAAACATTGCTATTAGGTTTTTATTTAGAAAGAAAAATTCATATTTTATTCAATGATATCTACCTATATTTTTGCTGAGCAGTGTTCCGCAAATGTCCAGTGCTTTGGTTTAATGAAATATAAATTAAATATATCGAGTTGATCAGGTTACATTCCTGTTGCTTTAATAAAGGCAAAATGCTTGGGTGATCATTAGAAATGGCAAATATTGACTTATGCATTATGGGAACATATCAGTCATGTTCATCAGACATTTTATTATTCATCAGTTACGCTTAAGCTGTTATTCTTATAGGAATAACAAGGAAATATAAAAGGAATAATAAGAGGGCCATAAAGAGAAACCAGACAAACCAGAAAGATGAAAATGTATATAGACTGTACTGCCGCTGCTCTGTTATTATCTCTTTATCTCTTAATAACACTTTGTATAGTCAGGGGCCTTTACATGTATAGGAATATGCAATTAAATGCTTTTTTATATAATTGCTTGGGCAGCTGAGAATGGATATTAAAGTGTTTATAATTGCAAAAAAA
  3  -1   2       bld Ovi1                                 CABI3994.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGTTACAATACCAACAGCAGGTGACTGCCAAATGATGACATATAATGAATATATAGCAAAGGGTGAATGCATCACACAGCAGAAGGTATCGGTCAGTTATTGCGCTGGACATTGCCCCACATTTGCTAGATATTCCTATGAAGCTGAAATGATGACTCGACAGTGTTCCTGTTGCGCTGAGACACATAAAAGCACCCGGAACGTTCAGTTGCACTGCCCCAACGGAACTGTGTCCCCCTATACGTACATTCACGTGGAGCTGTGTTCCTGCATGCAAGTAAAATGTTTCCAGGAAACTGTCGGCAACCCTTAAGAACAATGAACTGAGCTTTTCTTATATGTTAAAAATCCTCATATTTTTATGATTTGAGTAGGTGAGATAAACATTGCTATTAGGTTTTTATTTAGAAAGAAAAATTCATATTTTATTCAATGATATCTACCTATATTTTTGCTGAGCAGTGTTCCGCAAATGTCCAGTGCTTTGGTTTAATGAAATATAAATTAAATATATCGAGTTGATCAGGTTACATTCCTGTTGCTTTAATAAAGGCAAAATGCTTGGGTGATCATTAGAAATGGCAAATATTGACTTATGCATTATGGGAACATATCAGTCATGTTCATCAGACATTTTATTATTCATCAGTTACGCTTAAGCTGTTATTCTTATAGGAATAACAAGGAAATATAAAAGGAATAATAAGAGGGCCATAAAGAGAAACCAGACAAAACCAGAAAGATGAAAATGTATATAGACTGTACTGCCGCTGCTCTGTTAATATCCCTTTATCTCTTAAATACACTT
  3   1   2      seed Ovi1      in                         CABI8460.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCAAATGATGACATATAATGAATATATAGCAAAGGGTGAATGCATCACACAGCAGAAGGTATCGGTCAGTTATTGCGCTGGACATTGCCCCACATTTGCTAGATATTCCTATGAAGCTGAAATGATGACTCGACAGTGTTCCTGTTGCGCTGAGACACATAAAAGCACCCGGAACGTTCAGTTGCACTGCCCCAACGGAACTGTGTCCCCCTATACGTACATTCACGTGGAGCTGTGTTCCTGCATGCAAGTAAAATGTTTCCAGGAAACTGTCGGCAACCCTTAAGAACAATGAACTGAGCTTTTCTTATATGTTAAAAATCCTCATATTTTTATGATTTGAGTAGGTGAGATAAACATTGCTATTAGGTTTTTATTTAGAAAGAAAAATTCATATTTTATTCAATGATATCTACCTATATTTTTGCTGAGCAGTGTTCCGCAAATGTCCAGTGCTTTGGTTTAATGAAATATAAATTAAATATATCGAGTTGATCAGGTTACATTCCTGTTGCTTTAATAAAGGCAAAATGCTTGGGTGATCATTAGAAATGGCAAATATTGACTTATGCATTATGGGAACATATCAGTCATGTTCATCAGACATTTTATTATTCATCAGTTACGCTTAAGCTGTTATTCTTATAGGAATAACAAGGAAATATAAAAGGAATAATAAGAGGGCCATAAAGAGAAACCAGACAAACCAGAAAGATGAAAATGTATATAGACTGTACTGCCGCTGCTCTGTTATTATCTCTTTATCTCTTAATAACACTTTGTATAGTCAGGGGCCTTTACATGTATAGGAATATGCAATTAAATGCTTTTTTATATAATTGCTTGGGCAGCTGAGAATGGATATTAAAGTGTTTATAATTGC
  3   1   2       bld Ovi1      in                         CABI4726.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACATATAATGAATATATAGCAAAGGGTGAATGCATCACACAGCAGAAGGTATCGGTCAGTTATTGCGCTGGACATTGCCCCACATTTGCTAGATATTCCTATGAAGCTGAAATGATGACTCGACAGTGTTCCTGTTGCGCTGAGACACATAAAAGCACCCGGAACGTTCAGTTGCACTGCCCCAACGGAACTGTGTCCCCCTATACGTACATTCACGTGGAGCTGTGTTCCTGCATGCAAGTAAAATGTTTCCAGGAAACTGTCGGCAACCCTTAAGAACAATGAACTGAGCTTTTCTTATATGTTAAAAATCCTCATATTTTTATGATTTGAGTAGGTGAGATAAACATTGCTATTAGGTTTTTATTTAGAAAGAAAAATTCATATTTTATTCAATGATATCTACCTATATTTTTGCTGAGCAGTGTTCCGCAAATGTCCAGTGCTTTGGTTTAATGAAATATAAATTAAATATATCGAGTTGATCAGGTTACATTCCTGTTGCTTTAATAAAGGCAAAATGCTTGGGTGATCATTAGAAATGGCAAATATTGACTTATGCATTATGGGAACATATCAGTCATGTTCATCAGACATTTTATTATTCATCAGTTACGCTTAAGCTGTTATTCTTATAGGAATAACAAGGAAATATAAAAGGAATAATAAGAGGGCCATAAAGAGAAACCAGACAAACCAGAAAGATGAAAATGTATATAGACTGTACTGCCGCTGCTCTGTTATTATCTCTTTATCTCTTAATAACACTTTGTATAGTCAGGGGCCTTTACATGTATAGGAATATGCAATTAAATGCTTTTTTATAT
  3   1   2       bld Ovi1      in                         CABI9056.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAATATATAGCAAAGGGTGAATGCATCACACAGCAGAAGGTATCGGTCAGTTATTGCGCTGGACATTGCCCCACATTTGCTAGATATTCCTATGAAGCTGAAATGATGACTCGACAGTGTTCCTGTTGCGCTGAGACACATAAAAGCACCCGGAACGTTCAGTTGCACTGCCCCAACGGAACTGTGTCCCCCTATACGTACATTCACGTGGAGCTGTGTTCCTGCATGCAAGTAAAATGTTTCCAGGAAACTGTCGGCAACCCTTAAGAACAATGAACTGAGCTTTTCTTATATGTTAAAAATCCTCATATTTTTATGATTTGAGTAGGTGAGATAAACATTGCTATTAGGTTTTTATTTAGAAAGAAAAATTCATATTTTATTCAATGATATCTACCTATATTTTTGCTGAGCAGTGTTCCGCAAATGTCCAGTGCTTTGGTTTAATGAAATATAAATTAAATATATCGAGTTGATCAGGTTACATTCCTGTTGCTTTAATAAAGGCAAAATGCTTGGGTGATCATTAGAAATGGCAAATATTGACTTATGCATTATGGGAACATATCAGTCATGTTCATCAGACATTTTATTATTCATCAGTTACGCTTAAGCTGTTATTCTTATAGGAATAACAAGGAAATATAAAAGGAATAATAAGAGGGCCATAAAGAGAAACCAGACAAACCAGAAAGATGAAAATGTATATAGACTGTACTGCCGCTGCTCTGTTATTATCTCTTTATCTCTTAATAACACTTTGTATAGTCAGGGGCCTTTACATGTATAGGAATATGCAATTAAATGCTTTTTTATATAATTGCTTGGGCAGCTGAGAATGGATATTAAAGTGTTTATAATGCANAAAAAAGCC
  3   1   2       bld Ovi1      in                         CABI9885.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATAGCAAAGGGTGAATGCATCACACAGCAGAAGGTATCGGTCAGTTATTGCGCTGGACATTGCCCCACATTTGCTAGATATTCCTATGAAGCTGAAATGATGACTCGACAGTGTTCCTGTTGCGCTGAGACACATAAAAGCACCCGGAACGTTCAGTTGCACTGCCCCAACGGAACTGTGTCCCCCTATACGTACATTCACGTGGAGCTGTGTTCCTGCATGCAAGTAAAATGTTTCCAGGAAACTGTCGGCAACCCTTAAGAACAATGAACTGAGCTTTTCTTATATGTTAAAAATCCTCATATTTTTATGATTTGAGTAGGTGAGATAAACATTGCTATTAGGTTTTTATTTAGAAAGAAAAATTCATATTTTATTCAATGATATCTACCTATATTTTTGCTGAGCAGTGTTCCGCAAATGTCCAGTGCTTTGGTTTAATGAAATATAAATTAAATATATCGAGTTGATCAGGTTACATTCCTGTTGCTTTAATAAAGGCAAAATGCTTGGGTGATCATTAGAAATGGCAAATATTGACTTATGCATTATGGGAACATATCAGTCATGTTCATCAGACATTTTATTATTCATCAGTTACGCTTAAGCTGTTATTCTTATAGGAATAACAAGGAAATATAAAAGGAATAATAAGAGGGCCATAAAGAGAAACCAGACAAACCAGAAAGATGAAAATGTATATAGACTGTACTGCCGCTGCTCTGTTATTATCTCTTTATCTCTTAATAACACTTTGTATAGTCAGGGGCCTTTACATGTATAGGAATATGCAATTAAATGCTTTTTTATATAATTGCTTGGGCAGCTGAGAATGGATATTAAAGTGTTTATAATTGC
  3   1   2       bld Ovi1      out                        CABI7914.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACAGCAGAAGGTATCGGTCAGTTATTGCGCTGGACATTGCCCCACATTTGCTAGATATTCCTATGAAGCTGAAATGATGACTCGACAGTGTTCCTGTTGCGCTGAGACACATAAAAGCACCCGGAACGTTCAGTTGCACTGCCCCAACGGAACTGTGTCCCCCTATACGTACATTCACGTGGAGCTGTGTTCCTGCATGCAAGTAAAATGTTTCCAGGAAACTGTCGGCAACCCTTAAGAACAATGAACTGAGCTTTTCTTATATGTTAAAAATCCTCATATTTTTATGATTTGAGTAGGTGAGATAAACATTGCTATTAGGTTTTTATTTAGAAAGAAAAATTCATATTTTATTCAATGATATCTACCTATATTTTTGCTGAGCAGTGTTCCGCAAATGTCCAGTGCTTTGGTTTAATGAAATATAAATTAAATATATCGAGTTGATCAGGTTACATTCCTGTTGCTTTAATAAAGGCAAAATGCTTGGGTGATCATTAGAAATGGCAAATATTGACTTATGCATTATGGGAACATATCAGTCATGTTCATCAGACATTTTATTATTCATCAGTTACGCTTAAGCTGTTATTCTTATAGGAATAACAAGGAAATATAAAAGGAATAATAAGAGGGCCATAAAGAGAAACCAGACAAACCAGAAAGATGAAAATGTATATAGACTGTACTGCCGCTGCTCTGTTATTATCTCTTTATCTCTTAATAACACTTTGTATAGTCAGGGGCCTTTACATGTATAGGAATATGCAATTAAATGCTTTTTTATATAATTGCTTGGGCAGCTGAGAATGGATATTAAAGTGTTTATAATTG
  3   1   2       bld Ovi1      in                        CABI11062.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCAGAAGGTATCGGTCAGTTATTGCGCTGGACATTGCCCCACATTTGCTAGATATTCCTATGAAGCTGAAATGATGACTCGACAGTGTTCCTGTTGCGCTGAGACACATAAAAGCACCCGTAACGTTCAGTTGCACTGCCCCAACGGAACTGTGTCCCCCTATACGTACATTCACGTGGAGCTGTGTTCCTGCATGCAAGTAAAATGTTTCCAGGAAACTGTCGGCAACCCTTAAGAACAATGAACTGAGCTTTTCTTATATGTTAAAAATCCTCATATTTTTATGATTTGAGTAGGTGAGATAAACATTGCTATTAGGTTTTTATTTAGAAAGAAAAATTCATATTTTATTCAATGATATCTACCTATATTTTTGCTGAGCAGTGTTCCGCAAATGTCCAGTGCTTTGGTTTAATGAAATATAAATTAAATATATCGAGTTGATCAGGTTACATTCCTGTTGCTTTAATAAAGGCAAAATGCTTGGGTGATCATTAGAAATGGCAAATATTGACTTATGCATTATGGGAACATATCAGTCATGTTCATCAGACATTTTATTATTCATCAGTTACGCTTAAGCTGTTATTCTTATAGGAATAACAAGGAAATATAAAAGGAATAATAAGAGGGCCATAAAGAGAAACCAGACAAACCAGAAAGATGAAAATGTATATAGACTGTACTGCCGCTGCTCTGTTATTATCTCTTTATCTCTTAATAACACTTTGTATAGTCAGGGGCCTTTACATGTATAGGAATATGCAATTAAATGCTTTTTTTATATAATTGCTTGGGCAGCTGAGAATGGATATTAAAGTGTTTATAATTGC
  3   1   2       bld Ovi1      in                         CABI6376.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCAGAAGGTATCGGTCAGTTATTGCGCTGGACATTGCCCCACATTTGCTAGATATTCCTATGAAGCTGAAATGATGACTCGACAGTGTTCCTGTTGCGCTGAGACACATAAAAGCACCCGGAACGTTCAGTTGCACTGCCCCAACGGAACTGTGTCCCCCTATACGTACATTCACGTGGAGCTGTGTTCCTGCATGCAAGTAAAATGTTTCCAGGAAACTGTCGGCAACCCTTAAGAACAATGAACTGAGCTTTTCTTATATGTTAAAAATCCTCATATTTTTATGATTTGAGTAGGTGAGATAAACATTGCTATTAGGTTTTTATTTAGAAAGAAAAATTCATATTTTATTCAATGATATCTACCTATATTTTTGCTGAGCAGTGTTCCGCAAATGTCCAGTGCTTTGGTTTAATGAAATATAAATTAAATATATCGAGTTGATCAGGTTACATTCCTGTTGCTTTAATAAAGGCAAAATGCTTGGGTGATCATTAGAAATGGCAAATATTGACTTATGCATTATGGGAACATATCAGTCATGTTCATCAGACATTTTATTATTCATCAGTTACGCTTAAGCTGTTATTCTTATAGGAATAACAAGGAAATATAAAAGGAATAATAAGAGGGCCATAAAGAGAAACCAGACAAACCAGAAAGATGAAAATGTATATAGACTGTACTGCCGCTGCTCTGTTATTATCTCTTTATCTCTTAATAACACTTTGTATAGTCAGGGGCCTTTACATGTATAGGAATATGCAATTAAATGCTTTTTTATATAATTGCTTGGGCAGCTGAGAATGGATATTAAAGTGTTTATAATGNC
  3   1   2       bld Ovi1      in                         CABI9529.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGGTCAGTTATTGCGCTGGACATTGCCCCACATTTGCTAGATATTCCTATGAAGCTGAAATGATGACTCGACAGTGTTCCTGTTGCGCTGAGACACATAAAAGCACCCGGAACGTTCAGTTGCACTGCCCCAACGGAACTGTGTCCCCCTATACGTACATTCACGTGGAGCTGTGTTCCTGCATGCAAGTAAAATGTTTCCAGGAAACTGTCGGCAACCCTTAAGAACAATGAACTGAGCTTTTCTTATATGTTAAAAATCCTCATATTTTTATGATTTGAGTAGGTGAGATAAACATTGCTATTAGGTTTTTATTTAGAAAGAAAAATTCATATTTTATTCAATGATATCTACCTATATTTTTGCTGAGCAGTGTTCCGCAAATGTCCAGTGCTTTGGTTTAATGAAATATAAATTAAATATATCGAGTTGATCAGGTTACATTCCTGTTGCTTTAATAAAGGCAAAATGCTTGGGTGATCATTAGAAATGGCAAATATTGACTTATGCATTATGGGAACATATCAGTCATGTTCATCAGACATTTTATTATTCATCAGTTACGCTTAAGCTGTTATTCTTATAGGAATAACAAGGAAATATAAAAGGAATAATAAGAGGGCCATAAAGAGAAACCAGACAAACCAGAAAGATGAAAATGTATATAGACTGTACTGCCGCTGCTCTGTTATTATCTCTTTATCTCTTAATAACACTTTGTATAGTCAGGGGCCTTTACATGTATAGGAATATGCAATTAAATGCTTTTTTATATAATTGCTTGGGCAGCTGAGAATGGATATTAAAGTGTTTATAATTGC
  3   1   2       bld Ovi1      in                         CABI1392.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATGATGACTCGACAGTGTTCCTGTTGCGCTGAGACACATAAAAGCACCCGGAACGTTCAGTTGCACTGCCCCAACGGAACTGTGTCCCCCTATACGTACATTCACGTGGAGCTGTGTTCCTGCATGCAAGTAAAATGTTTCCAGGAAACTGTCGGCAACCCTTAAGAACAATGAACTGAGCTTTTCTTATATGTTAAAAATCCTCATATTTTTATGATTTGAGTAGGTGAGATAAACATTGCTATTAGGTTTTTATTTAGAAAGAAAAATTCATATTTTATTCAATGATATCTACCTATATTTTTGCTGAGCAGTGTTCCGCAAATGTCCAGTGCTTTGGTTTAATGAAATATAAATTAAATATATCGAGTTGATCAGGTTACATTCCTGTTGCTTTAATAAAGGCAAAATGCTTGGGTGATCATTAGAAATGGCAAATATTGACTTATGCATTATGGGAACATATCAGTCATGTTCATCAGACATTTTATTATTCATCAGTTACGCTTAAGCTGTTATTCTTATAGGAATAACAAGGAAATATACAAGGAATAATAAGAGGGCCATAAAGAGAAACCAGACAAACCAG
  3   1   2       bld Ovi1      out                        CABI1407.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGATATCTACCTATATTTTTGCTGAGCAGTGTTCGCAAAATGTCCAGTGCTTTGGTTTAATGAAATATAAATTAAATATATCGAGTTGATCAGGTTACATTCCTGTTGCTTTAATAAAGGCAAAATGCTTGGGTGATCATTAGAAATGGCAAATATTGACTTATGCATTATGGGAACATATCAGTCATGTTCATCAGACATTTTATTATTCATCAGTTACGCTTAAGCTGTTATTCTTATAGGAATAACAAGGAAATATAAAAGGAATAATAAGAGGGCCATAAAGAGAAACCAGACAAACCAGAAAGATGAAAATGTATATAGACTGTACTGCCGCTGCTCTGTTATTATCTCTTTATCTCTTAATAACACTTTGTATAGTCAGGGGCCTTTACATGTATAGGAATATGCAATTAAATGCTTTTTTATATAATTGCTTGGGCAGCTGAGAATGGATATTAAAGTGTTTATAATTGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)