Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 99%

 1012075498 Xt7.1-CABE11323.3 - 41 ESTs
                                                                       ..-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABE11323.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAGCGGCGGGCAGAGTGAAAAGCCTGGACTTTGTTGTTATTGTTGTCCCTGCACCGCTTCTCCCTGACCGGGGAACAAGCGCAGCAAGCGACAAGTCTGCGCGGTCAGAATGTATGTGCAAAATGCAACAGATCAACTGCAGCTTAGCTGACACCTGAATCTGAAAACTGAAAATGGATAAATGTAAACATGTTGGCCGATTGCGTCTCGCCCAAGATCATTCAATTTTGAACCCTCAAAAGTGGCACTGTGTGGATTGCAACACTACCGAATCCGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCGTGTGGTCGATACATTGAAGAGCATGCACTGCGACACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTACGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACGTTAAGTGCTATCAAAAGTCAGAACTATGACTGTACAACACGTAGTGGTCGGACTTTGCGGTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAAAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCATGGTTTGCTTTGACTCCAAAAGGCAAGCAAAGGCTAGAAGAGGAACGCTTGAGGGAGGTGGCAGAACAGAAGCGAGAGGAAGCAAGGAAAAGGCGACAGCAGTTGAAGCGCAAATTAAAGGAAGAAATGGAAAGCACTCCCCCTAGAAAAAGTTCACGTTTGAAACAGCAAATGCAACCTTCCCCCAAAACTGAATTGCCCTCTGTGCAAAAAATGAACCAAAAATACACTCCTACCACAAAACAAAAACCACCAGCACCTACCTCTATTGAAGTATGCTTAAAAAAAATTGGTAATTCTCCAATAAAAAGAAAGCCCACTGTGACCCCTGGAGTAACAGGACTGAGGAATCTGGGGAACACCTGCTACATGAACTCAATACTTCAGATACTGAGTCATTTGCATGTTTTCCGGGAGTGTTTTTTGCAACTTGATCTCAATCAAACTCAGGAGTTGTTGGCAGCTGCTGGCAGTGGGAAAACAAGGTTGTCCAGCAAATACCCACCTAGCGCTGTCCTACCAAAAGTAACACAAAAGCACACTAAAGTTCAAAGATCACTGGCAAGGCGTCAGAGCTTCTCCTCGGGACTTAGTGGTGGGGCCTCAAATAGTAGAAACATGGAACTAATTCAGCCTAAGGAGCCAAGTTCAAAGCACATATCCCTATGTCATGAATTGCATACCCTCTTCCAAGTCATGTGGTCAGGTAAATGGGCACTGGTTTCTCCCTTTGCAATGCTACATTCAGTCTGGAGGCTTATACCAGCCTTCCGTGGGTACGCACAACAAGATGCTCAGGAATTCCTCTGTGAACTATTGGATAAAGTACAACAAGAATTGGAGACAACTGGCACCAGATACCCAACCCTAATTCCTGCTTCTCAAAGGAAACTCATCAAACAGGTCCTGAATATCGTCAACAACATTTTTCACGGGCAACTACTTAGTCAGGTTACTTGTCTGGCCTGTGATCACAAATCAAATACCATTGAGCCATTTTGGGACTTGTCTCTTGAGTTTCCCGAGAGGTACCACTTCAATGGCAAAGAGACAGCTTCTCAGCGGCCTTGTCTGTTGACAGAAATGCTGGCCAAATTCACAGAGACTGAAGCCTTAGAAGGGAAGATCTATGCTTGTGACCAGTGCAACACAAAGCGTAGGAAGTTCTCATCCAAACCAGTTGTCCTTACAGAAGCACAGAAGCAGCTGATGGTGTGTCGGTTACCTCAGGTCCTGAGACTGCACCTCAAGAGATTCCGGTGGTCTGGCCGAAACCATCGTGAGAAAATTGGAGTGCATGTTCGCTTTGACCAGATGCTGAACATGGAGCCTTATTGTTGTAGAGAGTCCACTGCAGCCCTGAGAGCTGACTGCTTTATTTATGATCTGTCGTCTGTCGTGATGCATCATGGGAAAGGTTTTGGTTCTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGCTTCTGGGTCCACTGCAATGACTCCAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGCTTCTAGTCTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTCTGATATACGTTCTTTGGTTCTGGGAAAGTATTGGCATGCCTGGCATATGAAGTCTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGTGTGACTTTGTCTTATTCATGTACAATATGTTTATACAGTTTTGTATTGAATTAAGCACTCAAAATAGAATAAATTGATTTTAACATTTTGTATATTGGCAATGGATAACTTTCTACCAAATTCTTTCTGTTGTTTCCATGTTACCTTTCCATTTCCCAGCTCAGTCTGATGTTTGTTTTTTGACATAGCTGAAGCCATTTTCTGCTTTTATTTGTTGTGTTAATATACCTGCCATTG
                                                  Xt7.1-CHK-1008226682                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCGGGCAGAGTGAAAAGCCTGGACTTTGTTGTTATTGTTGTCCCTGCACCGCTTCTCCCTGACCGGGGAACAAGCGCAGCAAGCGACAAGTCTGCGCGGTCAGAATGTATGTGCAAAATGCAACAGATCAACTGCAGCTTAGCTGACACCTGAATCTGAAAACTGAAAATGGATAAATGTAAACATGTTGGCCGATTGCGTCTCGCCCAAGATCATTCAATTTTGAACCCTCAAAAGTGGCACTGTGTGGATTGCAACACTACCGAATCCGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCGTGTGGTCGATACATTGAAGAGCATGCACTGCGACACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTACGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACGTTAAGTGCTATCAAAAGTCAGAACTATGACTGTACAACACGTAGTGGTCGGACTTTGCGGTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAAAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCATGGTTTGCTTTGACTCCAAAAGGCAAGCAAAGGCTAGAAGAGGAACGCTTGAGGGAGGTGGCAGAACAGAAGCGAGAGGAAGCAAGGAAAAGGCGACAGCAGTTGAAGCGCAAATTAAAGGAAGAAATGGAAAGCACTCCCCCTAGAAAAAGTTCACGTTTGAAACAGCAAATGCAACCTTCCCCCAAAACTGAATTGCCCTCTGTGCAAAAAATGAACCAAAAATACACTCCTACCACAAAACAAAAACCACCAGCACCTACCTCTATTGAAGTATGCTTAAAAAAAATTGGTAATTCTCCAATAAAAAGAAAGCCCACTGTGACCCCTGGAGTAACAGGACTGAGGAATCTGGGGAACACCTGCTACATGAACTCAATACTTCAGATACTGAGTCATTTGCATGTTTTCCGGGAGTGTTTTTTGCAACTTGATCTCAATCAAACTCAGGAGTTGTTGGCAGCTGCTGGCAGTGGGAAAACAAGGTTGTCCAGCAAATACCCACCTAGCGCTGTCCTACCAAAAGTAACACAAAAGCACACTAAAGTTCAAAGATCACTGGCAAGGCGTCAGAGCTTCTCCTCGGGACTTAGTGGTGGGGCCTCAAATAGTAGAAACATGGAACTAATTCAGCCTAAGGAGCCAAGTTCAAAGCACATATCCCTATGTCATGAATTGCATACCCTCTTCCAAGTCATGTGGTCAGGTAAATGGGCACTGGTTTCTCCCTTTGCAATGCTACATTCAGTCTGGAGGCTTATACCAGCCTTCCGTGGGTACGCACAACAAGATGCTCAGGAATTCCTCTGTGAACTATTGGATAAAGTACAACAAGAATTGGAGACAACTGGCACCAGATACCCAACCCTAATTCCTGCTTCTCAAAGGAAACTCATCAAACAGGTCCTGAATATCGTCAACAACATTTTTCACGGGCAACTACTTAGTCAGGTTACTTGTCTGGCCTGTGATCACAAATCAAATACCATTGAGCCATTTTGGGACTTGTCTCTTGAGTTTCCCGAGAGGTACCACTTCAATGGCAAAGAGACAGCTTCTCAGCGGCCTTGTCTGTTGACAGAAATGCTGGCCAAATTCACAGAGACTGAAGCCTTAGAAGGGAAGATCTATGCTTGTGACCAGTGCAACACAAAGCGTAGGAAGTTCTCATCCAAACCAGTTGTCCTTACAGAAGCACAGAAGCAGCTGATGGTGTGTCGGTTACCTCAGGTCCTGAGACTGCACCTCAAGAGATTCCGGTGGTCTGGCCGAAACCATCGTGAGAAAATTGGAGTGCATGTTCGCTTTGACCAGATGCTGAACATGGAGCCTTATTGTTGTAGAGAGTCCACTGCAGCCCTGAGAGCTGACTGCTTTATTTATGATCTGTCGTCTGTCGTGATGCATCATGGGAAAGGTTTTGGTTCTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGCTTCTGGGTCCACTGCAATGACTCCAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGCTTCTAGTCTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTCTGATATACGTTCTTTGGTTCTGGGAAAGTATTGGCATGCCTGGCATATGAAGTCTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGTGTGACTTTGTCTTATTCATGTACAATATGTTTATACAGTTTTGTATTGAATTAAGCACTCAAAATAGAATAAATTGATTTTAACATTTTGTATATTGGCAATGGATAACTTTCTACCAAATTCTTTCTGTTGTTTCCATGTTACCTTTCCATTTCCCAGCTCAGTCTGATGTTTGTTTTTTGACATAGCTGAAGCCATTTTCTGCTTTTATTTGTTGTGTTAATATACCTG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      3     3     4     4     4     4     5     5     5     6     5     6     6     7     7     8     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    11    12    11    12    11    12    12    12    12    12    12    12    12    12    12    12    11    11    11    11    11    11    11    11    10    11    10    11    10    11    10    11     9    10     8    10     8     9     5     8     7     8     6     8     7     8     6     7     5     6     4     6     4     6     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     2     4     3     5     3     5     3     4     3     4     3     4     3     4     2     3     2     3     2     3     3     4     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     7     7     8     7     8     7     8     7     8     7     9    10    11    13    13    13    13    13    13    13    13    13    13    14    14    14    14    15    15    16    16    16    16    16    16    17    17    17    17    17    17    17    17    16    16    16    16    17    17    17    17    18    18    18    18    18    18    17    18    18    21    18    22    19    22    19    22    19    22    19    22    19    22    19    23    20    23    20    23    20    23    20    23    19    22    19    22    19    21    20    21    20    21    18    21    22    23    20    23    20    23    21    23    22    22    22    22    22    22    21    21    21    21    21    21    20    21    21    21    21    21    21    21    21    21    18    20    18    20    18    20    19    20    16    19    16    18    15    17     6    10     4     9     4     5     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -T----------
                                               BLH ATG     174    1349                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH MIN     168     251                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH OVR     174     744                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               EST CLI     -12       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               ORF LNG     174     186                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 1e-026     NP_510570.2 1 -interacting deubiquitinating enzyme (82.1 kD) (XQ213) [Caenorhabditiselegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Sc ---- 6e-032     NP_013950.1 putative deubiquitinating enzyme; Ubp8p [Saccharomyces cerevisiae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 2e-037     NP_650948.2 CG5798-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Sp ==== 4e-108     XP_792596.2 PREDICTED: similar to MGC83063 protein [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PROTEIN --- Ci ---- 2e-114     FAA00240.1 TPA: zinc finger protein [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Mm ==== 0          NP_940813.1 hypothetical protein C330046L10 [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Dr ==== 0          NP_956551.1 hypothetical protein MGC55661 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Hs ==== 0          NP_115523.2 ubiquitin specific protease 44 [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Gg ==== 0          XP_416154.2 PREDICTED: hypothetical protein [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Xt ==== 0          AAI21580.1 Hypothetical protein MGC147131 [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xl ==== 0          AAH68889.1 MGC83063 protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = ?? ==== 0          NP_001084641.1 hypothetical protein LOC414600 [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABE11323.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGA---------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------TGA---TGA---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------TGA---------------------------------------------------TAA---------------------------------------------------------TAA---------------TAA---------------------------------TAA------------------------------------------------------------ATG---------TGA------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   1           TpA  FL                     TTpA061l04.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGAGCTGAGCGGCGGGCAGAGTGAAAAGCCTGGACTTTGTTGTTATTGTTGTCCCTGCACCGCTTCTCCCTGACCGGGGAACAAGCGCAGCAAGCGACAAGTCTGCGCGGTCAGAATGTATGTGCAAAATGCAACAGATCAACTGCAGCTTAGCTGACACCTGAATCTGAAAACTGAAAATGGATAAATGTAAACATGTTGGCCGATTGCGTCTCGCCCAAGATCATTCAATTTTGAACCCTCAAAAGTGGCACTGTGTGGATTGCAACACTACCGAATCCGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCGTGTGGTCGATACATTGAAGAGCATGCACTGCGACACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTACGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACGTTAAGTGCTATCAAAAGTCAGAACTATGACTGTACAACACGTAGTGGTCGGACTTTGCGGTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAAAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCATGGTTTGCTTTGACTCCAAAAGGCAAGCAAAGGCTAGAAGAGGAACGCTTGAGGGAGGTGGCAGAACAGAAGCGAGAGGAAGCAAGGAAAAGGCGACAGCAGTTGAAGCGCAAATTAAAGGAAGAAATGGAAAGCACTCCCCCTAGAAAAAGTTCACGTTTGAAACAGCAAATGCAACCTTCCCCCAAAACTGAATTGCCCTCTGTGCAAAAAATGAACCAAAAATACACTCCTACCACAAAACAAAAACCACCAGCACCTACCTCTATTGAAGTATGCTTAAAAAAAATTGGTAATTCTCCAATAAAAAGAAAGCCCACTGTGACCCCTGGAGTAACAGGACTGAGGAATCTGGGGAACACCTGCTACATGAACTCAATACTTCAGATACTGAGTCATTTGCATGTTTTCCGGGAGTGTTTTTTGCAACTTGATCTCAATCAAACTCAGGAGTTGTTGGCAGCTGCTGGCAGTGGGAAAACAAGGTTGTCCAGCAAATACCCACCTAGCGCTGTCCTACCAAAAGTAACACAAAAGCACACTAAAGTTCAAAGATCACTGGCAAGGCGTCAGAGCTTCTCCTCGGGACTTAGTGGTGGGGCCTCAAATAGTAGAAACATGGAACTAATTCAGCCTAAGGAGCCAAGTTCAAAGCACATATCCCTATGTCATGAATTGCATACCCTCTTCCAAGTCATGTGGTCAGGTAAATGGGCACTGGTTTCTCCCTTTGCAATGCTACATTCAGTCTGGAGGCTTATACCAGCCTTCCGTGGGTACGCACAACAAGATGCTCAGGAATTCCTCTGTGAACTATTGGATAAAGTACAACAAGAATTGGAGACAACTGGCACCAGATACCCAACCCTAATTCCTGCTTCTCAAAGGAAACTCATCAAACAGGTCCTGAATATCGTCAACAACATTTTTCACGGGCAACTACTTAGTCAGGTTACTTGTCTGGCCTGTGATCACAAATCAAATACCATTGAGCCATTTTGGGACTTGTCTCTTGAGTTTCCCGAGAGGTACCACTTCAATGGCAAAGAGACAGCTTCTCAGCGGCCTTGTCTGTTGACAGAAATGCTGGCCAAATTCACAGAGACTGAAGCCTTAGAAGGGAAGATCTATGCTTGTGACCAGTGCAACACAAAGCGTAGGAAGTTCTCATCCAAACCAGTTGTCCTTACAGAAGCACAGAAGCAGCTGATGGTGTGTCGGTTACCTCAGGTCCTGAGACTGCACCTCAAGAGATTCCGGTGGTCTGGCCGAAACCATCGTGAGAAAATTGGAGTGCATGTTCGCTTTGACCAGATGCTGAACATGGAGCCTTATTGTTGTAGAGAGTCCACTGCAGCCCTGAGAGCTGACTGCTTTATTTATGATCTGTCGTCTGTCGTGATGCATCATGGGAAAGGTTTTGGTTCTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGCTTCTGGGTCCACTGCAATGACTCCAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGCTTCTAGTCTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTCTGATATACGTTCTTTGGTTCTGGGAAAGTATTGGCATGCCTGGCATATGAAGTCTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGTGTGACTTTGTCTTATTCATGTACAATATGTTTATACAGTTTTGTATTGAATTAAGCACTCAAAATAGAATAAATTGATTTTAACATTTTGAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Ovi1 FLsh                         CABI474.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTATTGTTGTCCCTGCACCGCTTCTCCCTGACCGGGGAACAAGCGCAGCAAGCGACAAGTCTGCGCGGTCAGAATGTATGTGCAAAATGCAACAGATCAACTGCAGCTTAGCTGACACCTGAATCTGAAAACTGAAAATGGATAAATGTAAACATGTTGGCCGATTGCGTCTCGCCCAAGATCATTCAATTTTGAACCCTCAAAAGTGGCACTGTGTGGATTGCAACACTACCGAATCCGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCGTGTGGTCGATACATTGAAGAGCATGCACTGCGACACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTACGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACGTTAAGTGCTATCAAAAGTCAGAACTATGACTGTACAACACGTAGTGGTCGGACTTTGCGGTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAAAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCATGGTTTGCTTTGACTCCAAAAGGCAAGCAAAGGCTAGAAGAGGAACGCTTGAGGGAGGTGGCAGAACAGAAGCGAGAGGAAGCAAGGAAAAGGCGACAGCAGTTGAAGCGCAAATTAAAGGAAGAAATGGAAAGCACTCCCCCTAGAAAAAGTTCACGTTTGAAACAGCAAATGCAACCTTCCCCCAAAACTGAATTGCCCTCTGTGCAAAAAATGAACCAAAAATACACTCCTACCACAAAACAAAAACCACCAGCACCTACCTCTATTGAAGTATGCTTAAAAAAAATTGGTAATTCTCCAATAAAAAGAAAGCCCACTGTGACCCCTGGAGTAACAGGACTGAGGAATCTGGGGAACACCTGCTACATGAACTCAATACTTCAGATACTGAGTCATTTGCATGTTTTCCGGGAGTGTTTTTTGCAACTTGATCTCAATCAAACTCAGGAGTTGTTGGCAGCTGCTGGCAGTGGGAAAACAAGGTTGTCCAGCAAATACCCACCTAGCGCTGTCCTACCAAAAGTAACACAAAAGCACACTAAAGTTCAAAGATCACTGGCAAGGCGTCAGAGCTTCTCCTCGGGACTTAGTGGTGGGGCCTCAAATAGTAGAAACATGGAACTAATTCAGCCTAAGGAGCCAAGTTCAAAGCACATATCCCTATGTCATGAATTGCATACCCTCTTCCAAGTCATGTGGTCAGGTAAATGGGCACTGGTTTCTCCCTTTGCAATGCTACATTCAGTCTGGAGGCTTATACCAGCCTTCCGTGGGTACGCACAACAAGATGCTCAGGAATTCCTCTGTGAACTATTGGATAAAGTACAACAAGAATTGGAGACAACTGGCACCAGATACCCAACCCTAATTCCTGCTTCTCAAAGGAAACTCATCAAACAGGTCCTGAATATCGTCAACAACATTTTTCACGGGCAACTACTTAGTCAGGTTACTTGTCTGGCCTGTGATCATAAATCAAATACCATTGAGCCATTTTGGGACTTGTCTCTTGAGTTTCCCGAGAGGTACCACTTCAATGGCAAAGAGACAGCTTCTCAGCGGCCTTGTCTGTTGACAGAAATGCTGGCCAAATTCACAGAGACTGAAGCCTTAGAAGGGAAGATCTATGCTTGTGACCAGTGCAACACAAAGCGTAGGAAGTTCTCATCCAAACCAGTTGTCCTTACAGAAGCACAGAAGCAGCTGATGGTGTGTCGGTTACCTCAGGTCCTGAGACTGCACCTCAAGAGATTCCGGTGGTCTGGCCGAAACCATCGTGAGAAAATTGGAGTGCATGTTCGCTTTGACCAGATGCTGAACATGGAGCCTTATTGTTGTAGAGAGTCCACTGCAGCCCTGAGAGCTGACTGCTTTATTTATGATCTGTCGTCTGTCGTGATGCATCATGGGAAAGGTTTTGGTTCTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGTAATGGATAGGTTTTATCTGCAGATTTCTTAAGGGGTTTGCATATGAGCTGAAGAATATAGCATTATATATTGTCTTTACAATCCTCTCTGCACTTTTTGGAATTGGTTTTAAATGACAATGTTATGTGATGTTACTTCATTTCACACTGTAGATTTACATTTATATGACGTTGCAGGGATTGATGGTAATATTGGTTAGAAATGTTACTGATGGCTTTCTAATAAAAGCACTGCATGATGAAAAAAAAA
  5   1   2       bld TpA  5x3  out                  TTpA014g24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCATCATCATCGTCACCGTGTATAGAGAGAGTGAGCTGAGCGGCGGGCAGAGTGAAAAGCCTGGACTTTGTTGTTATTGTTGTCCCTGCACCGCTTCTCCCTGACCGGGGAACAAGCGCAGCAAGCGACAAGTCTGCGCGGTCAGAATGTATGTGCAAAATGCAACAGATCAACTGCAGCTTAGCTGACACCTGAATCTGAAAACTGAAAATGGATAAATGTAAACATGTTGGCCGATTGCGTCTCGCCCAAGATCATTCAATTTTGAACCCTCAAAAGTGGCACTGTGTGGATTGCAACACTACCGAATCCGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCGTGTGGTCGATACATTGAAGAGCATGCACTGCGACACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTACGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACGTTAAGTGCTATCAAAAGTCAGAACTATGACTGTACAACACGTAGTGGTCGGACTTTGCGGTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAAAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCATGGTTTGCTTTGACTCCAAAAGGCAAGCAAAGGCTAGAAGAGGAACGCTTGAGGGAGGTGGCAGAACAGAAGCGAGAGGAAGCAAGGAAAAAGCGACAGCAGTTGAAGCGCAAA
  5   1   2   20  bld Limb 5g                             CBSU8971.fwd ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGAGAGAGAGCTGAGCGGCGGGCAGAGTGAAAAGCCTGGACTTTGTTGTTATTGTTGTCCCTGCACCGCTTCTCCCTGACCGGGGAACAAGCGCAGCAAGCGACAAGTCTGCGCGGTCAGAATGTATGTGCAAAATGCAACAGATCAACTGCAGCTTAGCTGACACCTGAATCTGAAAACTGAAAATGGATAAATGTAAACATGTTGGCCGATTGCGTCTCGCCCAAGATCATTCAATTTTGAACCCTCAAAAGTGGCACTGTGTGGATTGCAACACTACCGAATCCGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCGTGTGGTCGATACATTGAAGAGCATGCACTGCGACACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTACGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACGTTAAGTGCTATCAAAAGTCAGAACTATGACTGTACAACACGTAGTGGTCGGACTTTGCGGTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAAAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCATGGTTTGCTTTGACTCCAAAAGGCAAGCAAAGGCTAGAAGAGGAACGCTTGAGGGAGGTGGCAGAACAGAAGCGAGAGGAAGCAAGGNAAAGGCGACAGCAGTTGAAGCG
  5   1   2       bld TpA  FL   in                   TTpA061l04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAGCTGAGCGGCGGGCAGAGTGAAAAGCCTGGACTTTGTTGTTATTGTTGTCCCTGCACCGCTTCTCCCTGACCGGGGAACAAGCGCAGCAAGCGACAAGTCTGCGCGGTCAGAATGTATGTGCAAAATGCAACAGATCAACTGCAGCTTAGCTGACACCTGAATCTGAAAACTGAAAATGGATAAATGTAAACATGTTGGCCGATTGCGTCTCGCCCAAGATCATTCAATTTTGAACCCTCAAAAGTGGCACTGTGTGGATTGCAACACTACCGAATCCGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCGTGTGGTCGATACATTGAAGAGCATGCACTGCGACACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTACGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACGTTAAGTGCTATCAAAAGTCAGAACTATGACTGTACAACACGTAGTGGTCGGACTTTGCGGTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAAAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCATGGTTTGCTTTGACTCCAAAAGGCAAGCAAAGGCTAGAAGAGGAACGCTTGAGGGAGGTGGCAGAACAGAAGCGAGAGGAAGCAAGGAAAAGGCGACAGCAGTTGAAGCGCANATTANAGGAAGAAATGGAAAGCACTCCCCCTAGAAAAAGTTCACGTT
  5   1   2       bld Neu  5g                        TNeu019k17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCAGAGTGAAAAGCCTGGACTTTGTTGTTATTGTTGTCCCTGCACCGCTTCTCCCTGACCGGGGAACAAGCGCAGCAAGCGACAAGTCTGCGCGGTCAGAATGTATGTGCAAAATGCAACAGATCAACTGCAGCTTAGCTGACACCTGAATCTGAAAACTGAAAATGGATAAATGTAAACATGTTGGCCGATTGCGTCTCGCCCAAGATCATTCAATTTTGAACCCTCAAAAGTGGCACTGTGTGGATTGCAACACTACCGAATCCGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCGTGTGGTCGATACATTGAAGAGCATGCACTGCGACACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTACGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACGTTAAGTGCTATCAAAAGTCAGAACTATGACTGTACAACACGTAGTGGTCGGACTTTGCGGTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAAAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTC
  5   1   2       bld TpA  5g                        TTpA039j20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTTATTGTTGTCCCTGCCCGCTTCTCCCTGACCGGGGAACAAGCGCAGCAAGCGACTAGTCTGCGCGGTCAGAATGTATGTGCAAAATGCAACATCATCAACTGCAGCTTAGCTGACACCTGAATCTGAAAACTGAAAATGGATAAATGTAAACATGTTGGCCGATTGCGTCTCGCCCAAGATCATTCAATTTTGAACCCTCAAAAGTGGCACTGTGTGGATTGCAACACTACCGAATCCGTGTGGGCTTGCCTAATCTGTTCACATGTTACGTGTGGTCGATACATTGAAGAGCATGCACTGCGACACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGACGTTAATGAACTTTACGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGA
  5   1   2       bld Ovi1 FLsh in                          CABI474.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATTGTTGTCCCTGCACCGCTTCTCCCTGACCGGGGAACAAGCGCAGCAAGCGACAAGTCTGCGCGGTCAGAATGTATGTGCAAAATGCAACAGATCAACTGCAGCTTAGCTGACACCTGAATCTGAAAACTGAAAATGGATAAATGTAAACATGTTGGCCGATTGCGTCTCGCCCAAGATCATTCAATTTTGAACCCTCAAAAGTGGCACTGTGTGGATTGCAACACTACCGAATCCGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCGTGTGGTCGATACATTGAAGAGCATGCACTGCGACACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTACGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACGTTAAGTGCTATCAAAAGTCAGAACTATGACTGTACAACACGTAGTGGTCGGACTTTGCGGTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAAAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCATGGTTTGCTTTGACTCCAAAAGGCAAGCAAAGGCTAGAAGAGGAACGCTTGAGGGAGGTGGCAGAACAGAAGCGAGAGGAAGCAAGGAAAAGGCGACAGCAGTTGAAGCGCANATTANAGGAAGAAATGGAAAGCACTCCCCCCTAGAAAAGTTCACGTNTGAAACAGCAAATGCAACC
  5   1   2   12  bld Gas7 5g3  in                         XZG47428.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGGGAACAAGCGCAGCAAGCGACAAGTCTGCGCGGTCAGAATGTATGTGCAAAATGCAACAGATCAACTGCAGCTTAGCTGACACCTGAATCTGAAAACTGAAAATGGATAAATGTAAACATGTTGGCCGATTGCGTCTCGCCCAAGATCATTCAATTTTGAACCCTCAAAAGTGGCACTGTGTGGATTGCAACACTACCGAATCCGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCGTGTGGTCGATACATTGAAGAGCATGCACTGCGACACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTACGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACGTTAAGTGCTATCAAAAGTCAGAACTATGACTGTACAACACGTAGTGGTCGGACTTTGCGGTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAAAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCATGGTTTGCTTTGACTCCAAAAGGCAAGCAAAGGCTAGAAGAGGAACGCTTGAGGGAGGTGGCAGAACAGAAGCGAGAGGAAGCAAGGAAAAGGCGACAGCAGTTGAAGCGCAAATTAAAGGAAGAAATGGAAAGCACTCCCCCTAGAAAAGTTCACGTTTGAAACAGCAAATGCAACCTTCCCCAAAACTGAATTGCCCTCTGTGCAAAAAATGAACCAAAAATACACTCCTACCACAAAACAAAA
  5   1   2   10  bld Ova1 5g3  in                         CABE9407.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAACAAGCGCAGCAAGCGACAAGTCTGCGCGGTCAGAATGTATGTGCAAAATGCAACAGATCAACTGCAGCTTAGCTGACACCTGAATCTGAAAACTGAAAATGGATAAATGTAAACATGTTGGCCGATTGCGTCTCGCCCAAGATCATTCAATTTTGAACCCTCAAAAGTGGCACTGTGTGGATTGCAACACTACCGAATCCGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCGTGTGGTCGATACATTGAAGAGCATGCACTGCGACACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTACGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACGTTAAGTGCTATCAAAAGTCAGAACTATGACTGTACAACACGTAGTGGTCGGACTTTGCGGTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAAAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCATGGTTTGCTTTGACTCCAAAAGGCAAGCAAAGGCTAGAAGAGGAACGCTTGAGGGAGGTGGCAGAACAGAAGCGAGA
  3   1   2       bld Neu  5x3  ?                     TNeu108e06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCGCCCAAGATCATTCAATTTTGAACCCTCAAAAGTGGCACTGTGTGGATTGCAACACTACCGAATCCGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCGTGTGGTCGATACATTGAAGAGCATGCACTGCGACACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTACGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACGTTAAGTGCTATCAAAAGTCAGAACTATGACTGTACAACACGTAGTGGTCGGACTTTGCGGTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAAAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCATGGTTTGCTTTGACTCCAAAAGGCAAGCAAAGGCTAGAAGAGGAACGCTTGAGGGAGGTGGCAGAACAGAAGCGAGAGGAAGCAAGGAAAAGGCGACAGCAGTTGAAGCGCAAATTAAAGGAAGAAATGGAAAGCACTCCCCCTAGAAAAAGTTCACGTTTGAAACAGCAAATGCAACCTTCCCTCCAAAACNTGAATTGCCCTCTGTGCAAAAAAAAAAAAAAAAAAGACGCCCC
  5   1   2       bld Neu       out                  TNeu108g06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCCCAAGATCATTCAATTTTGAACCCTCAAAAGTGGCACTGTGTGGATTGCAACACTACCGAATCCGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCGTGTGGTCGATACATTGAAGAGCATGCACTGCGACACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTACGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACGTTAAGTGCTATCAAAAGTCAGAACTATGACTGTACAACACGTAGTGGTCGGACTTTGCGGTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAAAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCATGGTTTGCTTTGACTCCAAAAGGCAAGCAAAG
  5   1   2       bld Lun1                                 CABD5786.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGCTGTTCACATGTTGCGTGTGGTCGATACATTGAAGAGCATGCACTGCGACACTTTCAGGACAGTAAGCATCCTTTGGCTTTGGAGGTTAATGAACTTTACGTTTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACGTTAAGTGCTATCAAAAGTCAGAACTATGACTGTACAACACGTAGTGGTCGGACTTTGCGGTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAAAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCATGGTTTGCTTTGACTCCAAAAGGCAAGCAAAGGCTAGAAGAGGAACGCTTGAGGGAGGTGGCAGAACAGAAGCGAGAGGAAGCAAGGAAAAGGCGACAGCAGTTGAAGCGCAAATTAAAGGAAGAAATGGAAAGCACTCCCCCTAGAAAAAGTTCACGTTTGAAACAGCAAATGCAACCTTCCCCCAAAACTGAATTGCCCTCTGTGCAAAAAATGAACCAAAAATACACTCCTACCACAAAACAAAAACCACCAGCACCTACCTCTATTGAAGTATGCTTAAAAAAAATTGGTAATTCTCCAATAAAAAGAAAGCCCACTGTGACCCCTGGAGTAACAGGACTGAGGAATCTGGGGAACACCTGCTACATGAACTCAATACTTCAGATACTGAGTCATTTGCATGTTTTCCGGGAGTGTTTTTTGCAACTTGATCTCAATCAAACTCAGGAGTTGTTGGCAGCTGCTGGCAGTGGGAAAACAAGGTTGTCCAGCAAATACCCACCTAGCGCTGTCCTACTAAAAGTACACAAAAGCACACTAAAGTTCAAAGATCACTGGCAAGGCGTC
  5   1   2       bld Tad5      in                         XZT69538.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACGTTAAGTGCTATCAAAAGTCAGAACTATGACTGTACAACACGTAGTGGTCGGACTTTGCGGTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCCTTTCTTCAAAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCATGGTTTGCTTTGACTCCAAAAGGCAAGCAAAGGCTAGAAGAGGAACGCTTGAGGGAGGTGGCAGAACAGAAGCGAGAGGAAGCAAGGAAAAGGCGACAGCAGTTGAAGCGCAAATTAAAGGAAGAAATGGAAAGCACTCCCCCTAGAAAAAGTTCACGTTTGAAACAGCAAATGCAACCTTCCCCCAAAACTGAATTGCCCTCTGTGCAAAAAATGAACCAAAAATACACTCCTACCACAAAACAAAAACCACCAGCACCTACCTCTATTGAAGTATGCTTTAAAAAAATTGGTAATTCTCCAATAAAAAGAAAGCCCACTGTGACCCCTGGAGTAACAGGACTGAGGAATCTGGGGAACACCTGCTACATGAACTCAATACTTCAGATACTGAGTCATTTGCATGTTTTCCGGGAGTGTTTTTTGCAACTTGATCTCAATCAAACTCAGGAGTTGTTGGCAGCTGCTGGCAGTGNGAAAACAAGGTTGTCCAGCAAATACCCACCTAGCGCTGTCCTACCAAAAGTAACACAAAAGCACACTAAAGTTCAAAGATCACTGGCAAGGCGTCAGAGCTTCTCCTCGGGACTTAGTGGTGGGGCCTCAAATAGTAGAAACA
  5   1   2       bld Te5       in                         CAAO5447.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGTCTATGGTAACTGCAGATGATTCATTCATTTCACATGAAGGTGCACAAGCNCTTTCTTCAAAATGAAGACCGTGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGGTCATGGTTTGCTTTGACTCCAAAAGGCAAGCAAAGGCTAGAAGAGGAACGCTTGAGGGAGGTGGCAGAACAGAAGCGAGAGGAAGCAAGGAAAAGGCGACAGCAGTTGAAGCGCAAATTAAAGGAAGAAATGGAAAGCACTCCCCCTAGAAAAAGTTCACGTTTGAAACAGCAAATGCAACCTTCCCCCAAAACTGAATTGCCCTCTGTGCAAAAAATGAACCAAAAATACACTCCTACCACAAAACAAAAACCACCAGCACCTACCTCTATTGAAGTATGCTTAAAAAAAATTGGTAATTCTCCAATAAAAAGAAAGCCCACTGTGACCCCTGGAGTAACAGGACTGAGGAATCTGGGGAACACCTGCTACATGAACTCAATACTTCAGATACTGAGTCATTTGCATGTTTTCCGGGAGTGTTTTTTGCAACTTGATCTCAATCAAACTCAGGAGTTGTTGGCAGCTGCTGGCAGTGGGAAAACAAGGTTGTCCAGCAAATACCCACCTAGCGCTGTCCTACCAAAAGTAACACAAAAGCACACTAAAGTTCAAAGATCACTGGCAAGGCGTCAGAGCTTCTCCTCGGGACTTAGTGGTGGGGCCTCAAATAGTAGAAACATGGAACTAATTCAGCCTAAGGAGCCAAGTTCAAAGCACATATCCCTATGTCATGAATTGCATACCCTCTTCCAGTCATGTGGTCAGGTAAATGGGCACTGGTTTCTCCCTTTGCATGCTACATTCAGTCTGGAGGCTTATACCAG
  5   1   2       bld Gas       in                   TGas119f19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAAGGCAAGCAAAGGCTAGAAGAGGAACGCTTGAGGGAGGTGGCAGAACAGAAGCGAGAGGAAGCAAGGAAAAGGCGACAGCAGTTGAAGCGCAAATTAAAGGAAGAAATGGAAAGCACTCCCCCTAGAAAAGTTCACGTTTGAAACAGCAAATGCAACCTTCCCCCAAAACTGAATTGCCCTCTGTGCAAAAAATGAACCAAAAATACACTCCTACCACAAAACAAAAACCACCAGCACCTACCTCTATTGAAGTATGCTTAAAAAAAATTGGTAATTCTCCAATAAAAAGAAAGCCCACTGTGACCCCTGGAGTAACAGGACTGAGGAATCTGGGGAACACCTGCTACATGAACTCAATACTTCAGATACTGAGTCATTTGCATGTTTTCCGGGAGTGTTTTTTGCAACTTGATCTCAATCAAACTCAGGAGTTGTTGGCAGCTGCTGGCAGTGGGAAAACAAGGTTGTCCAGCAAATACCCACCTAGCGCTGTCCTACCAAAAGTAACACAAAGCACACTAAGTTCAAAGATCACTGGCAAGGCGTCAGAGCTTCTCCTCGGGACTTAGTGGTGGGGCCTCAAATAGTAGAAACATGGAACTAATTCAGCCTAAGGAGCCAAGTTCAAAGCACATATCCCTATGTCATG
  5   1   2       bld Neu0      in                     NISC_ng26a05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTAAAGTTCAAAGATCACTGGCAAGGCGTCAGAGCTTCTCCTCGGGACTTAGTGGTGGGGCCTCAAATAGTAGAAACATGGAACTAATTCAGCCTAAGGAGCCAAGTTCAAAGCACATATCCCTATGTCATGAATTGCATACCCTCTTCCAAGTCATGTGGTCAGGTAAATGGGCACTGGTTTCTCCCTTTGCAATGCTACATTCAGTCTGGAGGCTTATACCAGCCTTCCGTGGGTACGCACAACAAGATGCTCAGGAATTCCTCTGTGAACTATTGGATAAAGTACAACAAGAATTGGAGACAACTGGCACCAGATACCCAACCCTAATTCCTGCTTCTCAAAGGAAACTCATCAAACAGGTCCTGAATATCGTCAACAACATTTTTCACGGGCAACTACTTAGTCAGGTTACTTGTCTGGCCTGTGATCACAAATCAAATACCATTGAGCCATTTTGGGATTTGTCTCTTGAGTTTCCCGAGAGGTACCACTTCAATGGCAAAGAGACAGCTTCTCAGCGGCCTTGTCTGTTGACAGAAATGCTGGCCAAATTCACAGAGACTGAAGCCTTAGAAGGGAAGATCTATGCTTGTGACCAGTGCAACACAAAGCGTAGGAAGTTCTCATCCAAACCAGTTGTCCTTA
  5   1   2       bld Tbd1      in                         CBXT7874.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAAGCACATATCCCTATGTCATGAATTGCATACCCTCTTCCAAGTCATGTGGTCAGGTAAATGGGCACTGGTTTCTCCCTTTGCAATGCTACATTCAGTCTGGAGGCTTATACCAGCCTTCCGTGGGTACGCACAACAAGATGCTCAGGAATTCCTCTGTGAACTATTGGATAAAGTACAACAAGAATTGGAGACAACTGGCACCAGATACCCAACCCTAATTCCTGCTTCTCAAAGGAAACTCATCAAACAGGTCCTGAATATCGTCAACAACATTTTTCACGGGCAACTACTTAGTCAGGTTACTTGTCTGGCCTGTGATCACAAATCAAATACCATTGAGCCATTTTGGGACTTGTCTCTTGAGTTTCCCGAGAGGTACCACTTCAATGGCAAAGAGACAGCTTCTCAGCGGCCTTGTCTGTTGACAGAAATGCTGGCCAAATTCACAGAGACTGAAGCCTTAGAAGGGAAGATCTATGCTTGTGACCAGTGCAACACAAAGCGTAGGAAGTTCTCATCCAAACCAGTTGTCCTTACAGAAGCACAGAAGCAGCTGATGGTGTGTCGGTTACCTCAGGTCCTGAGACTGCACCTCAAGAGATTCCGGTGGTCTGGCCGAAACCATCGTGAGAAAATTGGAGTGCATGTTCGCTTTGACCAGATGCTGAACATGGAGCCTTATTGTTGTAGAGAGTCCACTGCAGCCCTGAGAGCTGACTGCTTTATTT
  5   1   2       bld Ova1      in                        CABE11323.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGCACAACAAGATGCTCAGGAATTCCTCTGTGAACTATTGGATAAAGTACAACAAGAATTGGAGACAACTGGCACCAGATACCCAACCCTAATTCCTGCTTCTCAAAGGAAACTCATCAAACAGGTCCTGAATATCGTCAACAACATTTTTCACGGGCAACTACTTAGTCAGGTTACTTGTCTGGCCTGTGATCATAAATCAAATACCATTGAGCCATTTTGGGACTTGTCTCTTGAGTTTCCCGAGAGGTACCACTTCAATGGCAAAGAGACAGCTTCTCAGCGGCCTTGTCTGTTGACAGAAATGCTGGCCAAATTCACAGAGACTGAAGCCTTAGAAGGGAAGATCTATGCTTGTGACCAGTGCAACACAAAGCGTAGGAAGTTCTCATCCAAACCAGTTGTCCTTACAGAAGCACAGAAGCAGCTGATGGTGTGTCGGTTACCTCAGGTCCTGAGACTGCACCTCAAGAGATTCCGGTGGTCTGGCCGAAACCATCGTGAGAAAATTGGAGTGCATGTTCGCTTTGACCAGATGCTGAACATGGAGCCTTATTGTTGTAGAGAGTCCACTGCAGCCCTGAGAGCTGACTGCTTTATTTATGATCTGTCGTCTGTCGTGATGCATCATGGGAAAGGTTTTGGTTCTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGCTTCTGGGTCCACTGCAATGACTCCAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGC
  3   1   2       chi Ovi1 FLsh in                          CABI474.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATACCCAACCCTAATTTCCTGCTTCTCAAAGGAAACTCATCAAACAGGTCCTGAATATCGTCAACAACATTTTTCACGGGCAACTACTTAGTCAGGTTACTTGTCTGGCCTGTGATCATAAATCAAATACCATTGAGCCATTTTGGGACTTGTCTCTTGAGTTTCCCGAGAGGTACCACTTCAATGGCAAAGAGACAGCTTCTCAGCGGCCTTGTCTGTTGACAGAAATGCTGGCCAAATTCACAGAGACTGAAGCCTTAGAAGGGAAGATCTATGCTTGTGACCAGTGCAACACAAAGCGTAGGAAGTTCTCATCCAAACCAGTTGTCCTTACAGAAGCACAGAAGCAGCTGATGGTGTGTCGGTTACCTCAGGTCCTGAGACTGCACCTCAAGAGATTCCGGTGGTCTGGCCGAAACCATCGTGAGAAAATTGGAGTGCATGTTCGCTTTGACCAGATGCTGAACATGGAGCCTTATTGTTGTAGAGAGTCCACTGCAGCCCTGAGAGCTGACTGCTTTATTTATGATCTGTCGTCTGTCGTGATGCATCATGGGAAAGGTTTTGGTTCTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGTAATGGATAGGTTTTATCTGCAGATTTCTTAAGGGGTTTGCATATGAGCTGAAGAATATAGCATTATATATTGTCTTTACAATCCTCTCTGCACTTTTTGGAATTGGTTTTAAATGACAATGTTATGTGATGTTACTTCATTTCACACTGTAGATTTACATTTATATGACGTTGCAGGGATTGATGGTAATATTGGTTAGAAATGTTACTGATGGCTTTCTAATAAAAGCACTGCATGAGAAAAAAAAAAGCCTCTCGCCCTATAG
  5   1   2       bld Tbd1      in                        CBXT22708.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAACAGGTCCTGAATATCGTCAACAACATTTTTCACGGGCAACTACTTAGTCAGGTTACTTGTCTGGCCTGTGATCACAAATCAAATACCATTGAGCCATTTTGGGACTTGTCTCTTGAGTTTCCCGAGAGGTACCACTTCAATGGCAAAGAGACAGCTTCTCAGCGGCCTTGTCTGTTGACAGAAATGCTGGCCAAATTCACAGAGACTGAAGCCTTAGAAGGGAAGATCTATGCTTGTGACCAGTGCAACACAAAGCGTAGGAAGTTCTCATCCAAACCAGTTGTCCTTACAGAAGCACAGAAGCAGCTGATGGTGTGTCGGTTACCTCAGGTCCTGAGACTGCACCTCAAGAGATTCCGGTGGTCTGGCCGAAACCATCGTGAGAAAATTGGAGTGCATGTTCGCTTTGACCAGATGCTGAACATGGAGCCTTATTGTTGTAGAGAGTCCACTGCAGCCCTGAGAGCTGACTGCTTTATTTATGATCTGTCGTCTGTCGTGATGCATCATGGGAAAGGTTTTGGTTCTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGCTTCTGGGTCCACTGCAATGACTCCAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTTTCATGGC
  5   1   2       chi Gas7      in                         XZG64464.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATAAATCAAATACCATTGAGCCATTTTGGGACTTGTCTCTTGAGTTTCCCGAGAGGTACCACTTCAATGGCAAAGAGACAGCTTCTCAGCGGCCTTGTCTGTTGACAGAAATGCTGGCCAAATTCACAGAGACTGAAGCCTTAGAAGGGAAGATCTATGCTTGTGACCAGTGCAACAAAGCACAGAAGCAGCTGATGGTGTGTCGGTTACCTCAGGTCCTGAGACTGCACCTCAAGAGATTCCGGTGGTCTGGCCGAAACCATCGTGAGAAAATTGGAGTGCATGTTCGCTTTGACCAGATGCTGAACATGGAGCCTTATTGTTGTAGAGAGTCCACTGCAGCCCTGAGAGCTGACTGCTTTATTTATGATCTGTCGTCTGTCGTGATGCATCATGGGAAAGGTTTTGGTTCTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGCTTCTGGGTCCACTGCAATGACTCCAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGCTTCTAGTCTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTCTGATATACGTTCTTTGGTTCTGGGAAAGTATTGGCATGCCTGGCATATGAAGT
  5   1   2       bld Gas7      in                         XZG44039.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAAGCCTTAGAAGGGAAGATCTATGCTTGTGACCAGTGCAACACAAAGCGTAGGAAGTTCTCATCCAAACCAGTTGTCCTTACAGAAGCACAGAAGCAGCTGATGGTGTGTCGGTTACCTCAGGTCCTGAGACTGCACCTCAAGAGATTCCGGTGGTCTGGCCGAAACCATCGTGAGAAAATTGGAGTGCATGTTCGCTTTGACCAGATGCTGAACATGGAGCCTTATTGTTGTAGAGAGTCCACTGCAGCCCTGAGAGCTGACTGCTTTATTTATGATCTGTCGTCTGTCGTGATGCATCATGGGAAAGGTTTTGGTTCTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGCTTCTGGGTCCACTGCAATGACTCTAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGCTTCTAGTCTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTCTGATATACGTTCTTTGGTTCTGGGAAAGTATTGGCATGCCTGGCATATGAAGTCTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGTGTGACTTTGTCTTATTCATGTACAATATGTTTATACAGTTTTGTATTGAATTAAGCACT
  3   1   2      seed Ova1      in                        CABE11323.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCCTTAGAAGGGAAGATCTATGCTTGTGACCAGTGCAACACAAAGCGTAGGAAGTTCTCATCCAAACCAGTTGTCCTTACAGAAGCACAGAAGCAGCTGATGGTGTGTCGGTTACCTCAGGTCCTGAGACTGCACCTCAAGAGATTCCGGTGGTCTGGCCGAAACCATCGTGAGAAAATTGGAGTGCATGTTCGCTTTGACCAGATGCTGAACATGGAGCCTTATTGTTGTAGAGAGTCCACTGCAGCCCTGAGAGCTGACTGCTTTATTTATGATCTGTCGTCTGTCGTGATGCATCATGGGAAAGGTTTTGGTTCTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGCTTCTGGGTCCACTGCAATGACTCCAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGCTTCTAGTCTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTCTGATATACGTTCTTTGGTTCTGGGAAAGTATTGGCATGCCTGGCATATGAAGTCTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGTGTGACTTTGTCTTATTCATGTACAATATGTTTATACAGTTTTGTATTGAATTAAGCACTCAAAATAGAATAAATTGATTTTAACATTT
  3   1   2       bld Tad5      in                         XZT69538.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATCCAAACCCAGTGGTCTTTACAGAAGCACAGAAGCAGCTGATGGTGTGTCGGTTACCTCAGGTCCTGAGACTGCACCTCAAGAGATTCCGGTGGTCTGGCCGAAACCATCGTGAGAAAATTGGAGTGCATGTTCGCTTTGACCAGATGCTGAACATGGAGCCTTATTGTTGTAGAGAGTCCACTGCAGCCCTGAGAGCTGACTGCTTTATTTATGATCTGTCGTCTGTCGTGATGCATCATGGGAAAGGTTTTGGTTCTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGCTTCTGGGTCCACTGCAATGACTCCAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGCTTCTAGTCTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTCTGATATACGTTCTTTGGTTCTGGGAAAGTATTGGCATGCCTGGCATATGAAGTCTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGTGTGACTTTGTCTTATTCATGTACAATATGTTTATACAGTTTTGTATTGAATTAAGCACTCAAAATAGAATAAATGGATTTTAACATTTGGTATATGGGC
  3   1   2       bld TpA       ?                     TTpA014g22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCAAACCAGTTGTCCTTACAGAAGCACAGAAGCAGCTGATGGTGTGTCGGTTACCTCAGGTCCTGAGACTGCACCTCAAGAGATTCCGGTGGTCTGGCCGAAACCATCGTGAGAAAATTGGAGTGCATGTTCGCTTTGACCAGATGCTGAACATGGAGCCTTATTGTTGTAGAGAGTCCACTGCAGCCCTGAGAGCTGACTGCTTTATTTATGATCTGTCGTCTGTCGTGATGCATCATGGGAAAGGTTTTGGTTCTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGCTTCTGGGTCCACTGCAATGACTCCAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGCTTCTAGTCTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTCTGATATACGTTCTTTGGTTCTGGGAAAGTATTGGCATGCCTGGCATATGAAGTCTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGTGTGACTTTGTCTTATTCATGTACAATATGTTTATACAGTTTTGTATTGAATTAAGCACTCAAAATAGAATAAATTGATTTTAACATTTTGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te5       in                         CAAO5447.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAACCAGTTGTCCTTACAGAAGCACAGAAGCAGCTGATGGTGTGTCGGTTACCTCAGGTCCTGAGACTGCACCTCAAGAGATTCCGGTGGTCTGGCCGAAACCATCGTGAGAAAATTGGAGTGCATGTTCGCTTTGACCAGATGCTGAACATGGAGCCTTATTGTTGTAGAGAGTCCACTGCAGCCCTGAGAGCTGACTGCTTTATTTATGATCTGTCGTCTGTCGTGATGCATCATGGGAAAGGTTTTGGTTCTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGCTTCTGGGTCCACTGCAATGACTCCAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGCTTCTAGTCTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTCTGATATACGTTCTTTGGTTCTGGGAAAGTATTGGCATGCCTGGCATATGAAGTCTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAAGTGTGACTTTGTCTTATTCATGTACAATATGTTTATACAGTTTTGTATTGAATTAAGCACTCAAAATAGAATAAATTGATTTTAACATTTG
  3   1   2       bld Gas7 5g3  in                         XZG47428.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACCAGTTGTCCTTACAGAAGCACAGAAGCAGCTGATGGTGTGTCGGTTACCTCAGGTCCTGAGACTGCACCTCAAGAGATTCCGGTGGTCTGGCCGAAACCATCGTGAGAAAATTGGAGTGCATGTTCGCTTTGACCAGATGCTGAACATGGAGCCTTATTGTTGTAGAGAGTCCACTGCAGCCCTGAGAGCTGACTGCTTTATTTATGATCTGTCGTCTGTCGTGATGCATCATGGGAAAGGTTTTGGTTCTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGCTTCTGGGTCCACTGCAATGACTCCAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGCTTCTAGTCTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTCTGATATACGTTCTTTGGTTCTGGGAAAGTATTGGCATGCCTGGCATATGAAGTCTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGTGTGACTTTGTCTTATTCATGTACAATATGTTTATACAGTTTTGTATTGAATTAAGCACTCAAAATAGAATAAATTGATTTTAACATTTAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas       in                    TGas119f19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGAAGCACAGAAGCAGCTGATGGTGTGTCGGTTACCTCAGGTCCTGAGACTGCACCTCAAGAGATTCCGGTGGTCTGGCCGAAACCATCGTGAGAAAATTGGAGTGCATGTTCGCTTTGACCAGATGCTGAACATGGAGCCTTATTGTTGTAGAGAGTCCACTGCAGCCCTGAGAGCTGACTGCTTTATTTATGATCTGTCGTCTGTCGTGATGCATCATGGGAAAGGTTTTGGTTCTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGCTTCTGGGTCCACTGCAATGACTCCAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGCTTCTAGTCTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTCTGATATACGTTCTTTGGTTCTGGGAAAGTATTGGCATGCCTGGCATATGAAGTCTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGTGTGACTTTGTCTTATTCATGTACAATATGTTTATACAGTTTTGTATTGAATTAAGCACTCAAAATAGAATAAATTGATTTTAACATTTTGTATATTGGCAATGGATAACTTTCTACCAAATTCTTTCTGTTGTTTCCATGTTACCTTTCCATTTCCCAGCTCAGTCTGATGTTTGTTTTTTGACATAGCTGAAGCCATTTTCTGCTTTTATTTGTTGTGTTAATATACCTGCCATGTTCTAAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA  FL   in                    TTpA061l04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGAAGCACAGAAGCAGCTGATGGTGTGTCGGTTACCTCAGGTCCTGAGACTGCACCTCAAGAGATTCCGGTGGTCTGGCCGAAACCATCGTGAGAAAATTGGAGTGCATGTTCGCTTTGACCAGATGCTGAACATGGAGCCTTATTGTTGTAGAGAGTCCACTGCAGCCCTGAGAGCTGACTGCTTTATTTATGATCTGTCGTCTGTCGTGATGCATCATGGGAAAGGTTTTGGTTTTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGCTTTTGGGTCCACTGCAATGACTCCAAGCTCCATTTGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGCTTCTAGTCTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTTTGATATACGTTCTTTGGTTTTGGGAAAGTATTGGCATGCCTGGCATATGAAGTTTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGTGTGACTTTGTTTTATTCATGTACAATATGTTTATACAGTTTTGTATTGAATTAAGCACTCAAAATAGAATAAATTGATTTTAACATTTGAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                        CBXT22708.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGATTCCGGTGGTCTGGCCGAAACCATCGTGAGAAAATTGGAGTGCATGTTCGCTTTGACCAGATGCTGAACATGGAGCCTTATTGTTGTAGAGAGTCCACTGCAGCCCTGAGAGCTGACTGCTTTATTTATGATCTGTCGTCTGTCGTGATGCATCATGGGAAAGGTTTTGGTTCTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGCTTCTGGGTCCACTGCAATGACTCCAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGCTTCTAGTCTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTTTGATATACGTTCTTTGGTTCTGGGAAAGTATTGGCATGCCTGGCATATGAAGTCTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGTGTGACTTTGTTTTATTCATGTACAATATGTTTATACAGTTTTGTATTGAATTAAGCACTCAAAATAGAATAAATTGATTTTAACATTTTGTATATTGAAAAAAAAAAAATAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG44039.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGAAACCATCGTGAGAAAATTGGAGTGCATGTTCGCTTTGACCAGATGCTGAACATGGAGCCTTATTGTTGTAGAGAGTCCACTGCAGCCCTGAGAGCTGACTGCTTTATTTATGATCTGTCGTCTGTCGTGATGCATCATGGGAAAGGTTTTGGTTTTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGGTTTTGGGTCCACTGCAATGACTTTAAGCTCCATTTGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTTTTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGGTTTTAGTCTCACTATTCCATAAGGGTATTTGTGGGTATGGGTATATACACTTTGATATACGTTTTTTGGTTTTGGGAAAGTATTGGCATGCCTGGCATATGAAGTTTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGTGTGACTTTGTTTTATTCATGTACAATATGTTTATACAGTTTTGTATTGAATTAAGCACTCAAAATAGAATAAATTGATTTTAACATTTTGG
  3   1   2       bld Gas7      in                         XZG64464.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCGTGAGAAAATTGGAGTGCATGTTCGCTTTGACCAGATGCTGAACATGGAGCCTTATTGTTGTAGAGAGTCCACTGCAGCCCTGAGAGCTGACTGCTTTATTTATGATCTGTCGTCTGTCGTGATGCATCATGGGAAAGGTTTTGGTTCTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGCTTCTGGGTCCACTGCAATGACTCCAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGCTTCTAGTCTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTCTGATATACGTTCTTTGGTTCTGGGAAAGTATTGGCATGCCTGGCATATGAAGTCTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGTGTGACTTTGTCTTATTCATGTACAATATGTTTATACAGTTTTGTATTGAATTAAGCACTCAAAATAGAATAAATTGATTTTAACATTTTG
  3   1   2       bld Ova1 5g3  in                         CABE9407.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAACATGGAGCCTTATTGTTGTAGAGAGTCCACTGCAGCCCTGAGAGCTGACTGCTTAATTTATGATCTGTCGTCTGTCGTGATGCATCATGGGAAAGGTTTTGGTTCTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGCTTCTGGGTCCACTGCAATGACTCCAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGCTTCTAGTCTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTCTGATATACGTTCTTTGGTTCTGGGAAAGTATTGGCATGCCTGGCATATGAAGTCTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGTGTGACTTTGTCTTATTCATGTACAATATGTTTATACAGTTTTGTATTGAATTAAGCACTCAAAATAGAATAAATTGATTTTAACATTTTGT
  3   1   2       bld Tbd1      in                         CBXT7874.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTCGTGATGCATCATGGGAAAGGTTTTGGTTCTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGCTTCTGGGTCCACTGCAATGACTCCAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGCTTCTAGTCTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTCTGATATACGTTCTTTGGTTCTGGGAAAGTATTGGCATGCCTGGCATATGAAGTCTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGTGTGACTTTGTCTTATTCATGTACAATATGTTTATACAGTTTTGTATTGAATTAAGCACTCAAAATAGAATAAATTGATTTTAACATTTTGTATATTGGCAATGGATAACTTTCTACCAAATTCTTTCTATTGTTTCCATGTTACCTTTCCATTTCCCAGCTCAGTCTGATGTTTGTTTTTTGACATAGCTGAAGCCATTTTCTGCTTTTATTTGTTGTGTTAATATACCTGCCATTGTTCTAAAAAAAAAAAAAAA
  5   1   2       bld Gas7      in                         XZG33069.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGAAAGGTTTTGGTTCTGGCCATTACACTGCCTTTTGTTACAATCCGGAAGGAGGCTTCTGGGTCCACTGCAATGACTCCAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGCTTCTAGTCTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTCTGATATACGTTCTTTGGTTCTGGGAAAGTATTGGCATGCCTGGCATATGAAGTCTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGTGTGACTTTGTCTTATTCATGTACAATATGTTTATACAGTTTTGTATTGAATTAAGCACTCAAAATAGAATAAATTGATTTTAACATTTTGTATATTGGCAATGGATAACTTTCTACCAAATTCTTTCTGTTGTTTCCATGTTACCTTTCCATTTCCCAGCTCAGTCTGATGTTTGTTTTTTGACATAGCTGAAGCCATTTTCTGCTTTTATTTGTTGTGTTAATATACCTGCCATTGTTCTAAAAA
  3   1   2       bld BrSp      in                     EC2BBA29BB05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGGAGGCTTCTGGGTCCACTGCAATGACTCCAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTCTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGCTTCTAGTCTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTCTGATATACGTTCTTTGGTTCTGGGAAAGTATTGGCATGCCTGGCATATGAAGTCTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGTGTGACTTTGTCTTATTCATGTACAATATGTTTATACAGTTTTGTATTAATTAAGCACTCAAAATAGAATAATGTAATT
  5   1   2       bld BrSp      in                     EC2BBA29BB05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGGAGGCTTCTGGGTCCACTGCAATGACTCCAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTCTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGCTTCTAGTCTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTCTGATATACGTTCTTTGGTTCTGGGAAAGTATTGGCATGCCTGGCATATGAAGTCTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGTGTGACTTTGTCTTATTCATGTACAATATGTTTATACAGTTTTGTATTGAATTAAGCACTCAAAATAGAATAAATTGATTTTAACATTGGAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg                            TEgg026m24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGCTTCTGGGTCCACTGCAATGACTCCAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTATTTTACACCCAGCGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGCTTCTAGTCTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTCTGATATACGTTCTTTGGTTCTGGGAAAGTATTGGCATGCCTGGCATATGAAGTCTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGTGTGACTTTGTCTTATTCATGTACAATATGTTTATACAGTTTTGTATTGAATT
  3   1   2       bld Gas7      in                         XZG33069.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTGGGTCCACTGCAATGACTCCAAGCTCCATTCGTGTACCGTGGAAGAGGTGTGCAAGGCACAAGCATACATATTTTTTTACCCCCAGGGAGTTACTCAGGAGAATGGACATTTGTCAAACAGGCTTCCTATCCATGGCAGCCCGCAGTCCCCACCCCGTTGAGACACTTTCATGGCAGGAACATCCCTGACCTTTTGGCAGCTTTTAGTCTCACTATTCCATAAGGGTATTTGGGGGTAGGGGTAAATACACTTTGATATACGTTTTTTGGTTTTGGGAAAGTATTGGCATCCCTGGCATATGAAGTTTCCATTGCAAAACCTGGACTGCAAAGGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGTGGGACTTTGTTTTATTCATGTCCAATATGTTTATACAGTTTTGTATTGAATTAAGCCCTCAAAATAGAATAAATTGATTTTAACATTTTGTATATTGGCAAGGGATAACTTTTTACCAAATTTTTTTTGTTGTTTCCATGTTACCTTTCCATTTCCCAGCTCAGTTTGAGGTTTGTTTTTTGACATAGCGGAAGCCATTTTTTGCTTTTATTTGTGGGGTTAAAAT
  3   1   2       bld Neu0      in                     NISC_ng26a05.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTTTTCCCCCCGGGGGTTTCTCCGGGGAATGGGCATTTGTCAAACAGGGTTTCTTTCCATGGGAGGCCGCAGTCCCCCCCCCGTTGGGGCCCTTTCATGGCAGGGACATCCCTGGCCTTTTGGGAGGTTTTAGTTTCCCTATTCCATAAGGGGATTTGGGGGGAAGGGGATAAACCCTCTGAAATACGTTTTTTGGTTTTGGGAAAGTATTGGCATGCCTGGCATATGAAGTTTCCCTTGCAAAACCTGGGGTGCAAAAGAATTGCCCTCCTCCGATTTAGCCGGCTTGGCATAGTAGTAACCCGCCCCGGGTAAGAAAGGGGGGCTTTGTTTTTTTCATGGACCAAATGTTTATACCGTTTTGTTTTGGATTAAGCCCCCCAAATAGAATAAATTGGTTTTTACCTTTTGGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG
  5   1   2       bld Thy1      in                        CBST5945.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTCTGATATACGTTCTTTGGTTCTGGGAAAGTATTGGCATGCCTGGCATATGAAGTCTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGTGTGACTTTGTCTTATTCATGTACAATATGTTTATACAGTTTTGTATTGAATTAAGCACTCAAAATAGAATAAATTGATTTTAACATTTTGT
  3   1   2       bld Thy1      in                        CBST5945.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCACTATTCCATAAGGGTATTTGTGTGTATGTGTATATACACTCTGATATACGTTCTTTGGTTCTGGGAAAGTATTGGCATGCCTGGCATATGAAGTCTCCATTGCAAAACCTGGACTGCAAATGAATTGCCATCATCAGATTTAGCAGACTTGGCATAGTAGTAACCAGACCTGTGTAAGAAAGNT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)