Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     1  89.0    0(repeat)                                    0 REP     86       2156     2361                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012075625 Xt7.1-CABI13057.5 - 39 ESTs
                                                                       ...-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABI13057.5                                                                                                                                                                                                                                                    GAAAACTGGACGCGTTGCAGTAACTGACAGCGAGTGCCTAGTATTTTGTCCCAGCCGGCTCTCCGTGAGGGAGATGGGAGAGAGCGTGTCAAAGCGACTGAGGCTGCAGCTCGGAGGGGAGGCGGAGATGGAGGAACGTGCCTTCCTCAACCCTTTTCCGGACTATCGGCCGCCACAGCCTGCACTCGGCACCGGGGCTGAACAGGAAAATCTGGAAGAAGATGAGGAAGCTCTGGGGGAGCTGGACCTGCCTTTTGACAGGGAAGGGAAGATCAGAAGTAGCTTTTCACGGCGCTTGCAGACAAAAATTAGTGATTTACTTCAGCAAATGGAAGAAGGCCTGAAGACTGCTGACCCACATGACTGCTCTGCTTATACAGGATATACAGGCATAGCCCTGCTGTACCTACAGTTGTACCGTGTTACAAAGGAACAAAGCCACTTGCAACGCTCACTTGACTATGTGAAACGAATCCTTCGGAACCTGAATGGAAGGAGAGTCAGCTTCCTATGTGGTGATGCTGGTCCCCTCGCTGTGAGTGCTGTTGTGCACCACAAGCTGAACAATGAGGCTGAATCAAAGGAATGCATTGCAAAGCTGCTGCAGCTTCAGAGAGGAGTGGTTAGCACAGACACAGACCTTCCAGATGAGTTATTGTATGGTAGAGCTGGCTACCTGTATGCTTTACTCTATGTAAATAATGAGATAAGCCCAGACACAGTACCCCCGGCTTCTATCAAAGAGGTTGTAGATGCCATCATTGAATCTGGGAAAAACTTGTCAAAAGAAGAGCACAAAACAGAACGCTGCCCTCTACTGTACCAATGGCACAAGAAGCAGTATGTTGGGGCAGCACATGGCCTAGCTGGAATCTACTACATGCTTATGCAGCCTTCGTCAAACGTGGATGTAGAAACACTAAGTGACCTGGTAAAGCCATGCATAGACTATGTGCGGCACAAAAAATTCAGGTCTGGCAATTACCCGTCCTCTTTAAGCAATGAAACAGACCGACTGGTGCACTGGTGCCATGGAGCACCTGGCGTTATCCACATGCTTCTCCACGCACACAAAGTTTTTAAAGAAGATAAATACTTGAAAGATGCCGTGGAATGCAGCGAAGTCATCTGGCAAAGAGGCCTCCTGAGAAAGGGCTATGGAATTTGTCACGGTACATCCGGAAATGGATATGCTTTCCTATCGCTCTACAACCACACCCAAGACAAGAAATATCTGTATAGAGCTTGCAGGTTTGCTGAGTGGTGCTTAGAGTATGGAAAACATGGATGCCGCATCCCCGATAGACCATATTCTCTATTTGAAGGAATGGCTGGTGCAATCCACTTCCTTTCCGACATGTTGACACCTGAGACTTCGCGCTTCCCAGCATTTGAACTCTGATCTCTTGGTGGCAGACAGCACAGAGGGATATATTTATGTGCCATTCCGGGAGGCAAGAATTAAAGGCATGCCATTATGCCTAGTGCCTACAACACACTGTGTCAACTCTAAACGTCACCACGTTTGGGTGAATTCTATATTGTGACTTGCAATGAACGTCATTGTACATGTTGGCATACCTTATATAACTTGCCCTGTGATTTCCCCAAGAGGATTAGGTTTCCATGCTTGTTGCACACGCCTTTTCATCCATGTCTATTTGTAACACAGCTACTGCACAAATTGTGTGTACTTGCCTATAGTCTGAGTGGCACAAACAATACAGGATTATCAATTGCTTTTCTTTAGGGTACAGTCATATATCTGTTCATATGGAATACATTTCTGTTTCACTGTTACAGTACAAATGCTTCATCCTGCAATTTTCCATCTTACAGCACTGGAATAGTGACATTCAATTTCCTCAGTAATGGGTCATTAACTTTTGTTAAAAACAAAAGAACCAAATTAAAGGTAAGTAAGGATTTTGTAGAGAAAAATGCAAAGCTAACATTAAATCTGTTTTTCTTTTCCTTTGTTTTTATTGTGTTCTTCATAGCTGCCTGTATCTTAACTTAAGCCAGTGAAAATACTGAATTAGTTCCTAACAAATGTTGTACTTTCACACCCCCAAAAGAATGACTAAGAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAAGACACACGGAGCTACTACCAGCAGCTACTTGTCATGGCTACAGAAATCGGCAATGCTGATCATTTACTGATAATTGCCTCTATGTGTGTTTTAGCAGAGGCAATTCCCAGTATTGTCTATGGCAGGTATTTTCTGGCGTTTAGTAGTCTTTACAAGTAGCTGCTACTAAGTAGCTCAGTGTCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTACAAAAAATGAATAATTCCACTCCTGTTTATAATGACTAAAAGTATTTACATAGTAGGAATGCCCTCTATACACAATGGGCACATCCTATGTTTTCTAGATTGACTGTAACATAAAATCTTCTTTACAGACATTTGCCATATTTCCCTTAAATCAGTTTTTCTTTGTGTTGTATTGCTGACAAGGTATGAGATGTACCACATGTGTATGAATGGTTTTGCTTGTCTCTGTTTGCAAGATCTGATTGGTGATCACTTTGAATGACAGGTATATGTATACTGCTGCGAAAAATGAAATATCGAATTCATTGTCTTAAATGTATTTCAACTTGTGCAAGAAAGTTTGTTCTTTTTTTGTTTTACCACCAATGCTGTGGACATATTATTAAAATGTCTAAAAGTTAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008226922                                                                                                                                                                                                                                                          TGGACGCGTTGCAGTAACTGACAGCGAGTGCCTAGTATTTTGTCCCAGCCGGCTCTCCGTGAGGGAGATGGGAGAGAGCGTGTCAAAGCGACTGAGGCTGCAGCTCGGAGGGGAGGCGGAGATGGAGGAACGTGCCTTCCTCAACCCTTTTCCGGACTATCGGCCGCCACAGCCTGCACTCGGCACCGGGGCTGAACAGGAAAATCTGGAAGAAGATGAGGAAGCTCTGGGGGAGCTGGACCTGCCTTTTGACAGGGAAGGGAAGATCAGAAGTAGCTTTTCACGGCGCTTGCAGACAAAAATTAGTGATTTACTTCAGCAAATGGAAGAAGGCCTGAAGACTGCTGACCCACATGACTGCTCTGCTTATACAGGATATACAGGCATAGCCCTGCTGTACCTACAGTTGTACCGTGTTACAAAGGAACAAAGCCACTTGCAACGCTCACTTGACTATGTGAAACGAATCCTTCGGAACCTGAATGGAAGGAGAGTCAGCTTCCTATGTGGTGATGCTGGTCCCCTCGCTGTGAGTGCTGTTGTGCACCACAAGCTGAACAATGAGGCTGAATCAAAGGAATGCATTGCAAAGCTGCTGCAGCTTCAGAGAGGAGTGGTTAGCACAGACACAGACCTTCCAGATGAGTTATTGTATGGTAGAGCTGGCTACCTGTATGCTTTACTCTATGTAAATAATGAGATAAGCCCAGACACAGTACCCCCGGCTTCTATCAAAGAGGTTGTAGATGCCATCATTGAATCTGGGAAAAACTTGTCAAAAGAAGAGCACAAAACAGAACGCTGCCCTCTACTGTACCAATGGCACAAGAAGCAGTATGTTGGGGCAGCACATGGCCTAGCTGGAATCTACTACATGCTTATGCAGCCTTCGTCAAACGTGGATGTAGAAACACTAAGTGACCTGGTAAAGCCATGCATAGACTATGTGCGGCACAAAAAATTCAGGTCTGGCAATTACCCGTCCTCTTTAAGCAATGAAACAGACCGACTGGTGCACTGGTGCCATGGAGCACCTGGCGTTATCCACATGCTTCTCCACGCACACAAAGTTTTTAAAGAAGATAAATACTTGAAAGATGCCGTGGAATGCAGCGAAGTCATCTGGCAAAGAGGCCTCCTGAGAAAGGGCTATGGAATTTGTCACGGTACATCCGGAAATGGATATGCTTTCCTATCGCTCTACAACCACACCCAAGACAAGAAATATCTGTATAGAGCTTGCAGGTTTGCTGAGTGGTGCTTAGAGTATGGAAAACATGGATGCCGCATCCCCGATAGACCATATTCTCTATTTGAAGGAATGGCTGGTGCAATCCACTTCCTTTCCGACATGTTGACACCTGAGACTTCGCGCTTCCCAGCATTTGAACTCTGATCTCTTGGTGGCAGACAGCACAGAGGGATATATTTATGTGCCATTCCGGGAGGCAAGAATTAAAGGCATGCCATTATGCCTAGTGCCTACAACACACTGTGTCAACTCTAAACGTCACCACGTTTGGGTGAATTCTATATTGTGACTTGCAATGAACGTCATTGTACATGTTGGCATACCTTATATAACTTGCCCTGTGATTTCCCCAAGAGGATTAGGTTTCCATGCTTGTTGCACACGCCTTTTCATCCATGTCTATTTGTAACACAGCTACTGCACAAATTGTGTGTACTTGCCTATAGTCTGAGTGGCACAAACAATACAGGATTATCAATTGCTTTTCTTTAGGGTACAGTCATATATCTGTTCATATGGAATACATTTCTGTTTCACTGTTACAGTACAAATGCTTCATCCTGCAATTTTCCATCTTACAGCACTGGAATAGTGACATTCAATTTCCTCAGTAATGGGTCATTAACTTTTGTTAAAAACAAAAGAACCAAATTAAAGGTAAGTAAGGATTTTGTAGAGAAAAATGCAAAGCTAACATTAAATCTGTTTTTCTTTTCCTTTGTTTTTATTGTGTTCTTCATAGCTGCCTGTATCTTAACTTAAGCCAGTGAAAATACTGAATTAGTTCCTAACAAATGTTGTACTTTCACACCCCCAAAAGAATGACTAAGAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAAGACACACGGAGCTACTACCAGCAGCTACTTGTCATGGCTACAGAAATCGGCAATGCTGATCATTTACTGATAATTGCCTCTATGTGTGTTTTAGCAGAGGCAATTCCCAGTATTGTCTATGGCAGGTATTTTCTGGCGTTTAGTAGTCTTTACAAGTAGCTGCTACTAAGTAGCTCAGTGTCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTACAAAAAATGAATAATTCCACTCCTGTTTATAATGACTAAAAGTATTTACATAGTAGGAATGCCCTCTATACACAATGGGCACATCCTATGTTTTCTAGATTGACTGTAACATAAAATCTTCTTTACAGACATTTGCCATATTTCCCTTAAATCAGTTTTTCTTTGTGTTGTATTGCTGACAAGGTATGAGATGTACCACATGTGTATGAATGGTTTTGCTTGTCTCTGTTTGCAAGATCTGATTGGTGATCACTTTGAATGACAGGTATATGTATACTGCTGCGAAAAATGAAATATCGAATTCATTGTCTTAAATGTATTTCAACTTGTGCAAGAAAGTTTGTTCTTTTTTTGTTTTACCACCAATGCTGTGGACATATTATTAAAATGTCTAAAAGTTAAAAAAAAAAAxAAAAAAATATC
                                                      consensus depths                                                                                                                                                                                                                                                         2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     6     5     6     4     6     4     6     4     6     4     6     4     6     4     7     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     3     4     3     4     3     3     3     5     3     5     5     5     5     5     7     7     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     8    10     9    11    10    12    10    12    10    12    11    13    11    13    11    11    11    11    11    11    11    11    11    12    11    12    11    12    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    10    11    11    11    11    11    10    10     9     9    10    10    10    10     9    10     8     9     8     8     8     8     8     9     8    10     9    10    10    12    12    12    12    12    15    15    15    15    18    18    18    18    19    19    17    19    20    21    21    22    20    21    20    21    20    21    20    21    20    21    20    21    20    21    21    22    20    21    18    21    18    20    19    20    17    20    19    20    16    19    18    19    17    18    18    20    19    20    19    20    19    19    19    19    19    19    19    19    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    17    17    17    17    17    17    17    17    17    17    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    17    18    18    18    18    18     6     8     3     5
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               BLH ATG      73     307                                                                                                                                                                                                                                                    
                                               BLH MIN      73     202                                                                                                                                                                                                                                                    
                                               BLH MPR      73     202                                                                                                                                                                                                                                                    
                                               BLH OVR      73     129                                                                                                                                                                                                                                                    
                                               CDS MIN      73     202                                                                                                                                                                                                                                                    
                                               ORF LNG      73      21                                                                                                                                                                                                                                                    
                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Dm ==== 6e-063     NP_572682.1 CG2061-PA [Drosophila melanogaster] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ---- 1e-116     XP_797679.1 PREDICTED: similar to LanC-like protein 2 (Testis-specific adriamycin sensitivity protein), partial [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Xl ==== 3e-130     AAH44978.1 Similar to LanC (bacterial lantibiotic synthetase component C)-like [Xenopuslaevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Dr ==== 1e-132     NP_001009891.1 LanC antibiotic synthetase component C-like 1 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = ?? ==== 0          XP_684170.1 PREDICTED: similar to LanC-like protein 2 (Testis-specific adriamycin sensitivity protein) [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Mm ==== 0          NP_598498.1 RIKEN cDNA 1700003F10 [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 0          NP_061167.1 LanC lantibiotic synthetase component C-like 2; testis-specific adriamycinsensitivity protein; LanC (bacterial lantibiotic synthetase component C)-like 2;G protein-coupled receptor 69B [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Gg ==== 0          XP_418874.2 PREDICTED: similar to LanC lantibiotic synthetase component C-like 2 (bacterial) [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 0          AAI35989.1 LOC734145 protein [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABI13057.5                                                                                                                                                                                                                                               TAA---------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------------------TGA------------------------------------------------------------TAA------------ATG------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------TGA---------------------------------------TAA------------------------------------------TAA---------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------------TAG---------------------------------------------------------ATG---------------------TGA---------------------ATG------------------------ATG---------------------------------------TGA---TAA---------------------------------------------------------------------------------ATG------ATG---ATG---------------------------------------------------TGA---------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  0   1   1           Brn3 FL                          CAAK2693.FL-MGC CTGAGTCTGTCCTATCCATTAATTCATCAGTGGATCACAGGGAACAATTCAGCTGCTGCAAAGACAAAGGCTGTGGGGGATTACAAATTGACTTTTCCAGGCATTAGAATGAAATTGAGCTGCCCAAAAAGAGGCGTGGTGGCTTCTCTACAGGACTGAATCAGAAACTGTCATCCCTGCAAGAGCTGCCTCACATGGATGTCATGGAGGAAGGATTGTGGAAGCTGCCTGGGAGCTGTAAAAGAAAACTGGACGCGTTGCAGTAACTGACAGCGAGTGCCTAGTATTTTGTCCCAGCCGGCTCTCCGTGAGGGAGATGGGAGAGAGCGTGTCAAAGCGACTGAGGCTGCAGCTCGGAGGGGAGGCGGAGATGGAGGAACGTGCCTTCCTCAACCCTTTTCCGGACTATCGGCCGCCACAGCCTGCACTCGGCACCGGGGCTGAACAGGAAAATCTGGAAGAAGATGAGGAACCTCTGGGGGAGCTGGACCTGCCTTTTGACAGGGAAGGGAAGATCAGAAGTAGCTTTTCACGGCGCTTGCAGACAAAAATTAGTGATTTACTTCAGCAAATGGAAGAAGGCCTGAAGACTGCTGACCCACATGACTGCTCTGCTTATACAGGATATACAGGCATAGCCCTGCTGTACCTACAGTTGTACCGTGTTACAAAGGAACAAAGCCACTTGCAACGCTCACTTGACTATGTGAAACGAATCCTTCGGAACCTGAATGGAAGGAGAGTCAGCTTCCTATGTGGTGATGCTGGTCCCCTCGCTGTGAGTGCTGTTGTGCACCACAAGCTGAACAATGAGGCTGAATCAAAGGAATGCATTGCAAAGCTGCTGCAGCTTCAGAGAGGAGTGGTTAGCACAGACACAGACCTTCCAGATGAGTTATTGTATGGTAGAGCTGGCTACCTGTATGCTTTACTCTATGTAAATAATGAGATAAGCCCAGACACAGTACCCCCGGCTTCTATCAAAGAGGTTGTAGATGCCATCATTGAATCTGGGAAAAACTTGTCAAAAGAAGAGCACAAAACAGAACGCTGCCCTCTACTGTACCAATGGCACAAGAAGCAGTATGTTGGGGCAGCACATGGCCTAGCTGGAATCTACTACATGCTTATGCAGCCTTCGTCAAACGTGGATGTAGAAACACTAAGTGACCTGGTAAAGCCATGCATAGACTATGTGCGGCACAAAAAATTCAGGTCTGGCAATTACCCGTCCTCTTTAAGCAATGAAACAGACCGACTGGTGCACTGGTGCCATGGAGCACCTGGCGTTATCCACATGCTTCTCCACGCACACAAAGTTTTTAAAGAAGATAAATACTTGAAAGATGCCGTGGAATGCAGCGAAGTCATCTGGCAAAGAGGCCTCCTGAGAAAGGGCTATGGAATTTGTCACGGTACATCCGGAAATGGATATGCTTTCCTATCGCTCTACAACCACACCCAAGACAAGAAATATCTGTATAGAGCTTGCAGGTTTGCTGAGTGGTGCTTAGAGTATGGAAAACATGGATGCCGCATCCCCGATAGACCATATTCTCTATTTGAAGGAATGGCTGGTGCAATCCACTTCCTTTCCGACATGTTGACACCTGAGACTTCGCGCTTCCCAGCATTTGAACTCTGATCTCTTGGTGGCAGACAGCACAGAGGGATATATTTATGTGCCATTCCGGGAGGCAAGAATTAAAGGCATGCCATTATGCCTAGTGCCTACAACACACTGTGTCAACTCTAAACGTCACCACGTTTGGGTGAATTCTATATTGTGACTTGCAATGAACGTCATTGTACATGTTGGCATACCTTATATAACTTGCCCTGTGATTTCCCCAAGAGGATTAGGTTTCCATGCTTGTTGCACACGCCTTTTCATCCATGTCTATTTGTAACACAGCTACTGCACAAATTGTGTGTACTTGCCTATAGTCTGAGTGGCACAAACAATACAGGATTATCAATTGCTTTTCTTTAGGGTACAGTCATATATCTGTTCATATGGAATACATTTCTGTTTCACTGTTACAGTACAAATGCTTCATCCTGCAATTTTCCATCTTACAGCACTGGAATAGTGACATTCAATTTCCTCAGTAATGGGTCATTAACTTTTGTTAAAAACAAAAGAACCAAATTAAAGGTAAGTAAGGATTTTGTAGAGAAAAATGCAAAGCTAACATTAAATCTGTTTTTCTTTTCCTTTGTTTTTATTGTGTTCTTCATAGCTGCCTGTATCTTAACTTAAGCCAGTGAAAATACTGAATTAGTTCCTAACAAATGTTGTACTTTCACACCCCCAAAAGAATGACTAAGAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAAGACACACGGAGCTACTACCAGCAGCTACTTGTCATGGCTACAGAAATCGGCAATGCTGATCATTTACTGATAATTGCCTCTATGTGTGTTTTAGCAGAGGCAATTCCCAGTATTGTCTATGGCAGGTATTTTCTGGCGTTTAGTAGTCTTTACAAGTAGCTGCTACTAAGTAGCTCAGTGTCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTACAAAAAAAAAAAAAAA
  0   1   1           Egg  FLt5                   TEgg100p17.FL-Sanger                                                                                                                                                                                                                                                                                                                                        CGTGTCAAAGCGACTGAGGCTGCAGCTCGGAGGGGAGGCGGAGATGGAGGAACGTGCCTTCCTCAACCCTTTTCCGGACTATCGGCCGCCACAGCCTGCACTCGGCACCGGGGCTGAACAGGAAAATCTGGAAGAAGATGAGGAAGCTCTGGGGGAGCTGGACCTGCCTTTTGACAGGGAAGGGAAGATCAGAAGTAGCTTTTCACGGCGCTTGCAGACAAAAATTAGTGATTTACTTCAGCAAATGGAAGAAGGCCTGAAGACTGCTGACCCACATGACTGCTCTGCTTATACAGGATATACAGGCATAGCCCTGCTGTACCTACAGTTGTACCGTGTTACAAAGGAACAAAGCCACTTGCAACGCTCACTTGACTATGTGAAACGAATCCTTCGGAACCTGAATGGAAGGAGAGTCAGCTTCCTATGTGGTGATGCTGGTCCCCTCGCTGTGAGTGCTGTTGTGCACCACAAGCTGAACAATGAGGCTGAATCAAAGGAATGCATTGCAAAGCTGCTGCAGCTTCAGAGAGGAGTGGTTAGCACAGACACAGACCTTCCAGATGAGTTATTGTATGGTAGAGCTGGCTACCTGTATGCTTTACTCTATGTAAATAATGAGATAAGCCCAGACACAGTACCCCCGGCTTCTATCAAAGAGGTTGTAGATGCCATCATTGAATCTGGGAAAAACTTGTCAAAAGAAGAGCACAAAACAGAACGCTGCCCTCTACTGTACCAATGGCACAAGAAGCAGTATGTTGGGGCAGCACATGGCCTAGCTGGAATCTACTACATGCTTATGCAGCCTTCGTCAAACGTGGATGTAGAAACACTAAGTGACCTGGTAAAGCCATGCATAGACTATGTGCGGCACAAAAAATTCAGGTCTGGCAATTACCCGTCCTCTTTAAGCAATGAAACAGACCGACTGGTGCACTGGTGCCATGGAGCACCTGGCGTTATCCACATGCTTCTCCACGCACACAAAGTTTTTAAAGAAGATAAATACTTGAAAGATGCCGTGGAATGCAGCGAAGTCATCTGGCAAAGAGGCCTCCTGAGAAAGGGCTATGGAATTTGTCACGGTACATCCGGAAATGGATATGCTTTCCTATCGCTCTACAACCACACCCAAGACAAGAAATATCTGTATAGAGCTTGCAGGTTTGCTGAGTGGTGCTTAGAGTATGGAAAACATGGATGCCGCATCCCCGATAGACCATATTCTCTATTTGAAGGAATGGCTGGTGCAATCCACTTCCTTTCCGACATGTTGACACCTGAGACTTCGCGCTTCCCAGCATTTGAACTCTGATCTCTTGGTGGCAGACAGCACAGAGGGATATATTTATGTGCCATTCCGGGAGGCAAGAATTAAAGGCATGCCATTATGCCTAGTGCCTACAACACACTGTGTCAACTCTAAACGTCACCACGTTTGGGTGAATTCTATATTGTGACTTGCAATGAACGTCATTGTACATGTTGGCATACCTTATATAACTTGCCCTGTGATTTCCCCAAGAGGATTAGGTTTCCATGCTTGTTGCACACGCCTTTTCATCCATGTCTATTTGTAACACAGCTACTGCACAAATTGTGTGTACTTGCCTATAGTCTGAGTGGCACAAACAATACAGGATTATCAATTGCTTTTCTTTAGGGTACAGTCATATATCTGTTCATATGGAATACATTTCTGTTTCACTGTTACAGTACAAATGCTTCATCCTGCAATTTTCCATCTTACAGCACTGGAATAGTGACATTCAATTTCCTCAGTAATGGGTCATTAACTTTTGTTAAAAACAAAAGAACCAAATTAAAGGTAAGTAAGGATTTTGTAGAGAAAAATGCAAAGCTAACATTAAATCTGTTTTTCTTTTCCTTTGTTTTTATTGTGTTCTTCATAGCTGCCTGTATCTTAACTTAAGCCAGTGAAAATACTGAATTAGTTCCTAACAAATGTTGTACTTTCACACCCCCAAAAGAATGACTAAGAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAAGACACACGGAGCTACTACCAGCAGCTACTTGTCATGGCTACAGAAATCGGCAATGCTGATCGTTTGCTGATAGTTGCCTCTATGTGTGTTTTGGCGGAGGCAATTCCCGGTGTTGTCTATGGCAGGTATTTTCTGGCGTTTAGTAGTCTTTACAAGTAGCTGCTACTAAGTAGCTCAGTGTCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTACAAAAAATGAATAATTCCACTCCTGTTTATAATGACTAAAAGTATTTACATAGTAGGAATGCCCTCTATACACAATGGGCACATCCTATGTTTTCTAGATTGACTGTAACATAAAATCTTCTTTACAGACATTTGCCATATTTCCCTTAAATCAGTTTTTCTTTGTGTTGTATTGCTGACAAGGTATGAGATGTACCACATGTGTATGAATGGTTTTGCTTGTCTCTGTTTGCAAGATCTGATTGGTGATCACTTTGAATGACAGGTATATGTATACTGCTGCGAAAAATGAAATATCGAATTCATTGTCTTAAATGTATTTCAACTTGTGCAAGAAAGTTTGTTCTTTTTTTGTTTTACCACCAATGCTGTGGACATATTATTAAAATGTCTAAAAGTTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Brn3 FL   in                         CAAK2693.5p CTGAGTCTGTCCTATCCATTAATTCATCAGTGGATCACAGGGAACAATTCAGCTGCTGCAAAGACAAAGGCTGTGGGGGATTACAAATTGACTTTTCCAGGCATTAGAATGAAATTGAGCTGCCCAAAAAGAGGCGTGGTGGCTTCTCTACAGGACTGAATCAGAAACTGTCATCCCTGCAAGAGCTGCCTCACATGGATGTCATGGAGGAAGGATTGTGGAAGCTGCCTGGGAGCTGTAAAAGAAAACTGGACGCGTTGCAGTAACTGACAGCGAGTGCCTAGTATTTTGTCCCAGCCGGCTCTCCGTGAGGGAGATGGGAGAGAGCGTGTCAAAGCGACTGAGGCTGCAGCTCGGAGGGGAGGCGGAGATGGAGGAACGTGCCTTCCTCAACCCTTTTCCGGACTATCGGCCGCCACAGCCTGCACTCGGCACCGGGGCTGAACAGGAAAATCTGGAAGAAGATGAGGAACCTCTGGGGGAGCTGGACCTGCCTTTTGACAGGGAAGGGAAGATCAGAAGTAGCTTTTCACGGCGCTTGCAGACAAAAATTAGTGATTTACTTCAGCAAATGGAAGAAGGCCTGAAGACTGCTGACCCACATGACTGCTCTGCTTATACAGGATATACAGGCATAGCCCTGCTGTACCTACAGTTGTACCGTGTTACAAAGGAACAAAGCCACTTGCAACGCTCACTTGACTATGTGAAACGAATCCTTCGGAACCTGAATGGAAGGAGAGTCAGCTTCCTATGTGGTGATGCTGGTCCCCTCGCTGTGAGTGCTGTTGTGCACCACAAGCTGAACNATGAGGCTGAATCAAAGGAATGCATTGCAAAGCTGCTGCAGC
  5   1   2       bld TpA  5g                        TTpA058g13.p1kSP6                                                                                                                                                                            CCCCGGGGGAACAATTCAGCTGCTGCAAAGACAAAGGCTGTGGGGGATTACAAATTGACTTTTCCAGTAAAAGAAAACTGGACGCGTTGCAGTAACTGACAGCGAGTGCCTAGTATTTTGTCCCAGCCGGCTCTCCGTGAGGGAGATGGGAGAGAGCGTGTCAAAGCGACTGAGGCTGCAGCTCGGAGGGGAGGCGGAGATGGAGGAACGTGCCTTCCTCAACCCTTTTCCGGACTATCGGCCGCCACAGCCTGCACTCGGCACCGGGGCTGAACAGGAAAATCTGGAAGAAGATGAGGAAGCTCTGGGGGAGCTGGACCTGCCTTTTGACAGGGAAGGGAAGATCAGAAGTAGCTTTTCACGGCGCTTGCAGACAAAAATTAGTGATTTACTTCAGCAAATGGAAGAAGGCCTGAAGACTGCTGACCCACATGACTGCTCTGCTTATACAGGATATACAGGCATAGCCCTGCTGTACCTACAGTTGTACCGTGTTACAAAGGAACAAAGCCACTTGCAACGCTCACTTGACTATGTGAAACGAATCCTTCGGAACCTGAATGGAAGGAGAGTCAGCTTCCTATGTGGTGATGCTGGTCCCCTCGCTGTGAGTGCTGTTGTGCACCACAAGCTGAACAATGAGGCTGAATCAAAGGAATGCATTGCAAAGCTGCTGCAGCTTCAGAGAGGAGTGGTTAGCACAGACACAGACCTTCCAGATGAGTTATTGTATGTAGAGCTGGCTACCTGTATGCTTTACTCTATGTAAATAATGAGATAAGCCCAGACACAGTACCCCCGGCTTCTATCANAGAGGTTGTAGATGCCATCATTGAATCTGGGAAAAACTTGTCAAAAGAAGAGCACAAACAGAACGCTGCCCTCTACTGT
  5   1   2       bld Egg  FLt5                      TEgg100p17.p1kSP6                                                                                                                                                                                                                                                                                                                                        CGTGTCAAAGCGACTGAGGCTGCAGCTCGGAGGGGAGGCGGAGATGGAGGAACGTGCCTTCCTCAACCCTTTTCCGGACTATCGGCCGCCACAGCCTGCACTCGGCACCGGGGCTGAACAGGAAAATCTGGAAGAAGATGAGGAAGCTCTGGGGGAGCTGGACCTGCCTTTTGACAGGGAAGGGAAGATCAGAAGTAGCTTTTCACGGCGCTTGCAGACAAAAATTAGTGATTTACTTCAGCAAATGGAAGAAGGCCTGAAGACTGCTGACCCACATGACTGCTCTGCTTATACAGGATATACAGGCATAGCCCTGCTGTACCTACAGTTGTACCGTGTTACAAAGGAACAAAGCCACTTGCAACGCTCACTTGACTATGTGAAACGAATCCTTCGGAACCTGAATGGAAGGAGAGTCAGCTTCCTATGTGGTGATGCTGGTCCCCTCGCTGTGAGTGCTGTTGTGCACCACAAGCTGAACAATGAGGCTGAATCAAAGGAATGCATTGCAAAGCTGCTGCAGCTTCAGAGAGGAGTGGTTAGCACAGACACAGACCTTCCAGATGAGTTATTGTATGGTAGAGCTGGCTACCTGTATGCTTTACTCTATGTAAATAATGAGATAAGCCCAGACACAGTACCCCCGGC
  5   1   2       bld Brn2      in                        CAAJ12747.5p                                                                                                                                                                                                                                                                                                                                            TCAAAGCGACTGAGGCTGCAGCTCGGAGGGGAGGCGGAGATGGAGGAACGTGCCTTCCTCAACCCTTTTCCGGACTATCGGCCGCCACAGCCTGCACTCGGCACCGGGGCTGAACAGGAAAATCTGGAAGAAGATGAGGAAGCTCTGGGGGAGCTGGACCTGCCTTTTGACAGGGAAGGGAAGATCAGAAGTAGCTTTTCACGGCGCTTGCAGACAAAAATTAGTGATTTACTTCAGCAAATGGAAGAAGGCCTGAAGACTGCTGACCCACATGACTGCTCTGCTTATACAGGATATACAGGCATAGCCCTGCTGTACCTACAGTTGTACCGTGTTACAAAGGAACAAAGCCACTTGCAACGCTCACTTGACTATGTGAAACGAATCCTTCGGAACCTGAATGGAAGGAGAGTCAGCTTCCTATGTGGTGATGCTGGTCCCCTCGCTGTGAGTGCTGTTGTGCACCACAAGCTGAACAATGAGGCTGAATCAAAGGAATGCATTGCAAAGCTGCTGCAGCTTCAGAGAGGAGTGGTTAGCACAGACACAGACCTTCCAGATGAGTTATTGTATGGTAGAGCTGGCTACCTGTATGCTTTACTCTATGTAAATAATGAGATAAGCCCAGACACAGTACCCCCGGCTTCTATCAAAGAGGTTGTAGATGCCATCATTGAATCTGGGAAAAACTTGTCAAAAGAAGAGCACAAAACAGAACGCTGCCCTCTACTGTACCAATGGCACAAGAAGCAGTATGTTGNGGCAGCACATGGCCTAGCTGGAATCTACTACATGCTTATGCAGCCTTCGTCAAACGTGGATGTAGAAACACTAAGTGACCTGGGTAAGCCATGCATAGACTATGTGCGGCACAAAAAAATCA
  3  -1   2       bld Ovi1      in                        CABI13057.3p                                                                                                                                                                                                                                                                                                                                                                                                                TCCGGACTATCGGCCGCCACAGCCTGCACTCGGCACCGGGGCTGAACAGGAAAATCTGGAAGAAGATGAGGAAGCTCTGGGGGAGCTGGACCTGCCTTTTGACAGGGAAGGGAAGATCAGAAGTAGCTTTTCACGGCGCTTGCAGACAAAAATTAGTGATTTACTTCAGCAAATGGAAGAAGGCCTGAAGACTGCTGACCCACATGACTGCTCTGCTTATACAGGATATACAGGCATAGCCCTGCTGTACCTACAGTTGTACCGTGTTACAAAGGAACAAAGCCACTTGCAACGCTCACTTGACTATGTGAAACGAATCCTTCGGAACCTGAATGGAAGGAGAGTCAGCTTCCTATGTGGTGATGCTGGTCCCCTCGCTGTGAGTGCTGTTGTGCACCACAAGCTGAACAATGAGGCTGAATCAAAGGAATGCATTGCAAAGCTGCTGCAGCTTCAGAGAGGAGTGGTTAGCACAGACACAGACCTTCCAGATGAGTTATTGTATGGTAGAGCTGGCTACCTGTATGCTTTACTCTATGTAAATAATGAGATAAGCCCAGACACAGTACCCCCGGCTTCTATCAAAGAGGTTGTAGATGCCATCATTGAATCTGGGAAAAACTTGTCAAAAGAAGAGCACAAAACAGAACGCTGCCCTCTACTGTACCAATGGCACAAGAAGCAGTATGTTGGGGCAGCACATGGCCTAGCTGGAATCTACTACATGCTTATGCAGCCTTCGTCAAACGTGGATGTAGAAACACTAAGTGACCTGGTAAAGCCATGCATAGACTATGTGCGGCACAAAAAATTCAGGTCTGGCAATTACCCGTCCTCTTAAGCAATGAAACAGACCGACTGGTGCACT
  5   1   2       bld TpA                            TTpA032b12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGACTGCTCTGCTTATACAGGATATACAGGCATAGCCCTGCTGTACCTACAGTTGTACCGTGTTACAAAGGAACAAAGCCACTTGCAACGCTCACTTGACTATGTGAAACGAATCCTTCGGAACCTGAATGGAAGGAGAGTCAGCTTCCTATGTGGTGATGCTGGTCCCCTCGCTGTGAGTGCTGTTGTGCACCACAAGCTGAACAATGAGGCTGAATCAAAGGAATGCATTGCAAAGCTGCTGCAGCTTCAGAGAGGAGTGGTTAGCACAGACACAGACCTTCCAGATGAGTTATTGTATGGTAGAGCTGGCTACCTGTATGCTTTACTCTATGTAAATAATGAGATAAGCCCAGACACAGTACCCCCGGCTTCTATCAAAGAGGTTGTAGATGCCATCATTGAATCTGGGAAAAACTTGTCAAAAGAAGAGCACAAAACAGAACGCTGCCCTCTACTGTACCAATGGCACAAGAAGCAGTATGTTGGGGCAGCACATGGCCTAGCTGGAATCTACTACATGCTTATGCAGCCTTCGTCAAACGTGGATGTAGAAACACTAAGTGACCTGGTAAAGCCATGCATAGACTATGTGCGGCACAAAAAATTCAGGTCTGGCAATTACCCGTCCTCTTTAAGCAATGAAACAGACCGACTGGTGCACTGGTGCCATGGAGCACCTGGCGTTATCCACATGCTTCTCCACGCACACAAAGTTTTTAAAGAACATAAATACTTCGAAGATGCCGTGGAATGCAGCGAAGTCATCTGGC
  5   1   2       bld HdA       in                  THdA014c20.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACAGACCTTCCAGATGAGTTATTGTATGGTAGAGCTGGCTACCTGTATGCTTTACTCTATGTAAATAATGAGATAAGCCCAGACACAGTACCCCCGGGCTTCTATCAAAGAGGTTGTAGATGCCATCATTGAATCTGGGAAAAACTTGTCAAAAGAAGAGCACAAAACAGAACGCTGCCCTCTACTGTACCAATGGCACAAGAAGCAGTATGTTGGGGCAGCACATGGCCTAGCTGGAATCTACTACATGCTTATGCAGCCTTCGTCAAACGTGGATGTAGAAACACTAAGTGACCTGGTAAAGCCATGCATAGACTATGTGCGGCACAAAAAATTCAGGTCTGGCAATTACCCGTCCTCTTTAAGCAATGAAACAGACCGACTGGTGCACTGGTGCCATGGAGCACCTGGCGTTATCCACATGCTTCTCCACGCACACAAAGTTTTTAAAGAAGATAAATACTTGAAAGATGCCGTGGAATGCAGCGAAGTCATCTGGCAAAGAGGCCTCCTGAGAAAGGGCTATGGAATTTGTCACGGTACATCCGGAAATGGATATGCTTTCCTATCGCTCTACAACCACACCCAAGACAAGAAATATCTGTATAGAGCTTGCAGGTTTGCTGAGTGGTGCTTAGAGTATGGAAAACATGGATGCCGCATCCCCGATAGACCATATTCTCTATTTGAAGGAATGGCTGGTGCAATCCACTTCCTTTCCGACATGTTGACACCTGAGACTTCGCGCTTCCCAGCATTTGAACTCTGATCTCTTGGTGGCAGAAGCACAGAGGGATATATTTATGTGCCATTCCGGGAGGNCAGATTAAAGGCATGCCATTATGCCTAGTGCCTACAACACACTGTGTCAACTCTAACGT
  5   1   2       bld Te5       in                         CAAO4303.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCAGACACAGTACCCCCGNGCTTCTATCAAAGAGGTTGTAGATGCCATCATTGAATCTGGGAAAAACTTGTCAAAAGAAGAGCACAAAACAGAACGCTGCCCTCTACTGTACCAATGGCACAAGAAGCAGTATGTTGGGGCAGCACATGGCCTAGCTGGAATCTACTACATGCTTATGCAGCCTTCGTCAAACGTGGATGTAGAAACACTAAGTGACCTGGTAAAGCCATGCATAGACTATGTGCGGCACAAAAAATTCAGGTCTGGCAATTACCCGTCCTCTTTAAGCAATGAAACAGACCGACTGGTGCACTGGTGCCATGGAGCACCTGGCGTTATCTACATGCTTCTCCACGCACACAAAGTTTTTAAAGAAGATAAATACTTGAAAGATGCCGTGGAATGCAGCGAAGTCATCTGGCAAAGAGGCCTCCTGAGAAAGGGCTATGGAATTTGTCACGGTACATCCGGAAATGGATATGCTTTCCTATCGCTCTACAACCACACCCAAGACAAGAAATATCTGTATAGAGCTTGCAGGTTTGCTGAGTGGTGCTTAGAGTATGGAAAACATGGATGCCGCATCCCCGATAGACCATATTCTCTATTTGAAGGAATGGCTGGTGCAATCCACTTCCTTTCCGACATGTTGACACCTGAGACTTCGCGCTTCCCAGCATTTGAACTCTGATCTCTTGGTGGCAGACAGCACAGAGGGATATATTTATGTGCCATTCCGGGGAGGCAAGAATTAAAGGCATGCCATTATGGCTAGTGCCTANCACACACTGTGTCAACTCTAAACGT
  5   1   2       bld Brn2      in                        CAAJ24281.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGGTGCCATGGAGCACCTGGGCGTTATCCACNATGCTTCTCCACGCACACAAAGTTTTTAAAGAAGATAAATACTTGAAAGATGCCGTGGAATGCAGCGAAGTCATCTGGCAAAGAGGCCTCCTGAGAAAGGGCTATGGAATTTGTCACGGTACATCCGGAAATGGATATGCTTTCCTATCGCTCTACAACCACACCCAAGACAAGAAATATCTGTATAGAGCTTGCAGGTTTGCTGAGTGGTGCTTAGAGTATGGAAAACATGGATGCCGCATCCCCGATAGACCATATTCTCTATTTGAAGGAATGGCTGGTGCAATCCACTTCCTTTCCGACATGTTGACACCTGAGACTTCGCGCTTCCCAGCATTTGAACTCTGATCTCTTGGTGGCAGACAGCACAGAGGGATATATTTATGTGCCATTCCGGGAGGCAAGAATTAAAGGCATGCCATTATGCCTAGTGCCTACAACACACTGTGTCAACTCTAAACGTCACCACGTTTGGGTGAATTCTATATTGTGACTTGCAATGAACGTCATTGTACATGTTGGCATACCTTATATAACTTGCCCTGTGATTTCCCCAAGAGGATTAGGTTTCCATGCTTGTTGCACACGCCTTTTCATCCATGTCTATTTGTAACACAGCTACTGCACAAATTGTGTGTACTTGCCTATAGTCTGAGTGGCACAAACAATACAGGATTATCAATTGCTTTTCTTTAGGGTACAGTCATATATCTGTTCATATGGAATACATTTCTGTTTCACTGTTACAGTACAAATGCTTCATCCTGCAATTTTCCATCTTACAGCACTGGAATAGTGACAT
  5   1   2       bld Brn4      in                         CAAL8876.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGAGCACCTGGGCGTTATCCACATGGCTTCTCCACGCACACAAAGTTTTTAAAGAAGATAAATACTTGAAAGATGCCGTGGAATGCAGCGAAGTCATCTGGCAAAGAGGCCTCCTGAGAAAGGGCTATGGAATTTGTCACGGTACATCCGGAAATGGATATGCTTTCCTATCGCTCTACAACCACACCCAAGACAAGAAATATCTGTATAGAGCTTGCAGGTTTGCTGAGTGGTGCTTAGAGTATGGAAAACATGGATGCCGCATCCCCGATAGACCATATTCTCTATTTGAAGGAATGGCTGGTGCAATCCACTTCCTTTCCGACATGTTGACACCTGAGACTTCGCGCTTCCCAGCATTTGAACTCTGATCTCTTGGTGGCAGACAGCACAGAGGGATATATTTATGTGCCATTCCGGGAGGCAAGAATTAAAGGCATGCCATTATGCCTAGTGCCTACAACACACTGTGTCAACTCTAAACGTCACCACGTTTGGGTGAATTCTATATTGTGACTTGCAATGAACGTCATTGTACATGTTGGCATACCTTATATAACTTGCCCTGTGATTTCCCCAAGAGGATTAGGTTTCCATGCTTGTTGCACACGCCTTTTCATCCATGTCTATTTGTAACACAGCTACTGCACAAATTGTGTGTACTTGCCTATAGTCTGAGTGGCACAAACAATACAGGATTATCAATTGCTTTTCTTTAGGGTACAGTCATATATCTGTTCATATGGAATACATTTCTGTTTCACTGTTACAGTACAAATGCTTCATCCCTGCATTTTCCATCTTACAGCACTGGAATAGTGACATTCAATTCCTC
  5   1   2       bld Brn4      in                        CAAL18212.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGTTTTTAAAGAAGATAAATACTTGAAAGATGCCGTGGAATGCAGCGAAGTCATCTGGCAAAGAGGCCTCCTGAGAAAGGGCTATGGAATTTGTCACGGTACATCCGGAAATGGATATGCTTTCCTATCGCTCTACAACCACACCCAAGACAAGAAATATCTGTATAGAGCTTGCAGGTTTGCTGAGTGGTGCTTAGAGTATGGAAAACATGGATGCCGCATCCCCGATAGACCATATTCTCTATTTGAAGGAATGGCTGGTGCAATCCACTTCCTTTCCGACATGTTGACACCTGAGACTTCGCGCTTCCCAGCATTTGAACTCTGATCTCTTGGTGGCAGACAGCACAGAGGGATATATTTATGTGCCATTCCGGGAGGCAAGAATTAAAGGCATGCCATTATGCCTAGTGCCTACAACACACTGTGTCAACTCTAAACGTCACCACGTTTGGGTGAATTCTATATTGTGACTTGCAATGAACGTCATTGTACATGTTGGCATACCTTATATAACTTGCCCTGTGATTTCCCCAAGAGGATTAGGTTTCCATGCTTGTTGCACACGCCTTTTCATCCATGTCTATTTGTAACACAGCTACTGCACAAATTGTGTGTACTTGCCTATAGTCTGAGTGGCACAAACAATACAGGATTATCAATTGCTTTTCTTTAGGGTACAGTCATATATCTGTTCATATGGAATACATTTCTGTTTCACTGTTACAGTACAAATGCTTCATCCTGCAATTTTCCATCTTACAGCACTGGAATAGTGACATTCCATTTCCTCAGTAATGGGTCATTAACTTTTGTTAAAAACAAAAGAACCAAA
  5   1   2       bld Gas7      in                         XZG15497.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGTTTTTAAAGAAGATAAATACTTGAAAGATGCCGTGGAATGCAGCGAAGTCATCTGGCAAAGAGGCCTCCTGAGAAAGGGCTATGGAATTTGTCACGGTACATCCGGAAATGGATATGCTTTCCTATCGCTCTACAACCACACCCAAGACAAGAAATATCTGTATAGAGCTTGCAGGTTTGCTGAGTGGTGCTTAGAGTATGGAAAACATGGATGCCGCATCCCCGATAGACCATATTCTCTATTTGAAGGAATGGCTGGTGCAATCCACTTCCTTTCCGACATGTTGACACCTGAGACTTCGCGCTTCCCAGCATTTGAACTCTGATCTCTTGGTGGCAGACAGCACAGAGGGATATATTTATGTGCCATTCCGGGAGGCAAGAATTAAAGGCATGCCATTATGCCTAGTGCCTACAACACACTGTGTCAACTCTAAACGTCACCACGTTTGGGTGAATTCTATATTGTGACTTGCAATGAACGTCATTGTACATGTTGGCATACCTTATATAACTTGCCCTGTGATTTCCCCAAGAGGATTAGGTTTCCATGCTTGTTGCACACGCCTTTTCATCCATGTCTATTTGTAACACAGCTACTGCACAAATTGTGTGTACTTGCCTATAGTCTGAGTGGCACACACAATACAGGATTATCAATTGCTTTTCTTTAGGGTACAGTCATATATCTGTTCATATGGAATACATTTCTGTTTCACTNGTACAGTACAAATGCTTCATCCTGCA
  5   1   2       bld Tad5      in                         XZT72520.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATAAATACTTGAAAGATGCCGTGGAATGCAGCGAAGTCATCTGGCAAAGAGGCCTCCTGAGAAAGGGCTATGGAATTTGTCACGGTACATCCGGAAATGGATATGCTTTCCTATCGCTCTACAACCACACCCAAGACAAGAAATATCTGTATAGAGCTTGCAGGTTTGCTGAGTGGTGCTTAGAGTATGGAAAACATGGATGCCGCATCCCCGATAGACCATATTCTCTATTTGAAGGAATGGCTGGTGCAATCCACTTCCTTTCCGACATGTTGACACCTGAGACTTCGCGCTTCCCAGCATTTGAACTCTGATCTCTTGGTGGCAGACAGCACAGAGGGATATATTTATGTGCCATTCCGGGAGGCAAGAATTAAAGGCATGCCATTATGCCTAGTGCCTACAACACACTGTGTCAACTCTAAACGTCACCACGTTTGGGTGAATTCTATATTGTGACTTGCAATGAACGTCATTGTACATGTTGGCATACCTTATATAACTTGCCCTGTGATTTCCCCAAGAGGATTAGGTTTCCATGCTTGTTGCACACGCCTTTTCATCCATGTCTATTTGTAACACAGCTACTGCACAAATTGTGTGTACTTGCCTATAGTCTGAGTGGCACAAACAATACAGGATTATCAATTGCTTTTCTTTAGGGTACAGTCATATATCTGTTCATATGGAATACATTTCTGTTTCACTGTTACAGTACAAATGCTTCATCCTGCAATTTTCCATCTTACAGCACTGGAATAGTGACATTCAATTTCCTCAGTAATGGGTCATTAACTTTTGTTAAAACAAAAGAACAAATTAAGGTAAGTAGGATTTGTAGAG
  5   1   2       bld Brn2                                CAAJ16279.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTAGAGTATGGAAAACATGGATGCCGCATCCCCGATAGACCATATTCTCTATTTGAAGGAATGGCTGGTGCAATCCACTTCCTTTCCGACATGTTGACACCTGAGACTTCGCGCTTCCCAGCATTTGAACTCTGATCTCTTGGTGGCAGACAGCACAGAGGGATATATTTATGTGCCATTCCGGGAGGCAAGAATTAAAGGCATGCCATTATGCCTAGTGCCTACAACACACTGTGTCAACTCTAAACGTCACCACGTTTGGGTGAATTCTATATTGTGACTTGCAATGAACGTCATTGTACATGTTGGCATACCTTATATAACTTGCCCTGTGATTTCCCCAAGAGGATTAGGTTTCCATGCTTGTTGCACACGCCTTTTCATCCATGTCTATTTGTAACACAGCTACTGCACAAATTGTGTGTACTTGCCTATAGTCTGAGTGGCACAAACAATACAGGATTATCAATTGCTTTTCTTTAGGGTACAGTCATATATCTGTTCATATGGAATACATTTCTGTTTCACTGTTACAGTACAAATGCTTCATCCTGCAATTTTCCATCTTACAGCACTGGAATAGTGACATTCAATTTCCTCAGTAATGGGTCATTAACTTTTGTTAAAAACAAAAGAACCAAATTAAAGGTAAGTAAGGATTTTGTAGAGAAAAATGCAAAGCTAACATTAAATCTGTTTTTCTTTTCCTTTGTTTTTATTGTGTTCTTCATAGCTGCCTGTATCTTAACTTAAGCCAGTGAAAATACTGAATTAGTTCCTAACAAATGTTGTACTTTCACACCCCCAAAAGAATGACTAAAGAGTATCCATACCAATGTAGGCTTT
  3  -1   2       bld Ova1      in                         CABE2630.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGGTGCAATCCACTTCCTTTCCGACATGTTGACACCTGAGACTTCGCGCTTCCCAGCATTTGAACTCTGATCTCTTGGTGGCAGACAGCACAGAGGGATATATTTATGTGCCATTCCGGGAGGCAAGAATTAAAGGCATGCCATTATGCCTAGTGCCTACAACACACTGTGTCAACTCTAAACGTCACCACGTTTGGGTGAATTCTATATTGTGACTTGCAATGAACGTCATTGTACATGTTGGCATACCTTATATAACTTGCCCTGTGATTTCCCCAAGAGGATTAGGTTTCCATGCTTGTTGCACACGCCTTTTCATCCATGTCTATTTGTAACACAGCTACTGCACAAATTGTGTGTACTTGCCTATAGTCTGAGTGGCACAAACAATACAGGATTATCAATTGCTTTTCTTTAGGGTACAGTCATATATCTGTTCATATGGAATACATTTCTGTTTCACTGTTACAGTACAAATGCTTCATCCTGCAATTTTCCATCTTACAGCACTGGAATAGTGACATTCAATTTCCTCAGTAATGGGTCATTAACTTTTGTTAAAAACAAAAGAACCAAATTAAAGGTAAGTAAGGATTTTGTAGAGAAAAATGCAAAGCTAACATTAAATCTGTTTTTCTTTTCCTTTGTTTTTATTGTGTTCTTCATAGCTGCCTGTATCTTAACTTAAGCCAGTGAAAATACTGAATTAGTTCCTAACAAATGTTGTACTTTCACACCCCCAAAAGAATGACTAAGAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAAGACACACGGAGCTACTACCAGCAGCTACTTGTCATGGCTA
  5   1   2       bld AbdN                               IMAGE:7021982                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTTTTCGTTTCCAGGAATTCCCGGGATCAAGAATTAAAGGCATGCCATTATGCCTAGTGCCTACAACACACTGTGTCAACTCTAAACGTCACCACGTTTGGGTGAATTCTATATTGTGACTTGCAATGAACGTCATTGTACATGTTGGCATACCTTATATAACTTGCCCTGTGATTTCCCCAAGAGGATTAGGTTTCCATGCTTGTTGCACACGCCTTTTCATCCATGTCTATTTGTAACACAGCTACTGCACAAATTGTGTGTACTTGCCTATAGTCTGAGTGGCACAAACAATACAGGATTATCAATTGCTTTTCTTTAGGGTACAGTCATATATCTGTTCATATGGAATACATTTCTGTTTCACTGTTACAGTACAAATGCTTCATCCTGCAATTTTCCATCTTACAGCACTGGAATAGTGACATTCAATTTCCTCAGTAATGGGTCATTAACTTTTGTTAAAAACAAAAGAACCAAATTAAAGGTAAGTAAGGATTTTGTAGAGAAAAATGCAAAGCTAACATTAAATCTGTTTTTCTTTTCCTTTGTTTTTATTGTGTTCTTCATAGCTGCCTGTATCTTAACTTAAGCCAGTGAAAATACTGAATTAGTTCCTAACAAATGTTGTACTTTCACAACCCCCAAAAGAATGACTAAGAGGTATCCATACCATTGTANGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAAGATTTAAagacacacggagctactaccagcagctacttgtcatggctacagaaaatcgcaaagctaatcatttactgataattgcctctatgtgtgttttagcaagaggcaattcCCCAGTATTGTCTATGGGAGGGATTTTTCTGGCCGTTTAATAATCCTTTACCAAGTAGCTGGCTACTAAGTAGCTCAATGTC
  5   1   2       bld Ova1      in                         CABE6420.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATTTATGTGCCATTCCGGGAGGCAAGAATTAAAGGCATGCCATTATGCCTAGTGCCTACAACACACTGTGTCAACTCTAAACGTCACCACGTTTGGGTGAATTCTATATTGTGACTTGCAATGAACGTCATTGTACATGTTGGCATACCTTATATAACTTGCCCTGTGATTTCCCCAAGAGGATTAGGTTTCCATGCTTGTTGCACACGCCTTTTCATCCATGTCTATTTGTAACACAGCTACTGCACAAATTGTGTGTACTTGCCTATAGTCTGAGTGGCACAAACAATACAGGATTATCAATTGCTTTTCTTTAGGGTACAGTCATATATCTGTTCATATGGAATACATTTCTGTTTCACTGTTACAGTACAAATGCTTCATCCTGCAATTTTCCATCTTACAGCACTGGAATAGTGACATTCAATTTCCTCAGTAATGGGTCATTAACTTTTGTTAAAAACAAAAGAACCAAATTAAAGGTAAGTAAGGATTTTGTAGAGAAAAATGCAAAGCTAACATTAAATCTGTTTTTCTTTTCCTTTGTTTTTATTGTGTTCTTCATAGCTGCCTGTATCTTAACTTAAGCCAGTGAAAATACTGAATTAGTTCCTAACAAATGTTGTACTTTCACACCCCCAAAAGAATGACTAAGAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAagacacacggagctactaccggcagctacttgtcatggctacagaaatcggcagtgctgatcatttgctgataattgcctctatgtgtgttttggcgggggcaattcccagtattgtctGTG
  5   1   2       bld Ova1      in                         CABE1332.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCCATTCCGGGAGGCAAGAATTAAAGGCATGCCATTATGCCTAGTGCCTACAACACACTGTGTCAACTCTAAACGTCACCACGTTTGGGTGAATTCTATATTGTGACTTGCAATGAACGTCATTGTACATGTTGGCATACCTTATATAACTTGCCCTGTGATTTCCCCAAGAGGATTAGGTTTCCATGCTTGTTGCACACGCCTTTTCATCCATGTCTATTTGTAACACAGCTACTGCACAAATTGTGTGTACTTGCCTATAGTCTGAGTGGCACAAACAATACAGGATTATCAATTGCTTTTCTTTAGGGTACAGTCATATATCTGTTCATATGGAATACATTTCTGTTTCACTGTTACAGTACAAATGCTTCATCCTGCAATTTTCCATCTTACAGCACTGGAATAGTGACATTCAATTTCCTCAGTAATGGGTCATTAACTTTTGTTAAAAACAAAAGAACCAAATTAAAGGTAAGTAAGGATTTTGTAGAGAAAAATGCAAAGCTAACATTAAATCTGTTTTTCTTTTCCTTTGTTTTTATTGTGTTCTTCATAGCTGCCTGTATCTTAACTTAAGCCAGTGAAAATACTGAATTAGTTCCTAACAAATGTTGTACTTTCACACCCCCAAAAGAATGACTAANAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAagacacacggagctactaccagcagctacttgtcatggctacagaaatcggcaatgctgatcatttactga
  5   1   2       bld Ova1      in                         CABE6840.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTAGTGCCTACAACACACTCTGTCAACTCTAAACGTCACCACGTTTGGGTGAATTCTATATTGTGACTTGCAATGAACGTCATTGTACATGTTGGCATACCTTATATAACTTGCCCTGTGATTTCCCCAAGAGGATTAGGTTTCCATGCTTGTTGCACACGCCTTTTCATCCATGTCTATTTGTAACACAGCTACTGCACAAATTGTGTGTACTTGCCTATAGTCTGAGTGGCACAAACAATACAGGATTATCAATTGCTTTTCTTTAGGGTACAGTCATATATCTGTTCATATGGAATACATTTCTGTTTCACTGTTACAGTACAAATGCTTCATCCTGCAATTTTCCATCTTACAGCACTGGAATAGTGACATTCAATTTCCTCAGTAATGGGTCATTAACTTTTGTTAAAAACAAAAGAACCAAATTAAAGGTAAGTAAGGATTTTGTAGAGAAAAATGCAAAGCTAACATTAAATCTGTTTTTCTTTTCCTTTGTTTTTATTGTGTTCTTCATAGCTGCCTGTATCTTAACTTAAGCCAGTGAAAATACTGAATTAGTTCCTAACAAATGTTGTACTTTCACACCCCCAAAAGAATGACTAAGAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAagacacacggagctactaccagcagctacttgtcatggctacagaaatcggcaatgctgatcatttactgataattgcctctatgtgtgttttagcagaggcaattcccagtattgtctatggcaggtattttctggcgttta
  3   1   2       bld Brn3 FL   in                         CAAK2693.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGTCATTGTACATGTTGGCATACCTAATATAACTTGCCCTGTGATTCCCCAAGAGGATTAGGTTTCCATGCTTGTTGCACACGCCTTTTCATCCATGTCTATTTGTAACACAGCTACTGCACAAATTGTGTGTACTTGCCTATAGTCTGAGTGGCACAAACAATACAGGATTATCAATTGCTTTTCTTTAGGGTACAGTCATATATCTGTTCATATGGAATACATTTCTGTTTCACTGTTACAGTACAAATGCTTCATCCTGCAATTTTCCATCTTACAGCACTGGAATAGTGACATTCAATTTCCTCAGTAATGGGTCATTAACTTTTGTTAAAAACAAAAGAACCAAATTAAAGGTAAGTAAGGATTTTGTAGAGAAAAATGCAAAGCTAACATTAAATCTGTTTTTCTTTTCCTTTGTTTTTATTGTGTTCTTCATAGCTGCCTGTATCTTAACTTAAGCCAGTGAAAATACTGAATTAGTTCCTAACAAATGTTGTACTTTCACACCCCCAAAAGAATGACTAAGAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAagacacacggagctactaccagcagctacttgtcatggctacagaaatcggcaatgctgatcatttactgataattgcctctatgtgtgttttagcagaggcaattcccagtattgtctatggcaggtattttctggcgtttagtagtctttacaagtagctgctactaagtagctcagtgtCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTAC
  5   1   2       bld Egg                            TEgg098d21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGGGGGGTCATTAACTTTTGTTAAAAACAAAAGAACCAAATTAAAGGTAAGTAAGGATTTTGTAGAGAAAAATGCAAAGCTAACATTAAATCTGTTTTTCTTTTCCTTTGTTTTTATTGTGTTCTTCATAGCTGCCTGTATCTTAACTTAAGCCAGTGAAAATACTGAATTAGTTCCTAACAAATGTTGTACTTTCACACCCCCAAAAGAATGACTAAGAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAagacacacggagctactaccagcagctacttgtcatggctacagaaatcggcaatgctgatcgtttactgataattgcctctatgtgtgttttagcagaggcaattcccagtattgtctgtggcaggtattttctggcgtttagtAGTCTTTACGGGTGGCTGCTACTAAGTAGCTCAGTGTCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTACAAAAAATGAATAATTCCACTCCTGTTTATAATGACTAAAAGTATTTACATAGTAGGAATGCCCTCTATACACAATGGGCACATCCTATGTTTTCTAGATTGACT
  3   1   2       bld Ova1      in                         CABE6420.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGCAAAGCTAACATTAAATCTGTTTTTCTTTCCTTGTTTTTATTGTGTTCTTCATAGCTGCCTGTATCTTAACTTAAGCCAGTGAAAATACTGAATTAGTTCCTAACAAATGTTGTACTTTCACACCCCCAAAAGAATGACTAAGAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAagacacacggagctactaccggcagctacttgtcatggctacagaaatcggcagtgctgatcatttgctgataattgcctctatgtgtgttttggcgggggcaattcccagtattgtctgtggcaggtattttctggcgtttagtAGTCTTTACGGGTAGCTGCTACTAAGTAGCTCAGTGTCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTACAAAAAATGAATAATTCCACTCCTGTTTATAATGACTAAAAGTATTTACATAGTAGGAATGCCCTCTATACACAATGGGCACATCCTATGTTTTCTAGATTGACTGTAACATAAAATCTTCTTTACAGACATTTGCCATATTTCCCTTAAATCAGTTTTTCTTTGTGTTGTATTGCTGACAAGGTATGAGATGTACCACATGTGTATGAATGGTTTTGCTTGTCTCTGTTTGCAAGATCTGATTGGTGATCACTTTGAATGACAGGTATATGTATACTGCTGCGAAAAATGAAATATCGAATTCATTGTCTTAAATGTATTTCAACTTGTGCAAGAAAGTTTGTTCTTTTTTTGTTTTACCACCAATGCTGTGGACATATTATTAAAATGTCTAAAAGTTG
  5  -1   2       bld Ovi1      in                        CABI13057.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATCCTGTTTTTCTTTTTCCTTTGTTTTTATTGTGTTCTTCATAGCTGCCTGTATCTTAACTTAAGCCAGTGAAAATACTGAATTAGTTCCTAACAAATGTTGTACTTTCACACCCCCAAAAGAATGACTAAGAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAagacacacggagctactaccagcagctacttgtcgtggctacggagatcggcagtgctggtcatttgctgatggttgcctctatgtgtgttttggcggaggcagttcccagtgttgtctgtggcaggtattttctggcgtttggtagtctttacaagtagctgctactaagtagctcagtgtCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTACAAAAAATGAATAATTCCACTCCTGTTTATAATGACTAAAAGTATTTACATAGTAGGAATGCCCTCTATACACAATGGGCACATCCTATGTTTTCTAGATTGACTGTAACATAAAATCTTCTTTACAGACATTTGCCATATTTCCCTTAAATCAGTTTTTCTTTGTGTTGTATTGCTGACAAGGTATGAGATGTACCACATGTGTATGAATGGTTTTGCTTGTCTCTGTTTGCAAGATCTGATTGGTGATCACTTTGAATGACAGGTATATGTATACTGCTGCGAAAAATGAAATATCGAATTCATTGTCTTAAATGTATTTCAACTTGTGCAAGAAAGTTTGTTCTTTTTTTGTTTTACCACCAATGCTGTGGACATATTATTAAAATGTCTAAAAGTT
  3   1   2       bld Brn2      in                        CAAJ12747.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTTTATGTGTTTCTTCATAGCTGCCTGTATCTTAACTTAAGCCAGTGAAAATACTGAATTAGTTCCTAACAAATGTTGTACTTTCACACCCCCAAAAGAATGACTAAGAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAagacacacggagctactaccagcagctacttgtcatggctacagaaatcggcaatgctgatcatttactgataattgcctctatgtgtgttttagcagaggcaattcccagtattgtctatggcaggtattttctggcgtttagtagtctttacaagtagctgctactaagtagctcagtgtCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTACAAAAAATGAATAATTCCACTCCTGTTTATAATGACTAAAAGTATTTACATAGTAGGAATGCCCTCTATACACAATGGGCACATCCTATGTTTTCTAGATTGACTGTAACATAAAATCTTCTTTACAGACATTTGCCATATTTCCCTTAAATCAGTTTTTCTTTGTGTTGTATTGCTGACAAGGTATGAGATGTACCACATGTGTATGAATGGTTTTGCTTGTCTCTGTTTGCAAGATCTGATTGGTGATCACTTTGAATGACAGGTATATGTATACTGCTGCGAAAAATGAAATATCGAATTCATTGTCTTAAATGTATTTCAACTTGTGCAAGAAAGTTTGTTCTTTTTTTGTTTTACCACCAATGCTGTGGACATATTATTAAAATGTCTAAAAGTT
  3   1   2       bld Brn2      in                        CAAJ24281.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTTATGTGTTTCTTCATAGCTGCCTGTATCTTAACTTAAGCCAGTGAAAATACTGAATTAGTTCCTAACAAATGTTGTACTTTCACACCCCCAAAAGAATGACTAAGAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAagacacacggagctactaccagcagctacttgtcatggctacagaaatcggcaatgctgatcatttactgataattgcctctatgtgtgttttagcagaggcaattcccagtattgtctatggcaggtattttctggcgtttagtagtctttacaagtagctgctactaagtagctcagtgtCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTACAAAAAATGAATAATTCCACTCCTGTTTATAATGACTAAAAGTATTTACATAGTAGGAATGCCCTCTATACACAATGGGCACATCCTATGTTTTCTAGATTGACTGTAACATAAAATCTTCTTTACAGACATTTGCCATATTTCCCTTAAATCAGTTTTTCTTTGTGTTGTATTGCTGACAAGGTATGAGATGTACCACATGTGTATGAATGGTTTTGCTTGTCTCTGTTTGCAAGATCTGATTGGTGATCACTTTGAATGACAGGTATATGTATACTGCTGCGAAAAATGAAATATCGAATTCATTGTCTTAAATGTATTTCAACTTGTGCAAGAAAGTTTGTTCTTTTTTTGTTTTACCACCAATGCTGTGGACATATTATTAAAATGTCTAAAAGTT
  3   1   2      seed Brn4      in                         CAAL8876.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAACTTAAGCCAGTGAAAATACTGAATTAGTTCCTAACAAATGTTGTACTTTCACACCCCCAAAAGAATGACTAAGAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAagacacacggagctactaccagcagctacttgtcatggctacagaaatcggcaatgctgatcatttactgataattgcctctatgtgtgttttagcagaggcaattcccagtattgtctatggcaggtattttctggcgtttagtagtctttacaagtagctgctactaagtagctcagtgtCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTACAAAAAATGAATAATTCCACTCCTGTTTATAATGACTAAAAGTATTTACATAGTAGGAATGCCCTCTATACACAATGGGCACATCCTATGTTTTCTAGATTGACTGTAACATAAAATCTTCTTTACAGACATTTGCCATATTTCCCTTAAATCAGTTTTTCTTTGTGTTGTATTGCTGACAAGGTATGAGATGTACCACATGTGTATGAATGGTTTTGCTTGTCTCTGTTTGCAAGATCTGATTGGTGATCACTTTGAATGACAGGTATATGTATACTGCTGCGAAAAATGAAATATCGAATTCATTGTCTTAAATGTATTTCAACTTGTGCAAGAAAGTTTGTTCTTTTTTTGTTTTACCACCAATGCTGTGGACATATTATTAAAATGTCTAAAAGTTTTTGTC
  5  -1   2       bld Ova1      in                         CABE2630.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTTAAGCCAGTGAAAATACTGAATTAGTTCCTAACAAATGTTGTACTTTCACACCCCCAAAAGAATGACTAAGAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAagacacacggagctactaccagcagctacttgtcatggctacagaaatcggcaatgctgatcatttactgataattgcctctatgtgtgttttagcagaggcaattcccagtattgtctatggcaggtattttctggcgtttagtagtctttacaagtagctgctactaagtagctcagtgtCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTACAAAAAATGAATAATTCCACTCCTGTTTATAATGACTAAAAGTATTTACATAGTAGGAATGCCCTCTATACACAATGGGCACATCCTATGTTTTCTAGATTGACTGTAACATAAAATCTTCTTTACAGACATTTGCCATATTTCCCTTAAATCAGTTTTTCTTTGTGTTGTATTGCTGACAAGGTATGAGATGTACCACATGTGTATGAATGGTTTTGCTTGTCTCTGTTTGCAAGATCTGATTGGTGATCACTTTGAATGACAGGTATATGTATACTGCTGCGAAAAATGAAATATCGAATTCATTGTCTTAAATGTATTTCAACTTGTGCAAGAAAGTTTGTTCTTTTTTTGTTTTACCACCAATGCTGTGGACATATTATTAAAATGTCTAAAAGTT
  3   1   2       bld Ova1      in                         CABE6840.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTTAAGCCAGTGAAAATACTGAATTAGTTCCTAACAAATGTTGTACTTTCACACCCCCAAAAGAATGACTAAGAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAagacacacggagctactaccagcagctacttgtcatggctacagaaatcggcaatgctgatcatttactgataattgcctctatgtgtgttttagcagaggcaattcccagtattgtctatggcaggtattttctggcgtttagtagtctttacaagtagctgctactaagtagctcagtgtCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTACAAAAAATGAATAATTCCACTCCTGTTTATAATGACTAAAAGTATTTACATAGTAGGAATGCCCTCTATACACAATGGGCACATCCTATGTTTTCTAGATTGACTGTAACATAAAATCTTCTTTACAGACATTTGCCATATTTCCCTTAAATCAGTTTTTCTTTGTGTTGTATTGCTGACAAGGTATGAGATGTACCACATGTGTATGAATGGTTTTGCTTGTCTCTGTTTGCAAGATCTGATTGGTGATCACTTTGAATGACAGGTATATGTATACTGCTGCGAAAAATGAAATATCGAATTCATTGTCTTAAATGTATTTCAACTTGTGCAAGAAAGTTTGTTCTTTTTTTGTTTTACCACCAATGCTGTGGACATATTATTAAAATGTCTAAAGGTT
  3   1   2       bld TbA                             TTbA074e23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATACTGAATTAGTTCCTAACAAATGTTGTACTTTCACACCCCCAAAAGAATGACTAAGAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAagacacacggagctactaccagcagctacttgtcatggctacagaaatcggcaatgctgatcatttactgataattgcctctatgtgtgttttagcagaggcaattcccagtattgtttatggcaggtattttctggcgtttagtagtctttacaagtagctgctactaagtagctcagtgtCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTACAAAAAATGAATAATTCCACTCCTGTTTATAATGACTAAAAGTATTTACATAGTAGGAATGCCCTCTATACACAATGGGCACATCCTATGTTTTTTAGATTGACTGTAACATAAAATTTTCTTTACAGACATTTGCCATATTTCCCTTAAATCAGTTTTTTTTTGTGTTGTATTGCTGACAAGGTATGAGATGTACCACATGTGTATGAATGGTTTTGCTTGTCTCTGTTTGCAAGATTTGATTGGTGATCACTTTGAATGACAGGTATATGTATACTGCTGCGAAAAATGAAATATCGAATTCATTGTCTTAAATGTATTTCAACTTGTGCAAGAAAGTTTGTTCTTTTTTTGTTTTACCCCCAATGCTGTGGACATATTATTAAAATGTCTAAAAGTTaaaaaaaaaaaaaaaaaaaaaccaaaaaaaaaaaaaaaaaaG
  3   1   2       bld Ova1      in                         CABE1332.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATACTGAATTAGTTCCTAACAAATGTTGTACTTTCACACCCCCAAAAGAATGACTAAAAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAagacacacggagctactaccagcagctacttgtcatggctacagaaatcggcaatgctgatcatttactgataattgcctctatgtgtgttttagcagaggcaattcccagtattgtctatggcaggtattttctggcgtttagtagtctttacaagtagctgctactaagtagctcagtgtCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTACAAAAAATGAATAATTCCACTCCTGTTTATAATGACTAAAAGTATTTACATAGTAGGAATGCCCTCTATACACAATGGGCACATCCTATGTTTTCTAGATTGACTGTAACATAAAATCTTCTTTACAGACATTTGCCATATTTCCCTTAAATCAGTTTTTCTTTGTGTTGTATTGCTGACAAGGTATGAGATGTACCACATGTGTATGAATGGTTTTGCTTGTCTCTGTTTGCAAGATCTGATTGGTGATCACTTTGAATGACAGGTATATGTATACTGCTGCGAAAAATGAAATATCGAATTCATTGTCTTAAATGTATTTCAACTTGTGCAAGAAAGTTTGTTCTTTTTTTGTTTTACCACCAATGCTGTGGACATATTATTAAAATGTCTAAAAGTTAAAAAAAAAAAAAAAG
  3   1   2       bld Brn4      in                        CAAL18212.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACTGAATTAGTTCCTAACAAATGTTGTACTTTCACACCCCCAAAAGAATGACTAAGAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAagacacacggagctactaccagcagctacttgtcatggctacagaaatcggcaatgctgatcatttactgataattgcctctatgtgtgttttagcagaggcaattcccagtattgtctatggcaggtattttctggcgtttagtagtctttacaagtagctgctactaagtagctcagtgtCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTACAAAAAATGAATAATTCCACTCCTGTTTATAATGACTAAAAGTATTTACATAGTAGGAATGCCCTCTATACACAATGGGCACATCCTATGTTTTCTAGATTGACTGTAACATAAAATCTTCTTTACAGACATTTGCCATATTTCCCTTAAATCAGTTTTTCTTTGTGTTGTATTGCTGACAAGGTATGAGATGTACCACATGTGTATGAATGGTTTTGCTTGTCTCTGTTTGCAAGATCTGATTGGTGATCACTTTGAATGACAGGTATATGTATACTGCTGCGAAAAATGAAATATCGAATTCATTGTCTTAAATGTATTTCAACTTGTGCAAGAAAGTTTGTTCTTTTTTTGTTTTACCACCAATGCTGTGGACATATTATTAAAATGTCTAAAAGTT
  3   1   2       bld Te5       in                         CAAO4303.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTACTTTCACACCCCCAAAAGAATGACTAAGAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAagacacacggagctactaccagcagctacttgtcatggctacagaaatcggcaatgctgatcatttactgataattgcctctatgtgtgttttagcagaggcaattcccagtattgtctatggcaggtattttctggcgtttagtagtctttacaagtagctgctactaagtagctcagtgtCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTACAAAAAATGAATAATTCCACTCCTGTTTATAATGACTAAAAGTATTTACATAGTAGGAATGCCCTCTATACACAATGGGCACATCCTATGTTTTCTAGATTGACTGTAACATAAAATCTTCTTTACAGACATTTGCCATATTTCCCTTAAATCAGTTTTTCTTTGTGTTGTATTGCTGACAAGGTATGAGATGTACCACATGTGTATGAATGGTTTTGCTTGTCTCTGTTTGCAAGATCTGATTGGTGATCACTTTGAATGACAGGTATATGTATACTGCTGCGAAAAATGAAATATCGAATTCATTGTCTTAAATGTATTTCAACTTGTGCAAGAAAGTTTGTTCTTTTTTTGTTTTACCACCAATGCTGTGGACATATTATTAAAATGTCTAAAAGTT
  3   1   2       bld HdA       in                   THdA014c20.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAATGACTAAGAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAagacacacggagctactaccagcagctacttgtcatggctacagaaatcggcaatgctgatcatttactgataattgcctctatgtgtgttttagcagaggcaattcccagtattgtctatggcaggtattttctggcgtttagtagtctttacaagtagctgctactaagtagctcagtgtCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTACAAAAAATGAATAATTCCACTCCTGTTTATAATGACTAAAAGTATTTACATAGTAGGAATGCCCTCTATACACAATGGGCACATCCTATGTTTTCTAGATTGACTGTAACATAAAATCTTCTTTACAGACATTTGCCATATTTCCCTTAAATCAGTTTTTCTTTGTGTTGTATTGCTGACAAGGTATGAGATGTACCACATGTGTATGAATGGTTTTGCTTGTCTCTGTTTGCAAGATCTGATTGGTGATCACTTTGAATGACAGGTATATGTATACTGCTGCGAAAAATGAAATATCGAATTCATTGTCTTAAATGTATTTCAACTTGTGCAAGAAAGTTTGTTCTTTTTTTGTTTTACCACCAATGGGGTGGACATATTATTAAAATGTCTAAAAGTTAAAAAAAAAAAAAAAAAAAAGCGCC
  3   1   2       bld Te3       out                        CAAM5104.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGGTATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAagacacacggagctactaccagcagctacttgtcatggctacagaaatcggcaatgctgatcatttactgataattgcctctatgtgtgttttagcagaggcaattcccagtattgtctatggcaggtattttctggcgtttagtagtctttacaagtagctgctactaagtagctcagtgtCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTACAAAAAATGAATAATTCCACTCCTGTTTATAATGACTAAAAGTATTTACATAGTAGGAATGCCCTCTATACACAATGGGCACATCCTATGTTTTCTAGATTGACTGTAACATAAAATCTTCTTTACAGACATTTGCCATATTTCCCTTAAATCAGTTTTTCTTTGTGTTGTATTGCTGACAAGGTATGAGATGTACCACATGTGTATGAATGGTTTTGCTTGTCTCTGTTTGCAAGATCTGATTGGTGATCACTTTGAATGACAGGTATATGTATACTGCTGCGAAAAATGAAATATCGAATTCATTGTCTTAAATGTATTTCAACTTGTGCAAGAAAGTTTGTTCTTTTTTTGTTTTACCACCAATGCTGTGGACATATTATTAAAATGTCTAAAAGTT
  3   1   2       bld Tad5      in                         XZT72520.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATCCATACCATTGTAGGCTTTTGGCAATGTTAATCTTACATCAGCGCAGTGGCACTGGTCTTGCTGAGTAAGGATTAagacacacggagctactaccagcagctacttgtcatggctacagaaatcggcaatgctgatcatttactgataattgcctctatgtgtgttttagcagaggcaattcccagtattgtctatggcaggtattttctggcgtttagtagtctttacaagtagctgctactaagtagctcagtgtCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTACAAAAAATGAATAATTCCACTCCTGTTTATAATGACTAAAAGTATTTACATAGTAGGAATGCCCTCTATACACAATGGGCACATCCTATGTTTTCTAGATTGACTGTAACATAAAATCTTCTTTACAGACATTTGCCATATTTCCCTTAAATCAGTTTTTCTTTGTGTTGTATTGCTGACAAGGTATGAGATGTACCACATGTGTATGAATGGTTTTGCTTGTCTCTGTTTGCAAGATCTGATTGGTGATCACTTTGAATGACAGGTATATGTATACTGCTGCGAAAAATGAAATATCGAATTCATTGTCTTAAATGTATTTCAACTTGTGCAAGAAAGTTTGTTCTTTTTTTGTTTTACCACCAATGCTGTGGACATATTATTAAAATGTCTAAAGGTT
  3   1   2       bld Gas7      in                         XZG15497.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCagcagctacttgtcatggctacagaaatcggcaatgctgatcatttactgataattgcctctatgtgtgtgttagcagaggcaattcccagtattgtctatggcaggtattttctggcgtttagtagtctttacaagtagctgctactaagtagctcagtgtCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTCCAAAAAATGAATAATTCCACTCCTGTTTATAATGACTAAAAGTATTTACATAGTAGGAATGCCCTCTATACACAATGGGCACATCCTATGTTTTCTAGATTGACTGTAACATAAAATCTTCTTTACAGACATTTGCCATATTTCCCTTAAATCAGTTTTTCTTTGTGTTGTATTGCTGACAAGGTATGAGATGTACCACACGTGTATGAATGGTTTTGCTTGTCTCTGTTTGCAAGATCTGATTGGTGATCACTTTGAATGACAGGTATATGTATACTGCTGCGAAAAATGAAATATCGAATTCATTGTCTTAAATGTATTTCAACTTGTGCAAGAAAGTTTGTTCTTTTTTTGTTTTACCCCCAATGCTGTGGACATATTATTAAAATGTCTAAAAGTTAAAAAAAAGAAGAAAAAAATATCGAACAAAAAAGAAAATAAAATCTACTT
  5   1   2       bld Gas       in                  TGas091g03.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGGGGGTCTTTACAAGTAGCTGCTACTAAGTAGCTCAGTGTCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTACAAAAAATGAATAATTCCACTCCTGTTTATAATGACTAAAAGTATTTACATAGTAGGAATGCCCTCTATACACAATGGGCACATCCTATGTTTTCTAGATTGACTGTAACATAAAATCTTCTTTACAGACATTTGCCATATTTCCCTTAAATCAGTTTTTCTTTGTGTTGTATTGCTGACAAGGTATGAGATGTACCACATGTGTATGAATGGTTTTGCTTGTCTCTGTTTGCAAGATCTGATTGGTGATCACTTTGAATGACAGGTATATGTATACTGCTGCGAAAAATGAAATATCGAATTCATTGTCTTAAATGTATTTCAACTTGTGCAAGAAAGTTTGTTCTTTTTTTGTTTTACCACCAATGCTGTGGACATATTATTAAAATGTCTAAAAGTTGAAAAATAGATAAAAATAAAGAAAAAT
  3   1   2       bld Gas       in                    TGas091g03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCTTTACAAGTAGCTGCTACTAAGTAGCTCAGTGTCTTTGCTCTATGGGGATACAAACAATGTCAAAGTCATGACAATTTATACCTACAAAAAATGAATAATTCCACTCCTGTTTATAATGACTAAAAGTATTTACATAGTAGGAATGCCCTCTATACACAATGGGCACATCCTATGTTTTCTAGATTGACTGTAACATAAAATCTTCTTTACAGACATTTGCCATATTTCCCTTAAATCAGTTTTTCTTTGTGTTGTATTGCTGACAAGGTATGAGATGTACCACATGTGTATGAATGGTTTTGCTTGTCTCTGTTTGCAAGATCTGATTGGTGATCACTTTGAATGACAGGTATATGTATACTGCTGCGAAAAATGAAATATCGAATTCATTGTCTTAAATGTATTTCAACTTGTGCAAGAAAGTTTGTTCTTTTTTTGTTTTACCACCAATGCTGTGGACATATTATTAAAATGTAAGAAGTGAAAAATAGATAAAATAAGAAAAATAAAAAAAAAAAAAAAA
  5  -1   2       bld Egg                            TEgg141d20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGTTGTATTGCTGACAAGGTATGAGATGTACCACATGTGTATGAATGGTTTTGCTTGTCTCTGTTTGCAAGATCTGATTGGTGATCACTTTGAATGACAGGTATATGTATACTGCTGCGAAAAATGAAATATCGAATTCATTGTCTTAAATGTATTTCAACTTGTGCAAGAAAGTTTGTTCTTTTTTTGTTTTACCACCAATGCTGTGGACATATTATTAAAATGTCTAAAAGTTAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)