Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAM5525.5                           14 END     6          10       50                Unknown (protein for MGC:145403) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012075547 Xt7.1-CAAM5871.3 - 57 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAM5871.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCACCAAAATGGATAGAACTCGCAAATTTAATTAACAGCTGTATGGACTATGAACCAGATTTTCGGCCTTCATTCAGGGCGATAATAAGGGACCTTAATAGCTTGTTTACTCCAGACTATGAGTTACTGGCAGAAACTGACTTTCTCCAAAATATGAGAATTGGGGCTTTTGGTTTCTCTGGAGGCTTTGAAGACCGAGATCCTCCTTTTGAAGAAAGACATCTTAAATTCTTGCAGCAACTTGGCAAGGGTAATTTTGGAAGTGTTGAATTGTGCCGCTATGACCCACTACAAGACAATACTGGTGAAGTTGTGGCAGTAAAAAAGCTGCAGCATACCACTGAGGAGTACCTGAGGGACTTTGAACGAGAAATTGAAATCCTTAAATCACTCCAACATGATAACATAGTGAGATACAAGGGAGTGTGTTACAGCGCAGGTCGTCGAAATCTTAGATTGATTATGGAATACTTGCCCTATGGAAGCTTACGAGACTATTTACAAAAGCATAAAGACCGATTGGACTTCAAAAAGCTTTTACAATATTCAAGCCAAATATGCAAGGGAATGGAATATCTTACCATTAAAAGGTACATTCACAGAGATTTGGCAACGAGAAATATTTTAGTCGAGAATGAAAACAGGGTAAAAATAGGGGATTTTGGATTGACTAAAGTACTGCCGCAAGACAAAGAATATTACAAAGTCAAAGAACCTGGTGAAAGTCCAATATTCTGGTATGCTCCTGAATCTCTGACAGAAAGCAAATTTTCTGTAGCATCAGATGTGTGGAGTTTTGGAGTTGTTCTCTATGAGTTGTTCACCTACAGTGAGAAGAGCAAAAGCCCACCTTCGGAGTTCATGAGAATGATTGGAAATGATAAACAAGGACAGATGATTGTATTTCATTTGATAGAACTGCTAAAAAATAAAGGAAGACTGCCACAACCTGAAGGCTGCCCTGATGAGATTTATAGGATAATGAATGAATGCTGGAACAACAGCATCAGTCAGCGTCCCTCATTTAAAGAGCTCACCATTCAAGTTGAGAAGGCAAAGGAAATCATGGGAGCATGAGCCTTGTGAGATGTCATTTCCATGGAAGAGTCAGCTTATGGTCACAACCCCTTCTGTGCCAAAGGCATGTGGAGTGTCAGGTTTCAGGTGCCTCCAGGGGAGAAATCCTAAATGCATTGTACAGTATTTGCTACGACTTAAAGACTGCAAAAGCTATTGTACAATAAAGGAAACTTGAATTTACTTTGGATTACAGACATAAAAAAACTTAATGTATATGCAAGTCTTATTGGCTTTTAAGACTGTAAATGGGCAGATTTTATAAACTAAGCCTTCTTGGAGAGCTAATTGTTTGTTATAACAAGGAAACAGAAGCTACGCAGAAGACTGAGCATTCTATTTTCCTTCTTTTCTTTTTCTGTCATTGTAAAATACATTTTGCCATGGCCAGACAGCATAGACTGAAAGCCTCTTGTTTGGGAAAATCAGTCCTGAACGTTTTCTTAGCAATGCATACAGAATTTGTACAGTTAATGTGAAAGTATGGATTACTTGCCACCAATTTTGTGTTTTAAGGGCTTTTGTTGAACATAGTATATATTGAACATACATAAATTTAAATATATTTTTCATTCTGTGTAAATGTGCAACGGAACAAGAGCAATTTTGGTACTTTTATTAACAAAACTCTGTCAAATATTTTGTATTAAGTCAGTAACTTAAGGAAATCTGTAAACTATGCTTCTAACTTTGTCATGTAAAAAATGCTATGGGATAAAGGGATCAAATATTGACCTCTACTTTCATATTTTCTCAAAGGATCGAGGGGGAGGGATTTTTAAATTGGAAGAAATAAGTAACATCTTTAAGCCTGTTTATTTTTGTTTCTTTTTCTTCATGTCCTACAACTTTTTCCCAGTATATGTACCATACTCTCTATCATTATAATGGCATTAGAAATGGCCTTCTGGCAGGGGATGGATTCATAACACATATGCACAGGGTCACTTTTCCAATATTTGTTCAGTTGAACAGATTTGTGAGTATGCTGTAGAAATCCCAGCAGAATTGTTTTTTTAAAGACTTTTAGAAATGCACCAAATCCATAATTTTTGGGTTAGCTAAATACCTAATTATCCACATACGGATTCCAAACCTAAATTGCAAATTCTAATTTGAAAGAAATAAAAAAAAATTGTATTATCTGTGAACAAAATATGTCACATTCCGTTTCCAGAAGATTAAATTAATGATTTGAATTGTTTCCAAACCCCTTAAAATTTGGCTAATCTGGATCCTGCAAAAAGTGCTGGCATTCGGTCTAATCCCAAACTCCTGGAAATGGTGCATCCATAAAGCCTTTGCAGACGTTGCCTGTTGGAAGGAGAATTGTTTACCAGCCACATGTTCCCAAATACGGGTGCATTTTTCCAGCTTTACTGTTCTCCCTCATTCCTCTTTTTTGCCTCCACTGACATGTTTTTGTTTTCTTTTATTACTTAATCTTATAACAAGGCATTATAACAGTTTTTAATGAACTATTACTGTTGTTCATATACAAGTTTCTCACGTAGATGTTTGGCTATCGCAGCTGCTACATTCTAATCACTGGAGATGGGAGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCCAACAAAAAGTGTGACCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTCTGGATCAAGGGCATGTCTTCAACCCCATCCCCTCCCATCACCTTTTTTTGTTTAAGGGTTTGTTAAAACATTAAAAAGAACATTGTAATGAGAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008225181                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAAATGGATAGAACTCGCAAATTTAATTAACAGCTGTATGGACTATGAACCAGATTTTCGGCCTTCATTCAGGGCGATAATAAGGGACCTTAATAGCTTGTTTACTCCAGACTATGAGTTACTGGCAGAAACTGACTTTCTCCAAAATATGAGAATTGGGGCTTTTGGTTTCTCTGGAGGCTTTGAAGACCGAGATCCTCCTTTTGAAGAAAGACATCTTAAATTCTTGCAGCAACTTGGCAAGGGTAATTTTGGAAGTGTTGAATTGTGCCGCTATGACCCACTACAAGACAATACTGGTGAAGTTGTGGCAGTAAAAAAGCTGCAGCATACCACTGAGGAGTACCTGAGGGACTTTGAACGAGAAATTGAAATCCTTAAATCACTCCAACATGATAACATAGTGAGATACAAGGGAGTGTGTTACAGCGCAGGTCGTCGAAATCTTAGATTGATTATGGAATACTTGCCCTATGGAAGCTTACGAGACTATTTACAAAAGCATAAAGACCGATTGGACTTCAAAAAGCTTTTACAATATTCAAGCCAAATATGCAAGGGAATGGAATATCTTACCATTAAAAGGTACATTCACAGAGATTTGGCAACGAGAAATATTTTAGTCGAGAATGAAAACAGGGTAAAAATAGGGGATTTTGGATTGACTAAAGTACTGCCGCAAGACAAAGAATATTACAAAGTCAAAGAACCTGGTGAAAGTCCAATATTCTGGTATGCTCCTGAATCTCTGACAGAAAGCAAATTTTCTGTAGCATCAGATGTGTGGAGTTTTGGAGTTGTTCTCTATGAGTTGTTCACCTACAGTGAGAAGAGCAAAAGCCCACCTTCGGAGTTCATGAGAATGATTGGAAATGATAAACAAGGACAGATGATTGTATTTCATTTGATAGAACTGCTAAAAAATAAAGGAAGACTGCCACAACCTGAAGGCTGCCCTGATGAGATTTATAGGATAATGAATGAATGCTGGAACAACAGCATCAGTCAGCGTCCCTCATTTAAAGAGCTCACCATTCAAGTTGAGAAGGCAAAGGAAATCATGGGAGCATGAGCCTTGTGAGATGTCATTTCCATGGAAGAGTCAGCTTATGGTCACAACCCCTTCTGTGCCAAAGGCATGTGGAGTGTCAGGTTTCAGGTGCCTCCAGGGGAGAAATCCTAAATGCATTGTACAGTATTTGCTACGACTTAAAGACTGCAAAAGCTATTGTACAATAAAGGAAACTTGAATTTACTTTGGATTACAGACATAAAAAAACTTAATGTATATGCAAGTCTTATTGGCTTTTAAGACTGTAAATGGGCAGATTTTATAAACTAAGCCTTCTTGGAGAGCTAATTGTTTGTTATAACAAGGAAACAGAAGCTACGCAGAAGACTGAGCATTCTATTTTCCTTCTTTTCTTTTTCTGTCATTGTAAAATACATTTTGCCATGGCCAGACAGCATAGACTGAAAGCCTCTTGTTTGGGAAAATCAGTCCTGAACGTTTTCTTAGCAATGCATACAGAATTTGTACAGTTAATGTGAAAGTATGGATTACTTGCCACCAATTTTGTGTTTTAAGGGCTTTTGTTGAACATAGTATATATTGAACATACATAAATTTAAATATATTTTTCATTCTGTGTAAATGTGCAACGGAACAAGAGCAATTTTGGTACTTTTATTAACAAAACTCTGTCAAATATTTTGTATTAAGTCAGTAACTTAAGGAAATCTGTAAACTATGCTTCTAACTTTGTCATGTAAAAAATGCTATGGGATAAAGGGATCAAATATTGACCTCTACTTTCATATTTTCTCAAAGGATCGAGGGGGAGGGATTTTTAAATTGGAAGAAATAAGTAACATCTTTAAGCCTGTTTATTTTTGTTTCTTTTTCTTCATGTCCTACAACTTTTTCCCAGTATATGTACCATACTCTCTATCATTATAATGGCATTAGAAATGGCCTTCTGGCAGGGGATGGATTCATAACACATATGCACAGGGTCACTTTTCCAATATTTGTTCAGTTGAACAGATTTGTGAGTATGCTGTAGAAATCCCAGCAGAATTGTTTTTTTAAAGACTTTTAGAAATGCACCAAATCCATAATTTTTGGGTTAGCTAAATACCTAATTATCCACATACGGATTCCAAACCTAAATTGCAAATTCTAATTTGAAAGAAATAAAAAAAAATTGTATTATCTGTGAACAAAATATGTCACATTCCGTTTCCAGAAGATTAAATTAATGATTTGAATTGTTTCCAAACCCCTTAAAATTTGGCTAATCTGGATCCTGCAAAAAGTGCTGGCATTCGGTCTAATCCCAAACTCCTGGAAATGGTGCATCCATAAAGCCTTTGCAGACGTTGCCTGTTGGAAGGAGAATTGTTTACCAGCCACATGTTCCCAAATACGGGTGCATTTTTCCAGCTTTACTGTTCTCCCTCATTCCTCTTTTTTGCCTCCACTGACATGTTTTTGTTTTCTTTTATTACTTAATCTTATAACAAGGCATTATAACAGTTTTTAATGAACTATTACTGTTGTTCATATACAAGTTTCTCACGTAGATGTTTGGCTATCGCAGCTGCTACATTCTAATCACTGGAGATGGGAGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCCAACAAAAAGTGTGACCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTCTGGATCAAGGGCATGTCTTCAACCCCATCCCCTCCCATCACCTTTTTTTGTTTAAGGGTTTGTTAAAACATTAAAAAGAACATTGTAATGAGAAAAAAAAAAAAAAAxxxxxxxxxCTCGCG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     7     8     8     8     8     8     8     8     8     9     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9    12    12    11    12    12    13    12    13    12    13    12    13    13    14    12    14    13    14    12    13    12    13    12    13    12    13    12    13    12    13    13    14    13    14    13    14    13    15    15    16    15    16    15    16    15    16    15    16    17    18    16    17    16    17    16    16    16    17    15    16    15    16    15    16    15    16    14    16    15    17    17    17    18    18    18    18    18    18    16    18    17    18    17    17    18    18    18    18    18    18    18    18    17    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    17    18    17    18    17    18    17    18    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    17    17    17    17     9    11     7     8     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     6     6     5     6     5     6     5     6     5     6     5     6     4     6     4     6     4     6     3     5     3     4     4     5     4     5     4     5     5     6     4     7     5     7     5     7     6     8     7     8     6     8     6     7     7     8     7     8     7     7     7     7     8    10    12    12    13    13    13    14    13    14    14    14    15    15    18    18    18    18    19    19    20    20    20    20    20    20    20    20    20    20    20    20    19    20    20    20    20    20    20    20    20    20    22    22    23    23    23    23    23    23    23    23    23    23    24    24    24    24    24    24    24    24    23    23    23    23    23    23    18    22    18    22    18    22    18    22    18    22    18    22    18    22    18    22    18    22    18    22    18    22    20    24    20    24    20    24    20    24    20    23    20    23    20    23    20    23    20    23    19    22    19    21    19    21    19    21    19    21    19    21    18    20    19    21    19    21    19    21    19    21    16    20    13    20    12    20     5    14     4     5     2     4
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------T-----
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Sc ---- 4e-025     NP_009411.1 Promotes the exit from mitosis by directly switching on the kinase activity ofDbf2. Required for mitosis and sporulation, cell division cycle blocked at 36C.; Cdc15p [Saccharomyces cerevisiae] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Br ---- 5e-037     AAB50848.1 insulin-like peptide receptor; ILP-R [Branchiostoma lanceolatum] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Cs ---- 4e-038     BAB68344.1 EPH receptor tyrosine kinase [Ciona savignyi] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bb ---- 6e-039     ABD24302.1 fibroblast growth factor receptor [Branchiostoma belcheri] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ce ---- 2e-039     NP_509779.2 related to oncogene ABL (abl-1) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 3e-041     NP_476758.1 CG10079-PA, isoform A [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bf ---- 6e-044     AAX94285.1 neurotrophic tyrosine kinase receptor precursor [Branchiostoma floridae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Sp ---- 1e-042     XP_788233.2 PREDICTED: similar to tyrosine kinase, partial [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 8e-055     BAE06524.1 Janus kinase [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 1e-152     NP_571168.1 Janus kinase 2a [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 7e-179     AAH73280.1 LOC443637 protein [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 0          NP_001025709.1 Janus kinase 2 (a protein tyrosine kinase) [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_004963.1 Janus kinase 2; tyrosine-protein kinase JAK2 [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_001041642.1 Janus kinase 2 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 0          AAI25683.1 Unknown (protein for MGC:145403) [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 0          NP_001090634.1 Janus kinase 2 (a protein tyrosine kinase) [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAM5871.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATG------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------TGA------TGA------------ATG------------------------------------------ATG---------------------------------------TAAATG------------------------TAA------------------------------------------------------------------------------------------------TAA---------------------------TAA---------------TAA------------------------------------------------------------------------------------------------------------------TGA---------------------------TGA---------TAG------------------------TAA---------ATG---------------------------------------TGA---TAG---------------------------------------------TAAATG---------------------------------------------------------------------------TAA---------TAA---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------TAA------TAG------------------------------------------------------------------------------------------------------------------------TAA------------ATG---------------------------TAA---------------------------------------------------TGA------TAA------------------------------------------------------TAA------------------------------TAA---------------------------------------------------------------ATG---------TAA------------------------------------------------ATG---------------------------------------------------------------------ATG---------------------TAA------------------TAA---------ATG------------------------------------------------------------------TAA---------ATG---------------------TAG---------------------------------------------------------------------------------------------------------------------------------------ATG------TAG---------------TGA---------------TAA---------------------------TGA---------------------------------------------TAA---------TAG------------------------------------------------------------------------------------------ATG---ATG---------------------------TAA------------------ATG------------------------------------------------TGA---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------TAA------------------------------TAATGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  5   1   2       bld Ski1      in                         CABJ8502.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAACCACTTACTGCTCTTGATAGCCAAAGAAAATTACAGTTTTATGAAGATAGACATCAACTTCCAGCACCAAAATGGATAGAACTCGCAAATTTAATTAACAGCTGTATGGACTATGAACCAGATTTTCGGCCTTCATTCAGGGCGATAATAAGGGACCTTAATAGCTTGTTTACTCCAGACTATGAGTTACTGGCAGAAACTGACTTTCTCCAAAATATGAGAATTGGGGCTTTTGGTTTCTCTGGAGGCTTTGAAGACCGAGATCCTCCTTTTGAAGAAAGACATCTTAAATTCTTGCAGCAACTTGGCAAGGGTAATTTTGGAAGTGTTGAATTGTGCCGCTATGACCCACTACAAGACAATACTGGTGAAGTTGTGGCAGTAAAAAAGCTGCAGCATACCACTGAGGAGTACCTGAGGGACTTTGAACGAGAAATTGAAATCCTTAAATCACTCCAACATGATAACATAGTGAGATACAAGGGAGTGTGTTACAGCGCAGGTCGTCGAAATCTTAGATTGATTATGGAATACTTGCCCTATGGAAGCTTACGAGACTATTTACAAAAGCATAAAGACCGATTGGACTTCAAAAAGCTTTTACAATATTCAAGCCAAATATGCAAGGGAATGGAATATCTTACCATTAAAAGGTACATTCACAGAGATTTGGCAACGAGAAATATTTTAGTCGAGAATGAAAACAGGGTAAAAATAGGGGATTTTGGATTGACTAAAGTACTGCCGCAAGACAAAGAATATTACAAAGTCAAAGAACCTGGTGAAAGTCCAATATTCTGGTATGCTCCTGAATCTCTGACAGAAAGCANATTTTCTGTAGCATCAGATGTGTGGA
  5   1   2       bld Spl1      in                         CABK4920.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCACCAAAATGGATAGAACTCGCAAATTTAATTAACAGCTGTATGGACTATGAACCAGATTTTCGGCCTTCATTCAGGGCGATAATAAGGGACCTTAATAGCTTGTTTACTCCAGACTATGAGTTACTGGCAGAAACTGACTTTCTCCAAAATATGAGAATTGGGGCTTTTGGTTTCTCTGGAGGCTTTGAAGACCGAGATCCTCCTTTTGAAGAAAGACATCTTAAATTCTTGCAGCAACTTGGCAAGGGTAATTTTGGAAGTGTTGAATTGTGCCGCTATGACCCACTACAAGACAATACTGGTGAAGTTGTGGCAGTAAAAAAGCTGCAGCATACCACTGAGGAGTACCTGAGGGACTTTGAACGAGAAATTGAAATCCTTAAATCACTCCAACATGATAACATAGTGAGATACAAGGGAGTGTGTTACAGCGCAGGTCGTCGAAATCTTAGATTGATTATGGAATACTTGCCCTATGGAAGCTTACGAGACTATTTACAAAAGCATAAAGACCGATTGGACTTCAAAAAGCTTTTACAATATTCAAGCCAAATATGCAAGGGAATGGAATATCTTACCATTAAAAGGTACATTCACAGAGATTTGGCAACGAGAAATATTTTAGTCGAGAATGAAAACAGGGTAAAAATAGGGGATTTTGGATTGACTAAAGTACTGCCGCAAGACAAAGAATATTACAAAGTCAAAGAACCTGGTGAAAGTCCAATATTCTGGTATGCTCCTGAATCTCTGACAGANAGCAAATTTTCTGTAGCATCAGATGTGTGGAGTTTTGGAGTTGTTCTCTATGAGTTGTTCACCTACAGTGAGAAGAGCAAAAGCCCACC
  5   1   2       bld Limb      in                        CBSU8082.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACAATACTGGTGAAGTTGTGGCAGTAAAAAAGCTGCAGCATACCACTGAGGAGTACCTGAGGGACTTTGAACGAGAAATTGAAATCCTTAAATCACTCCAACATGATAACATAGTGAGATACAAGGGAGTGTGTTACAGTGCAGGTCGTCGAAATCTTAGATTGATTATGGAATACTTGCCCTATGGAAGCTTACGAGACTATTTACAAAAGCATAAAGACCGATTGGACTTCAAAAAGCTTTTACAATATTCAAGCCAAATATGCAAGGGAATGGAATATCTTACCATTAAAAGGTACATTCACAGAGATTTGGCAACGAGAAATATTTTAGTCGAGAATGAAAACAGGGTAAAAATAGGGGATTTTGGATTGACTAAAGTACTGCCGCAAGACAAAGAATATTACAAAGTCAAAGAACCTGGTGAAAGTCCAATATTCTGGTATGCTCCTGAATCTCTGACAGAAAGCAAATTTTCTGTAGCATCAGATGTGTGGAGTTTTGGAGTTGTTCTCTATGAGTTGTTCACCTACAGTGAGAAGAGCAAAAGCCCACCTTCGGAGTTCATGAGAATGATTGGAAATGATAAACAAGGACAGATGATTGTATTTCATTTGATAGAACTGCTAAAAAATAAAGGAAGACTGCCACAACCTGAAGGCTGCCCTGATGAGATTTATAGGATAATGAATGAATGCTGGAACAACAGCATCAGTCAGCGTCCCTCATTTAAAGAGCTCACCATTCAAGTTGAGAAGGCAAAGGAAATCATGGG
  5   1   2       bld Hrt1      out                        CAAQ2493.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGAAATCTTAGATTGATTATGGAATACTTGCCCTATGGAAGCTTACGAGACTATTTACAAAAGCATAAAGACCGATTGGACTTCAAAAAGCTTTTACAATATTCAAGCCAAATATGCAAGGGAATGGAATATCTTACCATTAAAAGGTACATTCACAGAGATTTGGCAACGAGAAATATTTTAGTCGAGAATGAAAACAGGGTAAAAATAGGGGATTTTGGATTGACTAAAGTACTGCCGCAAGACAAAGAATATTACAAAGTCAAAGAACCTGGTGAAAGTCCAATATTCTGGTATGCTCCTGAATCTCTGACAGAAAGCAAATTTTCTGTAGCATCAGATGTGTGGAGTTTTGGAGTTGTTCTCTATGAGTTGTTCACCTACAGTGAGAAGAGCAAAAGCCCACCTTCGGAGTTCATGAGAATGATTGGAAATGATAAACAAGGACAGATGATTGTATTTCATTTGATAGAACTGCTAAAAAATAAAGGAAGACTGCCACAACCTGAAGGCTGCCCTGATGAGGTATGGATTCATGTACAAGCACAAGAGTAAAGTGCAAAATTGTCCTTGTGTCTAGTTTCTATAAACACACCTCTATCCTTCGGCCAAAATGCTAGATTTCTTAGTAAGGTACAGACAGCTGGGAGCAGTGAAACAAGAGTTGAAAAGGTGCAAGGTCCAGGTCTTTATTTTTTTTTTTTTTTGCATGATGCCCCTAAAAAAACACAATTCACTTGCACCTGATGAATCAGCAAAACATAAACACAATATGAATGCCAATTAGCATTTGCATTAGCTAATTGTGTGCATTGTGGAAAAGACATGACATATGACATTTTGCAAT
  5   1   2       bld TbA       in                   TTbA079e13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGAGACTATTTACAAAAGCATAAAGACCGATTGGACTTCAAAAAGCTTTTACAATATTCAAGCCAAATATGCAAGGGAATGGAATATCTTACCATTAAAAGGTACATTCACAGAGATTTGGCAACGAGAAATATTTTAGTCGAGAATGAAAACAGGGTAAAAATAGGGGATTTTGGATTGACTAAAGTACTGCCGCAAGACAAAGAATATTACAAAGTCAAAGAACCTGGTGAAAGTCCAATATTCTGGTATGCTCCTGAATCTCTGACAGAAAGCAAATTTTCTGTAGCATCAGATGTGTGGAGTTTTGGAGTTGTTCTCTATGAGTTGTTCACCTACAGTGAGAAGAGCAAAAGCCCACCTTCGGAGTTCATGAGAATGATTGGAAATGATAAACAAGGACAGATGATTGTATTTCATTTGATAGAACTGCTAAAAAATAAAGGAAGACTGCCACAACCTGAAGGCTGCCCTGATGAGATTTATAGGATAATGAATGAATGCTGGAACAACAGCATCAGTCAGCGTCCCTCATTTAAAGAGCTCACCATTCAAGTTGAGAAGGCAAAGGAAATCATGGGAGCATGAGCCTTGTGAGATGTCATTTCCATGGAAGAGTCAGCTTATGGTCACAACCCCTTCTGTGCCAAAGGCATGTGGAGTGTCAGGTTTCAGGTGCCTCCAGGGGAGAAATCCTAAATGCATTGTACAGTATTTGCTACGACTTANAGACTGCAAAAGCTATTGTACAATANAGGAAACTTGAATTTACTTTGGATTACAGACATAAAAAAACTTAATGTATATGCAAGTCTTATTGGC
  3   1   2       bld Te3  5g3  out                       CAAM10255.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGACTATTTACAAAAGCATAAAGACCGATTGGACTTCAAAAAGCTTTTACAATATTCAAGCCAAATATGCAAGGGAATGGAATATCTTACCATTAAAAGGTACATTCACAGAGATTTGGCAACGAGAAATATTTTAGTCGAGAATGAAAACAGGGTAAAAATAGGGGATTTTGGATTGACTAAAGTACTGCCGCAAGACAAAGAATATTACAAAGTCAAAGAACCTGGTGAAAGTCCAATATTCTGGTATGCTCCTGAATCTCTGACAGAAAGCAAATTTTCTGTAGCATCAGATGTGTGGAGTTTTGGAGTTGTTCTCTATGAGTTGTTCACCTACAGTGAGAAGAGCAAAAGCCCACCTTCGGAGTTCATGAGAATGATTGGAAATGATAAACAAGGACAGATGATTGTATTTCATTTGATAGAACTGCTAAAAAATAAAGGAAGACTGCCACAACCTGAAGGCTGCCCTGATGAGATTTATAGGATAATGAATGAATGCTGGAACAACAGCATCAGTCAGCGTCCCTCATTTAAAGAGCTCACCATTCAAGTTGAGAAGGCAAAGGAAATCATGGGAGCATGAGCCTTGTGAGATGTCATTTCCATGGAAGAGTCAGCTTATGGTCACAACCCCTTCTGTGCCAAAGGCATGTGGAGTGTCAGGTTTCAGGTGCCTCCAGGGGAGAAATCCTAAATGCATTGTACAGTATTTGCTACGACTTAAAGACTGCAAAAGCTATTGTACAATAAAGGAAACTTGAATTT
  5   1   2       bld Spl2                                CBSS3752.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATATTACAAAGTCAAAGAACCTGGTGAAAGTCCAATATTCTGGTATGCTCCTGAATCTCTGACAGAAAGCAAATTTTCTGTAGCATCAGATGTGTGGAGTTTTGGAGTTGTTCTCTATGAGTTGTTCACCTACAGTGAGAAGAGCAAAAGCCCACCTTCGGAGTTCATGAGAATGATTGGAAATGATAAACAAGGACAGATGATTGTATTTCATTTGATAGAACTGCTAAAAAATAAAGGAAGACTGCCACAACCTGAAGGCTGCCCTGATGAGATTTATAGGATAATGAATGAATGCTGGAACAACAGCATCAGTCAGCGTCCCTCATTTAAAGAGCTCACCATTCAAGTTGAGAAGGCAAAGGAAATCATGGGAGCATGAGCCTTGTGAGATGTCATTTCCATGGAAGAGTCAGCTTATGGTCACAACCCCTTCTGTGCCAAAGGCATGTGGAGTGTCAGGTTTCAGGTGCCTCCAGGGGAGAAATCCTAAATGCATTGTACAGTATTTGCTACGACTTAAAGACTGCAAAAGCTATTGTACAATAAAGGAAACTTGAATTTACTTTGGATTACAGACATAAAAAAACTTAATGTATATGCAAGTCTTATTGGCTTTTAAGACTGTAAATGGGCAGATTTTATAAACTAAGCCTTCTTGGAGAGCTAATTGTTTGTTATAACAAGGAAACAGAAGCTACGCAGAAGACTGAGCATTCTATTTTCCTTCTTTTCTTTTTCTGTCATTGTAAAATACATTTTGC
  5   1   2       bld Tad5      in                         XZT10153.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATATTCTGGTATGCTCCTGAATCTCTGACAGAAAGCAAATTTTCTGTAGCATCAGATGTGTGGAGTTTTGGAGTTGTTCTCTATGAGTTGTTCACCTACAGTGAGAAGAGCAAAAGCCCACCTTCGGAGTTCATGAGAATGATTGGAAATGATAAACAAGGACAGATGATTGTATTTCATTTGATAGAACTGCTAAAAAATAAAGGAAGACTGCCACAACCTGAAGGCTGCCCTGATGAGATTTATAGGATAATGAATGAATGCTGGAACAACAGCATCAGTCAGCGTCCCTCATTTAAAGAGCTCACCATTCAAGTTGAGAAGGCAAAGGAAATCATGGGAGCATGAGCCTTGTGAGATGTCATTTCCATGGAAGAGTCAGCTTATGGTCACAACCCCTTCTGTGCCAAAGGCATGTGGAGTGTCAGGTTTCAGGTGCCTCCAGGGGAGAAATCCTAAATGCATTGTACAGTATTTGCTACGACTTAAAGACTGCAAAAGCTATTGTACAATAAAGGAAACTTGAATTTACTTTGGATTACAGACATAAAAAAACTTAATGTATATGCAAGTCTTATTGGCTTTTAAGACTGTAAATGGGCAGATTTTATAAACTAAGCCTTCTTGGGGAGCTAATTGTTTGTTATAACAAGGAAACAGAAGCTACGCAGAAGACTGAGCATTCTATTTTCCTTCTTTTCTTTTTCTGTCATTGTAANATACATTTTGCCATGGCCAGACAGCATAGACTGAAAGCCTCTTGTTT
  5   1   2       bld Ovi1      in                        CABI10232.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAATTCGGCACGAGGGTTCTCTATGAGTTGTTCACCTACAGTGAGAAGAGCAAAAGCCCACCTTCGGAGTTCATGAGAATGATTGGAAATGATAAACAAGGACAGATGATTGTATTTCATTTGATAGAACTGCTAAAAAATAAAGGAAGACTGCCACAACCTGAAGGCTGCCCTGATGAGATTTATAGGATAATGAATGAATGCTGGAACAACAGCATCAGTCAGCGTCCCTCATTTAAAGAGCTCACCATTCAAGTTGAGAAGGCAAAGGAAATCATGGGAGCATGAGCCTTGTGAGATGTCATTTCCATGGAAGAGTCAGCTTATGGTCACAACCCCTTCTGTGCCAAAGGCATGTGGAGTGTCAGGTTTCAGGTGCCTCCAGGGGAGAAATCCTAAATGCATTGTACAGTATTTGCTACGACTTAAAGACTGCAAAAGCTATTGTACAATAAAGGAAACTTGAATTTACTTTGGATTACAGACATAAAAAAACTTAATGTATATGCAAGTCTTATTGGCTTTTAAGACTGTAAATGGGCAGATTTTATAAACTAAGCCTTCTTGGAGAGCTAATTGTTTGTTATAACAAGGAAACAGAAGCTACGCAGAAGACTGAGCATTCTATTTTCCTTCTTTTCTTTTTCTGTCATTGTAAAATACATTTTGCCATGGCCAGACAGCATAGACTGAAAGCCTCTTGTTTGGGAAAATCAGTCCTGAACGTTTTCTTAGCAATGCATACAGAATTTGTACAGTTAATGTGAAAGTATGGATTACTTGCCACCAATTTTGTGTTTTAAGGGCTTTTGTTGAACATAGTATATATTGAACATACATAAATTTAAATATATTTTTCATT
  5   1   2       bld Lun1      in                         CABD2958.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATCGATTCATTCGGCACGAGGCTTCGGAGTTCATGAGAATGATTGGAAATGATAAACAAGGACAGATGATTGTATTTCATTTGATAGAACTGCTAAAAAATAAAGGAAGACTGCCACAACCTGAAGGCTGCCCTGATGAGATTTATAGGATAATGAATGAATGCTGGAACAACAGCATCAGTCAGCGTCCCTCATTTAAAGAGCTCACCATTCAAGTTGAGAAGGCAAAGGAAATCATGGGAGCATGAGCCTTGTGAGATGTCATTTCCATGGAAGAGTCAGCTTATGGTCACAACCCCTTCTGTGCCAAAGGCATGTGGAGTGTCAGGTTTCAGGTGCCTCCAGGGGAGAAATCCTAAATGCATTGTACAGTATTTGCTACGACTTAAAGACTGCAAAAGCTATTGTACAATAAAGGAAACTTGAATTTACTTTGGATTACAGACATAAAAAAACTTAATGTATATGCAAGTCTTATTGGCTTTTAAGACTGTAAATGGGCAGATTTTATAAACTAAGCCTTCTTGGAGAGCTAATTGTTTGTTATAACAAGGAAACAGAAGCTACGCAGAAGACTGAGCATTCTATTTTCCTTCTTTTCTTTTTCTGTCATTGTAAAATACATTTTGCCATGGCCAGACAGCATAGACTGAAAGCCTCTTGTTTGGGAAAATCAGTCCTGAACGTTTTCTTAGCAATGCATACAGAATTTGTACAGTTAATGTGAAAGTATGGATTACTTGCCACCAATTTTGTGTTTTAAGGGCTTTTGTTGAACATAGTATATATTGAACATACATAAATTTAAATATATTTTTCATTCTGTGTAAATGTGCAA
  5   1   2       bld Fat1      in                         CABC2282.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCATTTGATAGAACTGCTAAAAAATAAAGGAAGACTGCCACAACCTGAAGGCTGCCCTGATGAGATTTATAGGATAATGAATGAATGCTGGAACAACAGCATCAGTCAGCGTCCCTCATTTAAAGAGCTCACCATTCAAGTTGAGAAGGCAAAGGAAATCATGGGAGCATGAGCCTTGTGAGATGTCATTTCCATGGAAGAGTCAGCTTATGGTCACAACCCCTTCTGTGCCAAAGGCATGTGGAGTGTCAGGTTTCAGGTGCCTCCAGGGGAGAAATCCTAAATGCATTGTACAGTATTTGCTACGACTTAAAGACTGCAAAAGCTATTGTACAATAAAGGAAACTTGAATTTACTTTGGATTACAGACATAAAAAAACTTAATGTATATGCAAGTCTTATTGGCTTTTAAGACTGTAAATGGGCAGATTTTATAAACTAAGCCTTCTTGGAGAGCTAATTGTTTGTTATAACAAGGAAACAGAAGCTACGCAGAAGACTGAGCATTCTATTTTCCTTCTTTTCTTTTTCTGTCATTGTAAAATACATTTTGCCATGGCCAGACAGCATAGACTGAAAGCCTCTTGTTTGGGAAAATCAGTCCTGAACGTTTTCTTAGCAATGCATACAGAATTTGTACAGTTAATGTGAAAGTATGGATTACTTGCCACCAATTTTGTGTTTTAAGGGCTTTTGTTGAACATAGTATATATTGAACATACATAAATTTAAATATATTTTTCATTCTGTGTAAATGTGCAACGGAACAAGAGCAATTTTGGTACTTTTATTAACAAAACTCTGTCAAATATTTTGTATTAAGTCAGTAACTTAAGGAAATCTGTAAACTATGCTTCTAACTTTGTCATGTAAAAAATGCTATGGGATAAAGGGATCAAAT
  3   1   2       bld Liv1 PIPE out                        CAAR2642.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAAGGCTGCCCTGATGAGATTTATAGGATAATGAATGAATGCTGGAACAACAGCATCAGTCAGCGTCCCTCATTTAAAGAGCTCACCATTCAAGTTGAGAAGGCAAAGGAAATCATGGGAGCATGAGCCTTGTGAGATGTCATTTCCATGGAAGAGTCAGCTTATGGTCACAACCCCTTCTGTGCCAAAGGCATGTGGAGTGTCAGGTTTCAGGTGCCTCCAGGGGAGAAATCCTAAATGCATTGTACAGTATTTGCTACGACTTAAAGACTGCAAAAGCTATTGTACAATAAAGGAAACTTGAATTTACTTTGGATTACAGACATAAAAAAACTTAATGTATATGCAAGTCTTATTGGCTTTTAAGACTGTAAATGGGCAGATTTTATAAACTAAGCCTTCTTGGAGAGCTAATTGTTTGTTATAACAAGGAAACAGAAGCTACGCAGAAGACTGAGCATTCTATTTTCCTTCTTTTCTTTTTCTGTCATTGTAAAATACATTTTGCCATGGCCAGACAGCATAGACTGAAAGCCTCTTGTTTGGGAAAATCAGTCCTGAACGTTTTCTTAGCAATGCATACAGAATTTGTACAGTTAATGTGAAAGTATGGATTACTTGCCACCAATTTTGTGTTTTAAGGGCTTTTGTTGAACATAGTATATATTGAACATACATAAATTTAAATATATTTTTCATTCTGTGTAAATGTGCAACGGAACAAGAGCAATTTTGGTACTTTTATTAACAAAACTCTGTCAAATATTTTGTATTAAGTCAGTAACTTAAGGAAATCTGTAAACTATGCTTCTAACTTTGTCATGTAAAAAATGCTATGGGATAAAGGGATCAAATATG
  3   1   2       bld Fat1      in                         CABC2282.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCTGCCCTGATGAGATTTATAGGATAATGAATGAATGCTGGAACACNAGCATCAGTCAGCGTCCCTCATTTAAAGAGCTCACCATTCAAGTTGAGAAGGCAAAGGAAATCATGGGAGCATGAGCCTTGTGAGATGTCATTTCCATGGAAGAGTCAGCTTATGGTCACAACCCCTTCTGTGCCAAAGGCATGTGGAGTGTCAGGTTTCAGGTGCCTCCAGGGGAGAAATCCTAAATGCATTGTACAGTATTTGCTACGACTTAAAGACTGCAAAAGCTATTGTACAATAAAGGAAACTTGAATTTACTTTGGATTACAGACATAAAAAAACTTAATGTATATGCAAGTCTTATTGGCTTTTAAGACTGTAAATGGGCAGATTTTATAAACTAAGCCTTCTTGGAGAGCTAATTGTTTGTTATAACAAGGAAACAGAAGCTACGCAGAAGACTGAGCATTCTATTTTCCTTCTTTTCTTTTTCTGTCATTGTAAAATACATTTTGCCATGGCCAGACAGCATAGACTGAAAGCCTCTTGTTTGGGAAAATCAGTCCTGAACGTTTTCTTAGCAATGCATACAGAATTTGTACAGTTAATGTGAAAGTATGGATTACTTGCCACCAATTTTGTGTTTTAAGGGCTTTTGTTGAACATAGTATATATTGAACATACATAAATTTAAATATATTTTTCATTCTGTGTAAATGTGCAACGGAACAAGAGCAATTTTGGTACTTTTATTAACAAAACTCTGTCAAATATTTTGTATTAAGTCAGTAACTTAAGGAAATCTGTAAACTATGCTTCTAACTTTGTCATGTAAAAAATGCTATGGGATAAAGGGATCAAATATG
  3   1   2       bld Ovi1      in                        CABI10232.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCCCTGATGAGATTTATAGGATAATGAATGAATGCTGGAACAACAGCATCAGTCAGCGTCCCTCATTTAAAGAGCTCACCATTCAAGTGAGAAAGGCAAAGGAAATCATGGGAGCATGAGCCTTGTGAGATGTCATTTCCATGGAAGAGTCAGCTTATGGTCACAACCCCTTCTGTGCCAAAGGCATGTGGAGTGTCAGGTTTCAGGTGCCTCCAGGGGAGAAATCCTAAATGCATTGTACAGTATTTGCTACGACTTAAAGACTGCAAAAGCTATTGTACAATAAAGGAAACTTGAATTTACTTTGGATTACAGACATAAAAAAACTTAATGTATATGCAAGTCTTATTGGCTTTTAAGACTGTAAATGGGCAGATTTTATAAACTAAGCCTTCTTGGAGAGCTAATTGTTTGTTATAACAAGGAAACAGAAGCTACGCAGAAGACTGAGCATTCTATTTTCCTTCTTTTCTTTTTCTGTCATTGTAAAATACATTTTGCCATGGCCAGACAGCATAGACTGAAAGCCTCTTGTTTGGGAAAATCAGTCCTGAACGTTTTCTTAGCAATGCATACAGAATTTGTACAGTTAATGTGAAAGTATGGATTACTTGCCACCAATTTTGTGTTTTAAGGGCTTTTGTTGAACATAGTATATATTGAACATACATAAATTTAAATATATTTTTCATTCTGTGTAAATGTGCAACGGAACAAGAGCAATTTTGGTACTTTTATTAACAAAACTCTGTCAAATATTTTGTATTAAGTCAGTAACTTAAGGAAATCTGTAAACTATGCTTCTAACTTTGTCATGTAAAAAATGCTATGGGATAAAGGGATCAAATATG
  3   1   2       bld TbA       in                    TTbA079e13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATAATGAATGAATGCTGGAACAACAGCATCAGTCAGCGTCCCTCATTTAAAGAGCTCACCATTCAAGTTGAGAAGGCAAAGGAAATCATGGGAGCATGAGCCTTGTGAGATGTCATTTCCATGGAAGAGTCAGCTTATGGTCACAACCCCTTCTGTGCCAAAGGCATGTGGAGTGTCAGGTTTCAGGTGCCTCCAGGGGAGAAATCCTAAATGCATTGTACAGTATTTGCTACGACTTAAAGACTGCAAAAGCTATTGTACAATAAAGGAAACTTGAATTTACTTTGGATTACAGACATAAAAAAACTTAATGTATATGCAAGTCTTATTGGCTTTTAAGACTGTAAATGGGCAGATTTTATAAACTAAGCCTTCTTGGGGAGCTAATTGTTTGTTATAACAAGGAAACAGAAGCTACGCAGAAGACTGAGCATTCTATTTTCCTTCTTTTCTTTTTCTGTCATTGTAAAATACATTTTGCCATGGCCAGACAGCATAGACTGAAAGCCTCTTGTTTGGGAAAATCAGTCCTGAACGTTTTTTTAGCAATGCATACAGAATTTGTACAGTTAATGTGAAAGTATGGATTACTTGCCACCAATTTTGTGTTTTAAGGGCTTTTGTTGAACATAGTATATATTGAACATACATAAATTTAAATATATTTTTCATTCTGTGTAAATGTGCAACGGAACAAGAGCAATTTTGGTACTTTTATTAACAAAACTCTGTCAAATATTTTGTATTAAGTCAGTAACTTAAGGAAATCTGTAAACTATGCTTCTAACTTTGTCATGTAAAAAATGCTATGGGATAAAGGGATCAAATATGAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Spl2 5g3  out                       CBSS2233.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGCTCACCATTCAAGTTGAGAAGGCAAAGGAAATCATGGGAGCATGAGCCTTGTGAGATGTCATTTCCATGGAAGAGTCAGCTTATGGTCACAACCCCTTCTGTGCCAAAGGCATGTGGAGTGTCAGGTTTCAGGTGCCTCCAGGGGAGAAATCCTAAATGCATTGTACAGTATTTGCTACGACTTAAAGACTGCAAAAGCTATTGTACAATAAAGGAAACTTGAATTTACTTTGGATTACAGACATAAAAAAACTTAATGTATATGCAAGTCTTATTGGCTTTTAAGACTGTAAATGGGCAGATTTTATAAACTAAGCCTTCTTGGAGAGCTAATTGTTTGTTATAACAAGGAAACAGAAGCTACGCAGAAGACTGAGCATTCTATTTTCCTTCTTTTCTTTTTCTGTCATTGTAAAATACATTTTGCCATGGCCAGACAGCATAGACTGAAAGCCTCTTGTTTGGGAAAATCAGTCCTGAACGTTTTCTTAGCAATGCATACAGAATTTGTACAGTTAATGTGAAAGTATGGATTACTTGCCACCAATTTTGTGTTTTAAGGGCTTTTGTTGAACATAGTATATATTGAACATACATAAATTTAAATATATTTTTCATTCTGTGTAAATGTGCAACGGAACAAGAGCAATTTTGGTACTTTTATTAACAAAACTCTGTCAAATATTTTGTATTAAGTCAGTAACTTAAGGAAATCTGTAAACTATGCTTCTAACTTTGTCATGTAAAAAATGCTATGGGATAAAGGGATCAAATATTG
  3   1   2       bld Gas7      out                        XZG59657.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGCCAAAGGCATGTGGAGTGTCAGGTTTCAGGTGCCTCCAGGGGAGAAATCCTAAATGCATTGTACAGTATTTGCTACGACTTAAAGACTGCAAAAGCTATTGTACAATAAAGGAAACTTGAATTTACTTTGGATTACAGACATAAAAAAACTTAATGTATATGCAAGTCTTATTGGCTTTTAAGACTGTAAATGGGCAGATTTTATAAACTAAGCCTTCTTGGAGAGCTAATTGTTTGTTATACCAAGGAAACAGAAGCTACGCAGAAGACTGAGCATTCTATTTTCCTTCTTTTCTTTTTCGGTCATTGTAAAATACATTTTGCCATGGCCAGACAGCATAGACTGAAAGCCTCTTGTTTGGGAAAATCAGTCCTGAACGTTTTCTTAGCAATGCATACAGAATTTGTCCAGTTAATGTGAAAGTATGGATTACTTGCCCCCAATTTTGTGTTTTAAGGGCTTTTGTTGAACATAGTATATATTGAACATACATAAATTTAAATATATTTTTCATTCTGGGTAAATGTGCAACGGAACAAGAGCAATTTTGGTACTTTTATTAACAAAACTCTGTCAAATATTTTGTATTAAGTCAGTAACTTAAGGAAATCTGTAAACTATGCTTCTAACTTTGTCATGTAAAAAATGCTATGGGATAAAGGGATCAAATTTTGAAAAAAAAAAAAT
  5   1   2       bld Spl1      in                        CABK10045.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCATCGATTCGCCTAAATGCATTGTACAGTATTTGCTACGACTTAAAGACTGCAAAAGCTATTGTACAATAAAGGAAACTTGAATTTACTTTGGATTACAGACATAAAAAAACTTAATGTATATGCAAGTCTTATTGGCTTTTAAGACTGTAAATGGGCAGATTTTATAAACTAAGCCTTCTTGGAGAGCTAATTGTTTGTTATAACAAGGAAACAGAAGCTACGCAGAAGACTGAGCATTCTATTTTCCTTCTTTTCTTTTTCTGTCATTGTAAAATACATTTTGCCATGGCCAGACAGCATAGACTGAAAGCCTCTTGTTTGGGAAAATCAGTCCTGAACGTTTTCTTAGCAATGCATACAGAATTTGTACAGTTAATGTGAAAGTATGGATTACTTGCCACCAATTTTGTGTTTTAAGGGCTTTTGTTGAACATAGTATATATTGAACATACATAAATTTAAATATATTTTTCATTCTGTGTAAATGTGCAACGGAACAAGAGCAATTTTGGTACTTTTATTAACAAAACTCTGTCAAATATTTTGTATTAAGTCAGTAACTTAAGGAAATCTGTAAACTATGCTTCTAACTTTGTCATGTAAAAAATGCTATGGGATAAAGGGATCAAATATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Spl1      in                        CABK10045.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTAAATGCATTGTACAGTATTTGCTACGACTTAAAGACTGCAAAAGCTATTGTACAATAAAGGAAACTTGAATTTACTTTGGATTACAGACATAAAAAAACTTAATGTATATGCAAGTCTTATTGGCTTTTAAGACTGTAAATGGGCAGATTTTATAAACTAAGCCTTCTTGGAGAGCTAATTGTTTGTTATAACAAGGAAACAGAAGCTACGCAGAAGACTGAGCATTCTATTTTCCTTCTTTTCTTTTTCTGTCATTGTAAAATACATTTTGCCATGGCCAGACAGCATAGACTGAAAGCCTCTTGTTTGGGAAAATCAGTCCTGAACGTTTTCTTAGCAATGCATACAGAATTTGTACAGTTAATGTGAAAGTATGGATTACTTGCCACCAATTTTGTGTTTTAAGGGCTTTTGTTGAACATAGTATATATTGAACATACATAAATTTAAATATATTTTTCATTCTGTGTAAATGTGCAACGGAACAAGAGCAATTTTGGTACTTTTATTAACAAAACTCTGTCAAATATTTTGTATTAAGTCAGTAACTTAAGGAAATCTGTAAACTATGCTTCTAACTTTGTCATGTAAAAAATGCTATGGGATAAAGGGATCAAATAT
  5   1   2       bld Hrt1      in                         CAAQ5338.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGATTCGGGAAACTTGAATTTACTTTGGATTACAGACATAAAAAAACTTAATGTATATGCAAGTCTTATTGGCTTTTAAGACTGTAAATGGGCAGATTTTATAAACTAAGCCTTCTTGGAGAGCTAATTGTTTGTTATAACAAGGAAACAGAAGCTACGCAGAAGACTGAGCATTCTATTTTCCTTCTTTTCTTTTTCTGTCATTGTAAAATACATTTTGCCATGGCCAGACAGCATAGACTGAAAGCCTCTTGTTTGGGAAAATCAGTCCTGAACGTTTTCTTAGCAATGCATACAGAATTTGTACAGTTAATGTGAAAGTATGGATTACTTGCCACCAATTTTGTGTTTTAAGGGCTTTTGTTGAACATAGTATATATTGAACATACATAAATTTAAATATATTTTTCATTCTGTGTAAATGTGCAACGGAACAAGAGCAATTTTGGTACTTTTATTAACAAAACTCTGTCAAATATTTTGTATTAAGTCAGTAACTTAAGGAAATCTGTAAACTATGCTTCTAACTTTGTCATGTAAAAAATGCTATGGGATAAAGGGATCAAATATTGACCTCTACTTTCATATTTTCTCAAAGGATCGAGGGGGAGGGATTTTTAAATTGGAAGAAATAAGTAACATCTTTAAGCCTGTTTATTTTTGTTTCTTTTTCTTCATGTCCTACAACTTTTTCCCAGTATATGTACCATACTCTCTATCATTATAATGGCATTAGAAATGGCCTTCTGGCAGGNGATGGATTCATAACACATATGCACAGGGTCACTTTTCCAATATTTGTTCAGTTGAACAGATTTGTGAGTATGCTGT
  3   1   2       bld HdA                             THdA034j09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATAAAGGAAACTTGAATTTACTTTGGATTACAGACATAAAAAAACTCAATGTATATGCAAGTTTTTTTGGCTTTTAAGACTGTAAATGGGCAGATTTTTTAAACTAAGCCTTTTTGGAGAGGTAATTGTTTGTTATAACAAGGAAACAGAAGCTACGCCGAAGACTGAGCATTCTATTTTCCTTCTTTTCTTTTTCTGTCATTGTAAAATACATTTTGCCATGGCCAGACAGCATAGACTGAAAGCCTCTTGTTTGGGAAAATCAGTCCTGAACGTTTTTTTAGCAATGCATACAGAATTTGTACAGTTAATGTGAAAGTATGGATTACTTGCCACCAATTTTGTGTTTTAAGGGCTTTTGTTGAACATAGTATATATTGAACATACATAAATTTAAATATATTTTTCATTCTGTGTAAATGTGCAACGGAACAAGAGCAATTTTGGTACTTTTATTAACAAAACTCTGTCAAATATTTTGTATTAAGTCAGTAACTTAAGGAAATCTGTAAACTATGCTTCTAACTTTGTCATGTAAAAAAAAATGTGGGATAAAGGGATCAAATTTGGAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Spl1      in                         CABK4920.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACTTAATGTATATGCAAGTCTTATTGGCTTTTAAGACTGTAAATGGGCAGATTTATAAANTAAGCCTTCTGGAGAGCTAATGTTTGTTATAACAGGAAACAGAAGCTACGCAGAAGACTGAGCATTCTATTTTCCTTCTTTTCTTTNTCTGTCATTGTAAAATACATTTTGCCATGGCCAGACAGCATAGACTGAAAGCCTCTTGTTTGGGAAAATCAGTCCTGAACGTTTTCTTAGCAATGCATACAGAATTTGTACAGTTAATGTGAAAGTATGGATTACTTGCCACCAATTTTGTGTTTTAAGGGCTTTTGTTGAACATAGTATATATTGAACATACATAAATTTAAATATATTTTTCATTCTGTGTAAATGTGCAACGGAACAAGAGCAATTTTGGTACTTTTATTAACAAAACTCTGTCAAATATTTTGTATTAAGTCAGTAACTTAAGGAAATCTGTAAACTATGCTTCTAACTTTGTCATGTAAAAAATGCTATGGGATAAAGGGATCAAATATTGACCTCTACTTTCATATTTTCTCAAAGGATCGAGGGGGAGGGATTTTTAAATTGGAAGAAATAAGTAACATCTTTAAGCCTGTTTATTTTTGTTTCTTTTTCTTCATGTCCTACAACTTTTTCCCAGTATATGTACCATACTCTCTATCATTATAATGGCATTAGAAATGGCCTTCTGGCAGGGGATGGATTCATAACACATATGCACAGGGTCACTTTTCCAATATTTGTTCAGTTGAACAGATTTGTGAGTATGCTGTAGAAATCCCAGCAGAATTGTTTTTTTAAAGACTTTTAGAAATGCACCAAATCCATAATTTTTGGGTTAGCTAAATACCTAATTATCCACATACGGATTCCAAACCTAAATTGCAAATTCTAATTTG
  3   1   2       bld TpA                             TTpA013k02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATTGTTTGTATAACAAGGAAACAGAAGCTACGCAGAAGACTGAGCATTCTATTTTCCTTCTTTTCTTTTTCTGTCATTGTAAAATACATTTTGCCATGGCCAGACAGCATAGACTGAAAGCCTCTTGTTTGGGAAAATCAGTCCTGAACGTTTTCTTAGCAATGCATACAGAATTTGTACAGTTAATGTGAAAGTATGGATTACTTGCCACCAATTTTGTGTTTTAAGGGCTTTTGTTGAACATAGTATATATTGAACATACATAAATTTAAATATATTTTTCATTCTGTGTAAATGTGCAACGGAACAAGAGCAATTTTGGTACTTTTATTAACAAAACTCTGTCAAATATTTTGTATTAAGTCAGTAACTTAAGGAAATCTGTAAACTATGCTTCTAACTTTGTCATGTAAAAAATGCTATGGGATAAAGGGATCAAATATTGACCTCTACTTTCATATTTTCTCAAAGGATCGAGGGGGAGGGATTTTTAAATTGGAAGAAATAAGTAACATCTTTAAGCCTGTTTATTTTTGTTTCTTTTTCTTCATGTCCTACAACTTTTTCCCAGTATATGTACCATACTCTCTATCATTATAATGGCATTAGAAATGGCCTTCTGGCAGGGGATGGATTCATAACACATATGCACAGGGTCACTTTTTCAATATTTGTTCAGTTGAACAGATTTGTGAGTATGCTGTAGAAATCCCAGCAGAATTGTTTTTTTAAAGACTTTTAGAAATGCACCAAATCCATAATTTTTGGGTTAGCTAAATACCTAATTATCCACATACGGATTCCAAACCTAAATTGCAAATTCTAATTGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te3  5g3  out                        CAAM5525.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAAACAGAAGCTACGCAGAAGACTGAGCATTCTATTTTCCTTCTTTTCTTTTCTGGTCATGNTAAAATACATTTTGCCATGCCCAGACAGCATAGACTGAAAGCCTCTTGTTTGGGAAAATCAGTCCTGAACGTTTTCTTAGCAATGCATACAGAATTTGTACAGTTAATGTGAAAGTATGGATTACTTGCCACCAATTTTGTGTTTTAAGGGCTTTTGTTGAACATAGTATATATTGAACATACATAAATTTAAATATATTTTTCATTCTGTGTAAATGTGCAACGGAACAAGAGCAATTTTGGTACTTTTATTAACAAAACTCTGTCAAATATTTTGTATTAAGTCAGTAACTTAAGGAAATCTGTAAACTATGCTTCTAACTTTGTCATGTAAAAAATGCTATGGGATAAAGGGATCAAATATTGACCTCTACTTTCATATTTTCTCAAAGGATCGAGGGGGAGGGATTTTTAAATTGGAAGAAATAAGTAACATCTTTAAGCCTGTTTATTTTTGTTTCTTTTTCTTCATGTCCTACAACTTTTTCCCAGTATATGTACCATACTCTCTATCATTATAATGGCATTAGAAATGGCCTTCTGGCAGGGGATGGATTCATAACACATATGCACAGGGTCACTTTTCCAATATTTGTTCAGTTGAACAGATTTGTGAGTATGCTGTAGAAATCCCAGCAGAATTGTTTTTTTAAAGACTTTTAGAAATGCACCAAATCCATAATTTTTGGGTTAGCTAAATACCTAATTATCCACATACGGATTCCAAACCTAAATTGCAAATTCTAATTG
  5   1   2       bld Tad5      in                         XZT46883.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATTTTGCCATGGCCAGACAGCATAGACTGAAAGCCTCTTGTTTGGGAAAATCAGTCCTGAACGTTTTCTTAGCAATGCATACAGAATTTGTACAGTTAATGTGAAAGTATGGATTACTTGCCACCAATTTTGTGTTTTAAGGGCTTTTGTTGAACATAGTATATATTGAACATACATAAATTTAAATATATTTTTCATTCTGTGTAAATGTGCAACGGAACAAGAGCAATTTTGGTACTTTTATTAACAAAACTCTGTCAAATATTTTGTATTAAGTCAGTAACTTAAGGAAATCTGTAAACTATGCTTCTAACTTTGTCATGTAAAAAATGCTATGGGATAAAGGGATCAAATATTGACCTCTACTTTCATATTTTCTCAAAGGATCGAGGGGGAGGGATTTTTAAATTGGAAGAAATAAGTAACATCTTTAAGCCTGTTTATTTTTGTTTCTTTTTCTTCATGTCCTACAACTTTTTCCCAGTATATGTACCATACTCTCTATCATTATAATGGCATTAGAAATGGCCTTCTGGCAGGGGATGGATTCATAACACATATGCACAGGGTCACTTTTCCAATATTTGTTCAGTTGAACAGATTTGTGAGTATGCTGTAGAAATCCCAGCAGAATTGTTTTTTTAAAGACTTTTAGAAATGCACCAAATCCATAATTTTTGGGTTAGCTAAATACCTAATTATCCACATACGGATTCCAAACCTAAATTGCAAATTCTAATTTGAAAGAAATAAAAAAAAATTGTATTATCTGTGAACAANATATGTCACATTCCGTTTCCAGAAGATTAAATTAATGATTGAATTGTTTCCAAACCCTTAAATTTGGCTATCTGGATCTGCAAAAGGCT
  3   1   2       add HdA       out                   THdA034j06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGCCTTTTGTTTGGGAAAATCAGTCCTGAATGTTTTTTTGGCAATGCATACAGAATTTGTACAGTTAATGTGAAAGTTTGGATTACTTGCCACCAATTTTGTGTTTTAAGGGCTTTCGTTGCCCATAGTGTCTATGGGACGGGCCAAAAATGAAAAAGGGTGTTCCTTTGGTGTAAATGGGCA
  5   1   2       bld Te5       in                         CAAO6625.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTTAAATATATTTTTCATTCTGTGTAAATGTGCAACGGAACAAGAGCAATTTTGGTACTTTTATTAACAAAACTCTGTCAAATATTTTGTATTAAGTCAGTAACTTAAGGAAATCTGTAAACTATGCTTCTAACTTTGTCATGTAAAAAATGCTATGGGATAAAGGGATCAAATATTGACCTCTACTTTCATATTTTCTCAAAGGATCGAGGGGGAGGGATTTTTAAATTGGAAGAAATAAGTAACATCTTTAAGCCTGTTTATTTTTGTTTCTTTTTCTTCATGTCCTACAACTTTTTCCCAGTATATGTACCATACTCTCTATCATTATAATGGCATTAGAAATGGCCTTCTGGCAGGGGATGGATTCATAACACATATGCACAGGGTCACTTTTCCAATATTTGTTCAGTTGAACAGATTTGTGAGTATGCTGTAGAAATCCCAGCAGAATTGTTTTTTTAAAGACTTTTAGAAATGCACCAAATCCATAATTTTTGGGTTAGCTAAATACCTAATTATCCACATACGGATTCCAAACCTAAATTGCAAATTCTAATTTGAAAGAAATAAAAAAAAAATTGTATTATCTGTGAACAAAATATGTCACATTCCGTTTCCAGAAGATTAAATTAATGATTTGAATTGTTTCCAAACCCCTTAAAATTTGGCTAATCTGGATCCTGCAAAAAGTGCTGGCATTCGGTCTAATCCCAAACTCCTGGAAATGGTGCATCCATAAAGCCTTTGCAGACGTTGCCTGTTGGAAGGAGAAATGTTTACCAGCCACATGTTCCCCAATACGGGTGCATTTTTCCCAGCTTACTGTTCTCCCCTCATCCTCTTTTTT
  5   1   2       bld Gas7      in                         XZG29356.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATGTAAAAAATGCTATGGGATAAAGGGATCAAATATTGACCTCTACTTTCATATTTTCTCAAAGGATCGAGGGGGAGGGATTTTTAAATTGGAAGAAATAAGTAACATCTTTAAGCCTGTTTATTTTTGTTTCTTTTTCTTCATGTCCTACAACTTTTTCCCAGTATATGTACCATACTCTCTATCATTATAATGGCATTAGAAATGGCCTTCTGGCAGGGGATGGATTCATAACACATATGCACAGGGTCACTTTTCCAATATTTGTTCAGTTGAACAGATTTGTGAGTATGCTGTAGAAATCCCAGCAGAATTGTTTTTTTAAAGACTTTTAGAAATGCACCAAATCCATAATTTTTGGGTTAGCTAAATACCTAATTATCCACATACGGATTCCAAACCTAAATTGCAAATTCTAATTTGAAAGAAATAAAAAAAAATTGTATTATCTGTGAACAAAATATGTCACATTCCGTTTCCAGAAGATTAAATTAATGATTTGAATTGTTTCCAAACCCCTTAAAATTTGGCTAATCTGGATCCTGCAAAAAGTGCTGGCATTCGGTCTAATCCCAAACTCCTGGAAATGGTGCATCCATAAAGCCTTTGCAGACGTTGCCTGTTGGAAGGAGAATTGTTTACCCGCCACATGTTCCCAAATACGGGGGGCATTTTTCCAGCTTT
  5   1   2       bld TbA                            TTbA078n06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGGGGAGGGATTTTTAAATTGGAAGAAATAAGTAACATCTTTAAGCCTGTTTATTTTTGTTTCTTTTTCTTCATGTCCTACAACTTTTTCCCAGTATATGTACCATACTCTCTATCATTATAATGGCATTAGAAATGGCCTTCTGGCAGGGGATGGATTCATAACACATATGCACAGGGTCACTTTTTCAATATTTGTTCAGTTGAACAGATTTGTGAGTATGCTGTAGAAATCCCAGCAGAATTGTTTTTTTAAAGACTTTTAGAAATGCACCAAATCCATAATTTTTGGGTTAGCTAAATACCTAATTATCCACATACGGATTCCAAACCTAAATTGCAAATTCTAATTTGAAAGAAATAAAAAAAAATTGTATTATCTGTGAACAAAATATGTCACATTCCGTTTCCAGAAGATTAAATTAATGATTTGAATTGTTTCCAAACCCCTTAAAATTTGGCTAATCT
  5   1   2       bld Tad5      in                         XZT38200.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGTCCTACAACTTTTTCCCAGTATATGTACCATACTCTCTATCATTATAATGGCATTAGAAATGGCCTTCTGGCAGGGGATGGATTCATAACACATATGCACAGGGTCACTTTTTCAATATTTGTTCAGTTGAACAGATTTGTGAGTATGCTGTAGAAATCCCAGCAGAATTGTTTTTTTAAAGACTTTTAGAAATGCACCAAATCCATAATTTTTGGGTTAGCTAAATACCTAATTATCCACATACGGATTCCAAACCTAAATTGCAAATTCTAATTTGAAAGAAATAAAAAAAAATTGTATTATCTGTGAACAAAATATGTCACATTCCGTTTCCAGAAGATTAAATTAATGATTTGAATTGTTTCCAAACCCCTTAAAATTTGGCTAATCTGGATCCTGCAAAAAGTGCTGGCATTCGGTCTAATCCCAAACTCCTGGAAATGGTGCATCCATAAAGCTTTTGCAGACATTGCCTGTTGGAAGGAGAATTGTTTACCAGCCACATGTTCCCAAATACGGGTGCATTTTTCCAGCTTTACTGTTCTCCCTCATTCCTCTTTTTTGCCTCCACTGACATGTTTTTGTTTTCTTTTATTACTTAATCTTATAACAAGGCATTATAACAGTTTTTAATGAACTATTACTGTTGTTCATATACAAGTTTCTCACGTAGATGTTTGGCTATCGCAGCTGCTACATTCTAATCACTGGAGATGGG
  5   1   2       bld Thy1      ?                         CBST4644.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAATGCACCAAATCCATAATTTTTGGGTTAGCTAAATACCTAATTATCCACATACGGATTCCAAACCTAAATTGCAAATTCTAATTTGAAAGAAATAAAAAAAAATTGTATTATCTGTGAACAAAATATGTCACATTCCGTTTCCAGAAGATTAAATTAATGATTTGAATTGTTTCCAAACCCCTTAAAATTTGGCTAATCTGGATCCTGCAAAAAGTGCTGGCATTCGGTCTAATCCCAAACTCCTGGAAATGGTGCATCCATAAAGCCTTTGCAGACGTTGCCTGTTGGAAGGAGAATTGTTTACCAGCCACATGTTCCCAAATACGGGTGCATTTTTCCAGCTTTACTGTTCTCCCTCATTCCTCTTTTTTGCCTCCACTGACATGTTTTTGTTTTCTTTTATTACTTAATCTTATAACAAGGCATTATAACAGTTTTTAATGAACTATTACTGTTGTTCATATACAAGTTTCTCACGTAGATGTTTGGCTATCGCAGCTGCTACATTCTAATCACTGGAGATGGGAGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCCAACAAAAAGTGTGACCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAG
  5   1   2       bld Spl2      in                        CBSS9970.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAAGTGCTGGCATTCGGTCTAATCCCAAACTCCTGGAAATGGTGCATCCATAAAGCCTTTGCAGACGTTGCCTGTTGGAAGGAGAATTGTTTACCAGCCACATGTTCCCAAATACGGGTGCATTTTTCCAGCTTTACTGTTCTCCCTCATTCCTCTTTTTTGCCTCCACTGACATGTTTTTGTTTTCTTTTATTACTTAATCTTATAACAAGGCATTATAACAGTTTTTAATGAACTATTACTGTTGTTCATATACAAGTTTCTCACGTAGATGTTTGGCTATCGCAGCTGCTACATTCTAATCACTGGAGATGGGAGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCCAACAAAAAGTGTGACCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTACT
  5   1   2       bld Limb      in                        CBSU6844.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGTGCATCCATAAAGCCTTTGCAGAAGTTGCCTGTTGGAAGGAGAATTGTTTACCAGCCACATGTTCCCAAATACGGGTGCATTTTTCCAGCTTTACTGTTCTCCCTCATTCCTCTTTTTTGCCTCCACTGACATGTTTTTGTTTTCTTTTATTACTTAATCTTATAACAAGGCATTATAACAGTTTTTAATGAACTATTACTGTTGTTCATATACAAGTTTCTCACGTAGATGTTTGGCTATCGCAGCTGCTACATTCTAATCACTGGAGATGGGGGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCAAACAAAAGGTGTGACCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGACCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAATGTTTTCTCTAAGTTTTGTGTTGCCGCACAACACACACATGACTCCGGTGCCCACAGAAAATTGAGTGCAAAGGAATTTTTTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATAT
  3   1   2       bld Tad5      in                         XZT46883.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATCCATAAAGCTTTTGCAGACGTTGCCTGTGGAAAGGAGAATTGTTACCAGCCACATGTTCCCAAATACGGGTGCATTTTTCCAGCTTTACTGTTCTCCCTCATTCCTCTTTTTTGCCTCCACTGACATGTTTTTGTTTTCTTTTATTACTTAATCTTATAACAAGGCATTATAACAGTTTTTAATGAACTATTACTGTTGTTCATATACAAGTTTCTCACGTAGATGTTTGGCTATCGCAGCTGCTACATTCTAATCACTGGAGATGGGAGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCCAACAAAAAGTGTGACCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCAC
  5   1   2       bld Limb      in                        CBSU2671.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGTTTACCAGCCACATGGTTCCCAAATACGGGTGCATTTTTCCAGCTTTACTGTTCTCCCTCATTCCTCTTTTTTGCCTCCACTGACATGTTTTTGTTTTCTTTTATTACTTAATCTTATAACAAGGCATTATAACAGTTTTTAATGAACTATTACTGTTGTTCATATACAAGTTTCTCACGTAGATGTTTGGCTATCGCAGCTGCTACATTCTAATCACTGGAGATGGGAGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCCAACAAAAAGTGTGACCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAAT
  5   1   2       bld Ova1      in                         CABE6963.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTTACTGTTCTCCCTCATTCCTCTTTTTTGCCTCCACTGACATGTTTTTGTTTTCTTTTATTACTTAATCTTATAACAAGGCATTATAACAGTTTTTAATGAACTATTACTGTTGTTCATATACAAGTTTCTCACGTAGATGTTTGGCTATCGCAGCTGCTACATTCTAATCACTGGAGATGGGAGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCCAACAAAAAGTGTGACCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTCTGGATCAAGGGCATGTCTTCACCCCCATCCCCTCCCATCACCTTTTTTTGT
  3   1   2       bld Hrt1      in                         CAAQ5338.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTTTCTTTTATACTNNAATCTTATAACAAGGCATTATAACAGTTTTTAATGAACTATTACTGTTGTTCATATACAAGTTTCTCACGTAGATGTTTGGCTATCGCAGCTGCTACATTCTAATCACTGGAGATGGGAGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCCAACAAAAAGTGTGACCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTCTGGATCAAGGGCATGTCTTCAACCCCATCCCCTCCCATCACCTTTTTTTGTTTAAGGGGTTTGTTAAAACATTAAAAAGAACATTG
  3   1   2       bld Te3  5g3  out                        CAAM5871.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCTTTTATTACTTAATCCTATAACAAGGCATTATAACAGTTTTTAATGAACTATTACTGTTGTTCATATACAAGTTTCTCACGTAGATGTTTGGCTATCGCAGCTGCTACATTCTAATCACTGGAGATGGGAGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCCAACAAAAAGTGTGATCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTCTGGATCAAGGGCATGTCTTCAACCCCATCCCCTCCCATCACCTTTTTTTGTTTAAGGGTTTGTTAAAACATTAAAAAGAACCATTGTAATGAG
  3   1   2       bld Lun1      in                         CABD2958.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCTTTTATACTNNAATCTTATAACAAGGCATTATAACAGTTTTTAATGAACTATTACTGTTGTTCATATACAAGTTTCTCACGTAGATGTTTGGCTATCGCAGCTGCTACATTCTAATCACTGGAGATGGGAGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCCAACAAAAAGTGTGACCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTCTGGATCAAGGGCATGTCTTCAACCCCATCCCCTCCCATCACCTTTTTTTGTTTAAGGGTTTGTTAAAACATTAAAAAGAACATTTAATGAG
  3  -1   2      seed Tad5      out                        XZT21464.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTTAATCTTATAACAAGGCATTATAACAGTTTTTAATGAACTATTACTGTTGTTCATATACAAGTTTCTCACGTAGATGTTTGGCTATCGCAGCTGCTACATTCTAATCACTGGAGATGGGAGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCCAACAAAAAGTGTGACCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTG
  3   1   2       bld Ski1      in                         CABJ8502.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTAATCTTATAACAAGGCATTATAACAGTTTTTAATGAACTATTACTGTTGTTCATATACAAGTTTCTCACGTAGATGTTTGGCTATCGCAGCTGCTACATTCTAATCACTGGAGATGGGAGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCCAACAAAAAGTGTGACCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTCTGGATCAAGGGCATGTCTTCAACCCCATCCCCTCCCATCACCTTTTTTTGTTTAAGGGTTTGTTAAAACATTAAAAAGAACATGTAATGAG
  3   1   2       bld Ova1      in                         CABE6963.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTTATAACAAGGCATTATAACAGTTTTTAATGAACTATTACTGTTGTTCATATACAAGTTTCTCACGTAGATGTTTGGCTATCGCAGCTGCTACATTCTAATCACTGGAGATGGGAGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCCAACAAAAAGTGTGACCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTCTGGATCAAGGGCATGTCTTCAACCCCATCCCCTCCCATCACCTTTTTTTGTTTAAGGGTTTGTTAAAACATAAAAAGAACATTGTAATGAGG
  5   1   2       bld TbA                           TTbA012i06.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAGTTTTTAATGAACTATTACTGGTTGTTCATATACAAGTTTCTCACGTAGATGTTTGGCTATCGCAGCTGCTACATTCTAATCACTGGAGATGGGAGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCCAACAAAAAGTGTGACCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTCTGGATCAAGGGCATGTCTTCAACCCCATCCCCTCCCATCACCTTTTTTTGTTTAAGGGTTTGTTAAAACATTAAAAAGAACATTGTAATG
  3   1   2       bld Te5       in                         CAAO6625.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATATACAAGTTTCTCACGTAGATGTTTGGCTATCGCAGCTGCTACATTCTAATCACTGGAGATGGGAGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCCAACAAAAAGTGTGACCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTCTGGATCAAGGGCATGTCTTCAACCCCATCCCCTCCCATCACCTTTTTTTGTTTAAGGGTTTGTTAAAACATTAAAAAGAACATGTAATGGGGG
  3   1   2       bld Limb      in                        CBSU8082.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCTCACGTAGATGTTTGGCTATCGCAGCTGCTACATTCTAATCACTGGAGATGGGGGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCAAACAAAAGGTGTGACCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGACCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAATGTTTTCTCTAAGTTTTGTGTTGCCGCACAACACACACATGACTCCGGTGCCCACAGAAAATTGAGTGCAAAGGAATTTTTTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTCTGGATCAAGGGCATGTCTTCAACCCCATCCCCTCCCATCACCTTTTTTTGTTTAAGNGGTTTGTTAAAACATTAAAAAGAACATGTAAT
  3   1   2       bld Limb      in                        CBSU6844.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACGTAGATGTTTGGCTATCGCAGCTGCTACATTCTAATCACTGGAGATGGGGGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCAAACAAAAGGTGTGACCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGACCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAATGTTTTCTCTAAGTTTTGTGTTGCCGCACAACACACACATGACTCCGGTGCCCACAGAAAATTGAGTGCAAAGGAATTTTTTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTCTGGATCAAGGGCATGTCTTCAACCCCATCCCCTCCCATCACCTTTTTTTGTTTAAGNGGTTTGTTAAAACATTAAAAAGAACATTGTAATGAGGG
  3   1   2       bld Tad5      in                         XZT38200.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTAGATGTTTGGCTATCGCAGCTGCTACATTCTAATCACTGGAGATGGGAGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCCAACAAAAAGTGTGACCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTCTGGATCAAGGGCATGTTTTCAACCCCATCCCCTCCCATCACCTTTTTTTGTTTAAGGGTTTGTTAAAACATTAAAAAGAACATTGTAATGAGGG
  3   1   2       bld Limb      in                        CBSU2671.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGCAGCTGCTACATTCTAATCACTGGAGATGGGAGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCCAACAAAAAGTGTGACCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTCTGGATCAAGGGCATGTCTTCAACCCCATCCCCTCCCATCACCTTTTTTTGTTTAAGGGTTTGTTAAAACATTAAAAAGAACATTGTAATGAG
  3   1   2       bld Gas7      in                         XZG29356.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATCCCTGGAGATGGGAGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCCAACAAAAAGTGTGACCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAAAGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTCTGGATCAAGGGCATGTCTTCAACCCCATCCCCTCCCATCACCTTTTTTTGTTTAAGGGTTTGTTAAAACATTAAAAAGAACATTGTAATGAATAAAAAATTTAAAAAAAAAAAAAAAAACC
  3   1   2       bld Tad5      in                         XZT10153.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATCACTGGAGATGGGAGAGAGGTGGTCGCAAAAGTAGTGCTTTTATCCGAGGACTAACCCATTGCAATCAGCCAACAAAAAGTGTGACCGTGAAACTAAAGAAAACAGTCATTTTTGTTTGCCATGGGTTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTCCTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTCTGGATCAAGGGCATGTCTTCAACCCCATCCCCTCCCATCACCTTTTTTTGGTTTAAGGGTTTGTTAAAACCTTAAAAAGAA
  5   1   2       bld Egg       in                   TEgg056c18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTCTGGATCAAGGGCATGTCTTCAACCCCATCCCCTCCCATCACCTTTTTTGTTTAAGGGTTTGTTAAAACATTAAAAAGAACATTGTAATGAG
  3   1   2       bld Egg       in                    TEgg056c18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTAAAACTCCAGAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTCTGGATCAAGGGCATGTCTTCAACCCCATCCCCTCCCATCACCTTTTTTGTTTAAGGGTTTGTTAAAACATTAAAAGAACATTGTAAGGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Spl2      in                        CBSS9970.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGGACGTTTGTTACCTGTGTGCCCTTTTAAGATGTGTACATAGCAGCAGCATCTTATTTGAGAGCAACGTTTTCTCTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGTGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTCTGGATCAAGGGCATGTCTTCAACCCCATCCCCTCCCATCACCTTTTTTTGTTTAAGGGGTTTGTTAAAACATTAAAAAGAACATTGTAATGAG
  3   1   2       bld Te3  FL   out                        CAAM5540.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGAGAGCAACGTTTTCTTTAAGTTTTGTGTTGCCACACAACACACACATGACACCGGTGCCCACAGAAAATTGAGTGCAAAGGAAATTTTTTTTACTAAGAAGCTGTTTAGCCATCTGTATATGCAGACGCCCTTAATTGTGGAGCACACAGCCTACAAGAAATTAGAGGGAACGTTGTTTTGCAATTAAATAACTATTACATGGGCATGCTGTGTTATTTAGTATGTTTTATTTGTTAAAAAAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGGGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTTTGGATCAAGGGCATGTTTTCAACCCCATCCCCTCCCATCACCTTTTTTTGTTTAAGGGTTTGTTAAAACCTTAAAAAGAACATTGTTATGGGGG
  3  -1   2       bld Brn2      in                        CAAJ14286.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTTTTTTTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTCTGGATCAAGGGCATGTCTTCAACCCCATCCCCTCCCATCACCTTTTTTTGTTTAAGGGTTTGTTAAAACATTAAAAAGAACATTGTAATGAGAAAAAAAAAAAAAAAGGGCGGCCGCTCGCGAT
  5  -1   2       bld Brn2      in                        CAAJ14286.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTTTTTTTTAAAATAGCACTGGAGCTGCAATGCAGGTTTACACAATATCGGATAGTAATGTTTGCAGTTATACTTTATGGTGATTACTTTCTACTAATAAGTATGTTAATGCAACATTCCACAAAATTACTGTTATGTGCGCTTTCTGTAATCTTTACTGCAGAGCTTTGTCACTGGTTGCCCAGAGTGTTTCTGGATCAAGGGCATGTCTTCAACCCCATCCCCTCCCATCACCTTTTTTTGTTTAAGGGTTTGTTAAAACATTAAAAAGAACATTGTAATGAGAAAAAAAAAAAAAAAGGGCGGCCGCTCGCGAT
  5   1   2       bld Int1                                CAAP14854.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCCCAGAGTGTTTCTGGATCAAGGGCATGTCTTCAACCCCATCCCCTCCCATCACCTTTTTTTGTTTAAGGGTTTGTTAAAACATTAAAAAGAACATTTTATTATaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaCCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)