Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABD14205.3                          24 END     4          14       16                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012075714 Xt7.1-CABJ3561.5.5 - 28 ESTs
                                                                       -20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABJ3561.5.5                     CCGGCGGGGATGAAATGACATCAGTTTTGATGCGCTGGCTATAACTTTTCTCATGAAGGAAATATTCGTGTTACATGTTTGTTTAGCTCGGTGTTACGCTAAAATACACTGGACATCGTTCAGTACTTCGGTGCAGTTTGGATCTGTATTTAGGAGTCGTGTTTGCTAAATATGCTTGTCTGATTTATACATTGATATGGAATTGTAAACCAAGCTCTCCATTATACAGGCGTTAATGCTTACAAATATTTCTGTGCTCACAAAGCCATAGCAAGTCCATAGCAAATATTTCTTTTAGTTTCTTTTCCTAGACAGGTATGAGCTTTATTTGGTTATCATTTGCAGATTGTTCATCACATTTACATCCATTCCCCAGTGGGATTTAGAATATGAGATGTCCTGCCTATCACATGCACGCAACCGGCTTGCTTCACTTTCATAGGGGGCTCTGTAACCTGGCTGTATATTTTGTTTTCATTTATAATGTGGAAAGACTAAGCGATTTGCTGGATATGATGGAAAAGTGATTGCTGGACCAGCAGTTGAAAAGATAAAGCTAATGTTGGCTGGTTTCCTAGGGGTTAATATTTTGTCACTAGGACAGAAGTGCAGGATGTGACAGCACAGGCCTCGGATCTAGGGTGGCAATCAATCGATTGGTCTTATTAAGGAATCTCTATCAGCTAATGATTTAACAGAGAGAAGGGTCCCAGAAATCTGAAAATGATCTGTTGTGCTTTGAGACTGCTGAATGTAAAATGCCCAGAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATCATCACTTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAAAAAACAACAAAGACACATTGAGTTCTTACATCTATCCTCTTATTGCAATGTAGACATAAGTTCTTTGTATTCTGCATCGCTAAGGGCAATGGCACATGTTGTGATTTTGGCCACTTCTGTGCTCAGTATTTTTAATATTTTAGAGGGTAATGGCA
                                                  Xt7.1-CHK-1008228527                           GGGATGAAATGACATCAGTTTTGATGCGCTGGCTATAACTTTTCTCATGAAGGAAATATTCGTGTTACATGTTTGTTTAGCTCGGTGTTACGCTAAAATACACTGGACATCGTTCAGTACTTCGGTGCAGTTTGGATCTGTATTTAGGAGTCGTGTTTGCTAAATATGCTTGTCTGATTTATACATTGATATGGAATTGTAAACCAAGCTCTCCATTATACAGGCGTTAATGCTTACAAATATTTCTGTGCTCACAAAGCCATAGCAAGTCCATAGCAAATATTTCTTTTAGTTTCTTTTCCTAGACAGGTATGAGCTTTATTTGGTTATCATTTGCAGATTGTTCATCACATTTACATCCATTCCCCAGTGGGATTTAGAATATGAGATGTCCTGCCTATCACATGCACGCAACCGGCTTGCTTCACTTTCATAGGGGGCTCTGTAACCTGGCTGTATATTTTGTTTTCATTTATAATGTGGAAAGACTAAGCGATTTGCTGGATATGATGGAAAAGTGATTGCTGGACCAGCAGTTGAAAAGATAAAGCTAATGTTGGCTGGTTTCCTAGGGGTTAATATTTTGTCACTAGGACAGAAGTGCAGGATGTGACAGCACAGGCCTCGGATCTAGGGTGGCAATCAATCGATTGGTCTTATTAAGGAATCTCTATCAGCTAATGAxTxxxxAGAGAGAAGGGTCCCAGAAATCTGAAAATGATCTGTTGTGCTTTGAGACTGCTGAATGTAAAATGCCCAGAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATCATCACTTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAxxAxAxxxxxxxGACACATTGAGTTCTTACATCTATCCTCTTATTGCAATGTAGACATAAGTTCTTTGTATTCTGCATCGCTAAGGGCAATGGCACATGTTGTGATTTTGGCCACTTCTGTGCTCAGTATTTTTAATATTTTAGAGGGTAATGGCAAATTGC
                                                      consensus depths                          2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     5     3     6     3     7     3     7     4     8     7     8     7     8     7     8     6     7     6     8     9    11     9    11     9    11     9    11     7    12    11    12    11    13    11    13    11    12    11    12    13    14    14    15    15    16    16    17    15    17    15    17    15    17    15    17    15    16    15    16    15    16    15    16    16    17    16    17    17    18    17    18    17    18    17    18    17    19    17    19    17    19    17    19    17    19    17    20    18    21    18    21    18    21    19    21    19    21    19    21    18    20    18    20    18    20    18    20    20    22    20    22    20    22    20    22    20    22    21    23    21    24    21    24    20    24    20    24    20    24    21    24    20    23    19    22    18    20    18    20    18    20    18    20    18    20    18    20    18    20    18    20    17    20    17    20    16    19    10    18     9    17     8    15     8    14     8    14     8    14     7    13     7    13     7    13     7    13     3     8     2     4     2     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
  5   1   2  SIG                                      Xt7.1-CAAP8391.5 GGTAAACAGCGCGGGTGATGCCGGCGGGGATGAAATGACATCAGTTTTGATGCGCTGGCTATAACTTTTCTCATGAAGGAAATATTCGTGTTACATGTTTGTTTAGCTCGGTGTTACGCTAAAATACACTGGACATCGTTCAGTACTTCGGTGCAGTTTGGATCTGTATTTAGGAGTCGTGTTTGCTAAATATGCTTGTCTGATTTATACATTGATATGGAATTGTAAACCAAGCTCTCCATTATACAGGCGTTAATGCTTACAAATATTTCTGTGCTCACAAAGCCATAGCAAGTCCATAGCAAATATTTCTTTTAGTTTCTTTTCCTAGACAGGTATGAGCTTTATTTGGTTATCATTTGCAGATTGTTCATCACATTTACATCCATTCCCCAGTGGGATTTAGAATATGAGATGTCCTGCCTATCACATGCACGCAACCGGCTTGCTTCACTTTCATAGGGGGCTCTGTAACCTGGCTGTATATTTTGTTTTCATTTATAATGTGGAAAGACTAAGCGATTTGCTGGATATGATGGAAAAGTGATTGCTGGACCAGCAGTTGAAAAGATAAAGCTAATGTTGGCTGGTTTCCTAGGGGTTAATATTTTGTCACTAGGACAGAAGTGCAGGATGTGACAGCACAGGCCTCGGATCTAGGGTGGCAATCAATCGATTGGTCTTATTAAGGAATCTCTATCAGCTAATGATTTAACATTTATATTTGTTTTAGAAATCTGAAAATGATCTGTTGTGCTTTGAGACTGC------------ACACTAGATAGACATTACATGTTAATAATATTTCCTCTCTTCCTTCTATTCATAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATCATCACTTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATGAGTTTGACTTAGGATTTAATAAAATACTTCACCG
  5   1   2  SIG                                      Xt7.1-XZG54187.5                     CCGGCGGGGATGAAATGACGTCAGTTTTGATGCGCTGGCTATAACTTTTCTCATGAAGGAAATATTCGTGTTACATGTTTGTTTAGCTCGGTGTTACGCTAAAATACACTGGACATCGTTCAGTACTTCGGTGCAGTTTGGATCTGTATTTAGGAGTCGTGTTTGCTAAATATGCTTGTCTGATTTATACATTGATATGGAATTGTAAACCAAGCTCTCCATTATACAGGCGTTAATGCTTACAAATATTTCTGTGCTCACAAAGCCATAGCAAGTCCATAGCAAATATTTCTTTTAGTTTCTTTTCCTAGACAGGTATGAGCTTTATTTGGTTATCATTTGCAGATTGTTCATCACATTTACATCCATTCCCCAGTGGGATTTAGAATATGAGATGTCCTGCCTATCACATGCACGCAACCGGCTTGCTTCACTTTCATAGGGGGCTCTGTAACCTGGCTGTATATTTTGTTATCATTTATAATGTGGAAAGACTAAGCGATTTGCTGGATATGATGGAAAAGTGATTGCTGGACCAGCAGTTGAAAAGATAAAGCTAATGTTGGCTGGTTTCCTAGGGGTTAATATTTTGTCACTAGGACAGAAGTGCAGGATGTGACAGCACAGGCCTCGGATCTAGGGTGGCAATCAATCGATTGGTCTTATTAAGGAATCTCTATCAGCTAATGATTTAACATTTATATTTGTTTTAGAAATCTGAAAATGATCTGTTGTGCTTTGAGACTGCTGAATGTAAAATGCCCAGAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATAATAAATTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAGTACAAGTACTTGTTTCTGTGGACACATTGAGTTCTTACATCTATCCTCTTATTGCAATGTAGACATAAGTTCTTTGTATTCTGCATCGCTAAGGGCAATGGCACATGTTGTGATTTTGGCCACTTCTGTGCTCAGTATTTTTAATATTTTAGAGGGTAATGGCAAATTGCCTGAATTTGTGCCCACCCCCCTTGTGAGCTATGGTAACATCCTGAAGTGTTAAGCGCTACCCACGCTGTTGTTGATTGATAACATGTCAATCCGCATTTCCAGGCAACAGTCACCTGACAAACTTTCAGGCAATTACCACAGCATGCAGTGGAGGGCAAATTGGTACTGGTGCAAAGTTTCCCAGTGTGTCATATCCCTAAAAGAATGCAGTAATGAATTAGCTAATTTTTAAAGGGATAGAACCTGCAGATTTGCAAACTAGAAGTGTCAAAGCACTTAAGGGGTCACAACCACTGTGTAGACCATATACACTGGATATAAAAAGTCTATACACCCCTGCAAAATGGCAGGTT
  5   1   2                                           Xt7.1-CABJ3077.3                                                                                                                                                                    CTGTATTTAGGAGTCGTGTTTGCTAAATATGCTTGTCTGATTTATACATTGATATGGAATTGTAAACCAAGCTCTCCATTATACAGGCGTTAATGCTTACAAATATTTCTGTGCTCACAAAGCCATAGCAAGTCCATAGCAAATATTTCTTTTAGTTTCTTTTCCTAGACAGGTATGAGCTTTATTTGGTTATCATTTGCAGATTGTTCATCACATTTACATCCATTCCCCAGTGGGATTTAGAATATGAGATGTCCTGCCTATCACATGCACGCAACCGGCTTGCTTCACTTTCATAGGGGGCTCTGTAACCTGGCTGTATATTTTGTTTTCATTTATAATGTGGAAAGACTAAGCGATTTGCTGGATATGATGGAAAAGTGATTGCTGGACCAGCAGTTGAAAAGATAAAGCTAATGTTGGCTGGTTTCCTAGGGGTTAATATTTTGTCACTAGGACAGAAGTGCAGGATGTGACAGCACAGGCCTCGGATCTAGGGTGGCAATCAATCGATTGGTCTTATTAAGGAATCTCTATCAGCTAATGATTTAACATTTATATTTGTTTTAGAAATCTGAAAATGATCTGTTGTGCTTTGAGACTGCTGAATGTAAAATGCCCAGAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATCATCACTTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAGTACAAGTACTTGTTTCTGTGGACACATTGAGTTCTTACATCTATCCTCTTATTGCAATGCAGACATAAGTTCTTTGTATTCTGCATCGCTAAGGGCAATGGCACATGTTGTGATTTTGGCCACTTCTGTGCTCAGTATTTTTAATATTTTAGAGGGTAATGGCAAATTGCCTGAATTTGTGCCCACCACTTTCAGGCAATTACCACAGCATGCAGTGGAGGGCAAATTGGTACTGGTGCAAAGTTGCCCAGTGTGTCATATCCCTAAAAGAATGCAGTAATGAATTAGCTAATTTTTAAAGGGATAGAACCTGCAGATTTGCAAACTAGAAGTGTCAAAGCACTCAAGGGGTCACAACCACTGTGTAGACCATATACATTGGATATGGGGGGTCTATACACCCCTGCAAAATGGCAGGTTTTTGCTTAACAAAAAAAAAAACAAGATAAATCCTGCCACAACTTATTCCACATTTATTGCAAAATAAACAAATCAGAAACCTTTTAGTGAAAGAAGGAAAAGCAAA
  5   1   2  SIG                                      Xt7.1-CABJ3561.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCGGAGTTGTTTTCGCCATGTTTTCTCAGGCGATCCAGTAGGGGAGCTCGCTAGAGAGAAGGGTCCCAGAAATCTGAAAATGATCTGTTGTGCTTTGAGACTGCTGAATGTAAAATGCCCAGAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATCATCACTTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAGTACAAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCGATCCAGTAGGGGAGCTCGCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTATATTTGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACATAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -TT---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------A--
                                               BLH ATG     846     605                     
                                               BLH MIN     846     112                     
                                               BLH MPR     822     112                     
                                               BLH OVR     846     520                     
                                               CDS MIN     846     112                     
                                               ORF LNG     846      14                     
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Bb ---= 3e-017     BAE95627.1 GTP binding protein Rho [Branchiostoma belcheri] =========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Br ---- 9e-023     ABB85359.1 Ran [Branchiostoma belcheri tsingtaunese] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ci ==== 6e-026     BAC57527.1 GTP-binding protein rab-2 homologue [Ciona intestinalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Sc ==== 2e-048     NP_013713.1 Gtp-binding protein of the rab family; required for homotypic fusion event invacuole inheritance, for endosome-endosome fusion, and for fusion of endosomesto vacuoles when expressed from high copy plasmid; Ypt7p [Saccharomycescerevisiae] ==================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ==== 4e-052     NP_496549.1 RAB family RAB-7 (23.4 kD) (rab-7) [Caenorhabditis elegans] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dm ==== 3e-052     NP_524472.1 Rab-protein 7 CG5915-PA [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Sp ==== 7e-072     XP_782831.1 PREDICTED: similar to Ras-related protein Rab-9A (Rab-9) [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Dr ==== 7e-097     NP_001038931.1 hypothetical protein LOC751756 [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 2e-102     NP_062747.1 RAB9, member RAS oncogene family; Sid6061p; SID 99 [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Gg ==== 3e-104     NP_001008678.1 similar to Ras-related protein Rab-9A (Rab-9) [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 3e-105     NP_004242.1 RAB9A, member RAS oncogene family; RAB9, member RAS oncogene family [Homosapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 3e-111     AAH68782.1 MGC81321 protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === ?? ==== 3e-111     NP_001084671.1 RAB9A, member RAS oncogene family [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Xt ==== 9e-115     NP_001072637.1 hypothetical protein LOC780093 [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABJ3561.5.5                              ATG---TGA---------TGA---------------------------------------------------------------------TAA------------------------------------------------TAG------------------ATG------TGA---------TGA------------------------------------------------------------------------------------TAG------------------------------------TGA---------------------------------------------------------------------TGA------------------------------------------------------------------------------------------ATG---------TAA---------------TGA---------------------------TGA------------------------------------TAA---------------------------------------------------------------------------------TAA---------------TAATGA---------------------------------ATG---------------------------------------------------TGA------------------------------------------TAA---------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---TAG---------------------------------------------------------------TAA---------------ATGTAG---------------------------------------------------------------TAA------------TAA---------------------------ATG---------------TAA---------------TAG------------------------------------------------------------------------ATGTAG---TAA---------------------TAA------------ATG---TGA------------------------------------TAG------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  5   1   2  SIG                                      Xt7.1-CAAP8391.5 GGTAAACAGCGCGGGTGATGCCGGCGGGGATGAAATGACATCAGTTTTGATGCGCTGGCTATAACTTTTCTCATGAAGGAAATATTCGTGTTACATGTTTGTTTAGCTCGGTGTTACGCTAAAATACACTGGACATCGTTCAGTACTTCGGTGCAGTTTGGATCTGTATTTAGGAGTCGTGTTTGCTAAATATGCTTGTCTGATTTATACATTGATATGGAATTGTAAACCAAGCTCTCCATTATACAGGCGTTAATGCTTACAAATATTTCTGTGCTCACAAAGCCATAGCAAGTCCATAGCAAATATTTCTTTTAGTTTCTTTTCCTAGACAGGTATGAGCTTTATTTGGTTATCATTTGCAGATTGTTCATCACATTTACATCCATTCCCCAGTGGGATTTAGAATATGAGATGTCCTGCCTATCACATGCACGCAACCGGCTTGCTTCACTTTCATAGGGGGCTCTGTAACCTGGCTGTATATTTTGTTTTCATTTATAATGTGGAAAGACTAAGCGATTTGCTGGATATGATGGAAAAGTGATTGCTGGACCAGCAGTTGAAAAGATAAAGCTAATGTTGGCTGGTTTCCTAGGGGTTAATATTTTGTCACTAGGACAGAAGTGCAGGATGTGACAGCACAGGCCTCGGATCTAGGGTGGCAATCAATCGATTGGTCTTATTAAGGAATCTCTATCAGCTAATGATTTAACATTTATATTTGTTTTAGAAATCTGAAAATGATCTGTTGTGCTTTGAGACTGC------------ACACTAGATAGACATTACATGTTAATAATATTTCCTCTCTTCCTTCTATTCATAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATCATCACTTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATGAGTTTGACTTAGGATTTAATAAAATACTTCACCG
                                                  Xt7.1-CHK-1008294262       CAGCGCGGGTGATGCCGGCGGGGATGAAATGACATCAGTTTTGATGCGCTGGCTATAACTTTTCTCATGAAGGAAATATTCGTGTTACATGTTTGTTTAGCTCGGTGTTACGCTAAAATACACTGGACATCGTTCAGTACTTCGGTGCAGTTTGGATCTGTATTTAGGAGTCGTGTTTGCTAAATATGCTTGTCTGATTTATACATTGATATGGAATTGTAAACCAAGCTCTCCATTATACAGGCGTTAATGCTTACAAATATTTCTGTGCTCACAAAGCCATAGCAAGTCCATAGCAAATATTTCTTTTAGTTTCTTTTCCTAGACAGGTATGAGCTTTATTTGGTTATCATTTGCAGATTGTTCATCACATTTACATCCATTCCCCAGTGGGATTTAGAATATGAGATGTCCTGCCTATCACATGCACGCAACCGGCTTGCTTCACTTTCATAGGGGGCTCTGTAACCTGGCTGTATATTTTGTTTTCATTTATAATGTGGAAAGACTAAGCGATTTGCTGGATATGATGGAAAAGTGATTGCTGGACCAGCAGTTGAAAAGATAAAGCTAATGTTGGCTGGTTTCCTAGGGGTTAATATTTTGTCACTAGGACAGAAGTGCAGGATGTGACAGCACAGGCCTCGGATCTAGGGTGGCAATCAATCGATTGGTCTTATTAAGGAATCTCTATCAGCTAATGATTTAACATTTATATTTGTTTTAGAAATCTGAAAATGATCTGTTGTGCTTTGA------------------------GATAGACATTACATGTTAATAATATTTCCTCTCTTCCTTCTATTCATAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATCATCACTTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATGAGTTTGACTTAGGATTTAATAAAATACT
  5   1   4      seed Thy1      in                        CBST5134.fwd GGTAAACAGCGCGGGTGATGCCGGCGGGGATGAAATGACATCAGTTTTGATGCGCTGGCTATAACTTTTCTCATGAAGGAAATATTCGTGTTACATGTTTGTTTAGCTCGGTGTTACGCTAAAATACACTGGACATCGTTCAGTACTTCGGTGCAGTTTGGATCTGTATTTAGGAGTCGTGTTTGCTAAATATGCTTGTCTGATTTATACATTGATATGGAATTGTAAACCAAGCTCTCCATTATACAGGCGTTAATGCTTACAAATATTTCTGTGCTCACAAAGCCATAGCAAGTCCATAGCAAATATTTCTTTTAGTTTCTTTTCCTAGACAGGTATGAGCTTTATTTGGTTATCATTTGCAGATTGTTCATCACATTTACATCCATTCCCCAGTGGGATTTAGAATATGAGATGTCCTGCCTATCACATGCACGCAACCGGCTTGCTTCACTTTCATAGGGGGCTCTGTAACCTGGCTGTATATTTTGTTTTCATTTATAATGTGGAAAGACTAAGCGATTTGCTGGATATGATGGAAAAGTGATTGCTGGACCAGCAGTTGAAAAGATAAAGCTAATGTTGGCTGGTTTCCTAGGGGTTAATATTTTGTCACTAGGACAGAAGTGCAGGATGTGACAGCACAGGCCTCGGATCTAGGGTGGCAATCAATCGATTGGTCTTATTAAGGAATCTCTATCAGCTAATGATTTAACATTTATATTTGTTTTAGAAATCTGAAAATGATCTGTTGTGCTTTGAGACTGC
  5   1   2   30  ext Int1 5g3  out                        CAAP8391.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTACACTAGATAGACATTACATGTTAATAATATTTCCTCTCTTCCTTCTATTCATAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATCATCACTTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAANACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAGAATATCTAATATTAGGTCTGTGAGGACATCAA
  3   1   4      seed Thy1      in                        CBST5134.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATGAGTTTGACTTAGGATTTAATAAAATACTTCACCG
  5   1   2  SIG                                      Xt7.1-XZG54187.5                     CCGGCGGGGATGAAATGACGTCAGTTTTGATGCGCTGGCTATAACTTTTCTCATGAAGGAAATATTCGTGTTACATGTTTGTTTAGCTCGGTGTTACGCTAAAATACACTGGACATCGTTCAGTACTTCGGTGCAGTTTGGATCTGTATTTAGGAGTCGTGTTTGCTAAATATGCTTGTCTGATTTATACATTGATATGGAATTGTAAACCAAGCTCTCCATTATACAGGCGTTAATGCTTACAAATATTTCTGTGCTCACAAAGCCATAGCAAGTCCATAGCAAATATTTCTTTTAGTTTCTTTTCCTAGACAGGTATGAGCTTTATTTGGTTATCATTTGCAGATTGTTCATCACATTTACATCCATTCCCCAGTGGGATTTAGAATATGAGATGTCCTGCCTATCACATGCACGCAACCGGCTTGCTTCACTTTCATAGGGGGCTCTGTAACCTGGCTGTATATTTTGTTATCATTTATAATGTGGAAAGACTAAGCGATTTGCTGGATATGATGGAAAAGTGATTGCTGGACCAGCAGTTGAAAAGATAAAGCTAATGTTGGCTGGTTTCCTAGGGGTTAATATTTTGTCACTAGGACAGAAGTGCAGGATGTGACAGCACAGGCCTCGGATCTAGGGTGGCAATCAATCGATTGGTCTTATTAAGGAATCTCTATCAGCTAATGATTTAACATTTATATTTGTTTTAGAAATCTGAAAATGATCTGTTGTGCTTTGAGACTGCTGAATGTAAAATGCCCAGAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATAATAAATTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAGTACAAGTACTTGTTTCTGTGGACACATTGAGTTCTTACATCTATCCTCTTATTGCAATGTAGACATAAGTTCTTTGTATTCTGCATCGCTAAGGGCAATGGCACATGTTGTGATTTTGGCCACTTCTGTGCTCAGTATTTTTAATATTTTAGAGGGTAATGGCAAATTGCCTGAATTTGTGCCCACCCCCCTTGTGAGCTATGGTAACATCCTGAAGTGTTAAGCGCTACCCACGCTGTTGTTGATTGATAACATGTCAATCCGCATTTCCAGGCAACAGTCACCTGACAAACTTTCAGGCAATTACCACAGCATGCAGTGGAGGGCAAATTGGTACTGGTGCAAAGTTTCCCAGTGTGTCATATCCCTAAAAGAATGCAGTAATGAATTAGCTAATTTTTAAAGGGATAGAACCTGCAGATTTGCAAACTAGAAGTGTCAAAGCACTTAAGGGGTCACAACCACTGTGTAGACCATATACACTGGATATAAAAAGTCTATACACCCCTGCAAAATGGCAGGTT
                                                  Xt7.1-CHK-1008294260                           GGGATGAAATGACGTCAGTTTTGATGCGCTGGCTATAACTTTTCTCATGAAGGAAATATTCGTGTTACATGTTTGTTTAGCTCGGTGTTACGCTAAAATACACTGGACATCGTTCAGTACTTCGGTGCAGTTTGGATCTGTATTTAGGAGTCGTGTTTGCTAAATATGCTTGTCTGATTTATACATTGATATGGAATTGTAAACCAAGCTCTCCATTATACAGGCGTTAATGCTTACAAATATTTCTGTGCTCACAAAGCCATAGCAAGTCCATAGCAAATATTTCTTTTAGTTTCTTTTCCTAGACAGGTATGAGCTTTATTTGGTTATCATTTGCAGATTGTTCATCACATTTACATCCATTCCCCAGTGGGATTTAGAATATGAGATGTCCTGCCTATCACATGCACGCAACCGGCTTGCTTCACTTTCATAGGGGGCTCTGTAACCTGGCTGTATATTTTGTTATCATTTATAATGTGGAAAGACTAAGCGATTTGCTGGATATGATGGAAAAGTGATTGCTGGACCAGCAGTTGAAAAGATAAAGCTAATGTTGGCTGGTTTCCTAGGGGTTAATATTTTGTCACTAGGACAGAAGTGCAGGATGTGACAGCACAGGCCTCGGATCTAGGGTGGCAATCAATCGATTGGTCTTATTAAGGAATCTCTATCAGCTAATGATTTAACATTTATATTTGTTTTAGAAATCTGAAAATGATCTGTTGTGCTTTGAGACTGCTGAATGTAAAATGCCCAGAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATAATAAATTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAGTACAAGTACTTGTTTCTGTGGACACATTGAGTTCTTACATCTATCCTCTTATTGCAATGTAGACATAAGTTCTTTGTATTCTGCATCGCTAAGGGCAATGGCACATGTTGTGATTTTGGCCACTTCTGTGCTCAGTATTTTTAATATTTTAGAGGGTAATGGCAAATTGCCTGAATTTGTGCCCACCCCCCTTGTGAGCTATGGTAACATCCTGAAGTGTTAAGCGCTACCCACGCTGTTGTTGATTGATAACATGTCAATCCGCATTTCCAGGCAACAGTCACCTGACAAACTTTCAGGCAATTACCACAGCATGCAGTGGAGGGCAAATTGGTACTGGTGCAAAGTTTCCCAGTGTGTCATATCCCTAAAAGAATGCAGTAATGAATTAGCTAATTTTTAAAGGGATAGAACCTGCAGATTTGCAAACTAGAAGTGTCAAAGCACTTAAGGGGTCACAACCACTGTGTAGACCATATACACTGGATATAAAAAGTCTATACACCCCTGCAAAATGGCAGGTTTTTGCT
  5   1   1           HdA  FL                     THdA053m08.FL-Sanger                    GCCGGCGGGGATGAAATGACGTCAGTTTTGATGCGCTGGCTATAACTTTTCTCATGAAGGAAATATTCGTGTTACATGTTTGTTTAGCTCGGTGTTACGCTAAAATACACTGGACATCGTTCAGTACTTCGGTGCAGTTTGGATCTGTATTTAGGAGTCGTGTTTGCTAAATATGCTTGTCTGATTTATACATTGATATGGAATTGTAAACCAAGCTCTCCATTATACAGGCGTTAATGCTTACAAATATTTCTGTGCTCACAAAGCCATAGCAAGTCCATAGCAAATATTTCTTTTAGTTTCTTTTCCTAGACAGGTATGAGCTTTATTTGGTTATCATTTGCAGATTGTTCATCACATTTACATCCATTCCCCAGTGGGATTTAGAATATGAGATGTCCTGCCTATCACATGCACGCAACCGGCTTGCTTCACTTTCATAGGGGGCTCTGTAACCTGGCTGTATATTTTGTTATCATTTATAATGTGGAAAGACTAAGCGATTTGCTGGATATGATGGAAAAGTGATTGCTGGACCAGCAGTTGAAAAGATAAAGCTAATGTTGGCTGGTTTCCTAGGGGTTAATATTTTGTCACTAGGACAGAAGTGCAGGATGTGACAGCACAGGCCTCGGATCTAGGGTGGCAATCAATCGATTGGTCTTATTAAGGAATCTCTATCAGCTAATGATTTAACATTTATATTTGTTTTAGAAATCTGAAAATGATCTGTTGTGCTTTGAGACTGCTGAATGTAAAATGCCCAGAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATAATAAATTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext HdA  FL   in                   THdA053m08.p1kSP6                     CCGGCGGGGATGAAATGACGTCAGTTTTGATGCGCTGGCTATAACTTTTCTCATGAAGGAAATATTCGTGTTACATGTTTGTTTAGCTCGGTGTTACGCTAAAATACACTGGACATCGTTCAGTACTTCGGTGCAGTTTGGATCTGTATTTAGGAGTCGTGTTTGCTAAATATGCTTGTCTGATTTATACATTGATATGGAATTGTAAACCAAGCTCTCCATTATACAGGCGTTAATGCTTACAAATATTTCTGTGCTCACAAAGCCATAGCAAGTCCATAGCAAATATTTCTTTTAGTTTCTTTTCCTAGACAGGTATGAGCTTTATTTGGTTATCATTTGCAGATTGTTCATCACATTTACATCCATTCCCCAGTGGGATTTAGAATATGAGATGTCCTGCCTATCACATGCACGCAACCGGCTTGCTTCACTTTCATAGGGGGCTCTGTAACCTGGCTGTATATTTTGTTATCATTTATAATGTGGAAAGACTAAGCGATTTGCTGGATATGATGGAAAAGTGATTGCTGGACCAGCAGTTGAAAAGATAAAGCTAATGTTGGCTGGTTTCCTAGGGGTTAATATTTTGTCACTAGGACAGAAGTGCAGGATGTGACAGCACAGGCCTCGGATCTAGGGTGGCAATCAATCGATTGGTCTTATTAAGGAATCTCTATCAGCTAATGATTTAACATTTATATTTGTTTTAGAAATCTGAAAATGATCTGTTGTGCTTTGAGACTGCTGAATGTAAAATGCCCAGAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATAATAAATTTTAAAGGAAGATTGTGTCTGTTACATGTCTGCCAATCCTCCTGCTG
  5   1   4   12 seed Gas7 PIPE in                         XZG54187.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATAATAAATTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACAT
  5   1   2   10  ext Tbd1 5g3  in                        CBXT11315.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATAATCAATTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAA
  3   1   2       ext Tbd1 5g3  in                        CBXT11315.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAGTACAAAAAAAAAAAAAAA
  3   1   2       ext HdA  FL   in                    THdA053m08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATTTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb Gas0                                 dad51b06.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCCATTCAGTGTTAATATTTTTCAAGGTTTTCANACCCTGACCAATTGGAAAAGGAATTTTTTTTATAATGCAGATTTCAAAGATCCTGACAGCTTTCCTTTGTTATCTTGGGAACCAAAATAGACATCCCAGCCCGCCAGGTGTCGTTTAAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCACGCCAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAAACTTCCACTGAAGTACAAAAAAA
  3   1   4      seed Gas7 PIPE in                         XZG54187.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTATCTTGGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAGTACAAGTACTTGTTTCTGTGGACACATTGAGTTCTTACATCTATCCTCTTATTGCAATGTAGACATAAGTTCTTTGTATTCTGCATCGCTAAGGGCAATGGCACATGTTGTGATTTTGGCCACTTCTGTGCTCAGTATTTTTAATATTTTAGAGGGTAATGGCAAATTGCCTAAAAATAAAAAAATAAAG
  5   1   2       ext HdA       out                  THdA019i05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAGTACAAGTACTTGTTTCTGTGGACACATTGAGTTCTTACATCTATCCTCTTATTGCAATGTAGACATAAGTTCTTTGTATTCTGCATCGCTAAGGGCAATGGCACATGTTGTGATTTTGGCCACTTCTGTGCTCAGTATTTTTAATATTTTAGAGGGTAATGGCAAATTGCCTGAATTTGTGCCCACCCCCCTTGTGAGCTATGGTAACATCCTGAAGTGTTAAGCGCTACCCACGCTGTTGTTGATTGATAACATGTCAATCCGCATTTCCAGGCAACAGTCACCTGACAAACTTTCAGGCAATTACCACAGCATGCAGTGGAGGGCAAATTGGTACTGGTGCAAAGTTTCCCAGTGTGTCATATCCCTAAAAGAATGCAGTAATGAATTAGCTAATTTTTAAAGGGATAGAACCTGCAGATTTGCAAACTAGAAGTGTCAAAGCACTTAAGGGGTCACAACCACTGTGTAGACCATATACACTGGATATAAAAAGTCTATACACCCCTGCAAAATGGCAGGTTTTTGCTTAC
  5   1   2                                           Xt7.1-CABJ3077.3                                                                                                                                                                    CTGTATTTAGGAGTCGTGTTTGCTAAATATGCTTGTCTGATTTATACATTGATATGGAATTGTAAACCAAGCTCTCCATTATACAGGCGTTAATGCTTACAAATATTTCTGTGCTCACAAAGCCATAGCAAGTCCATAGCAAATATTTCTTTTAGTTTCTTTTCCTAGACAGGTATGAGCTTTATTTGGTTATCATTTGCAGATTGTTCATCACATTTACATCCATTCCCCAGTGGGATTTAGAATATGAGATGTCCTGCCTATCACATGCACGCAACCGGCTTGCTTCACTTTCATAGGGGGCTCTGTAACCTGGCTGTATATTTTGTTTTCATTTATAATGTGGAAAGACTAAGCGATTTGCTGGATATGATGGAAAAGTGATTGCTGGACCAGCAGTTGAAAAGATAAAGCTAATGTTGGCTGGTTTCCTAGGGGTTAATATTTTGTCACTAGGACAGAAGTGCAGGATGTGACAGCACAGGCCTCGGATCTAGGGTGGCAATCAATCGATTGGTCTTATTAAGGAATCTCTATCAGCTAATGATTTAACATTTATATTTGTTTTAGAAATCTGAAAATGATCTGTTGTGCTTTGAGACTGCTGAATGTAAAATGCCCAGAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATCATCACTTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAGTACAAGTACTTGTTTCTGTGGACACATTGAGTTCTTACATCTATCCTCTTATTGCAATGCAGACATAAGTTCTTTGTATTCTGCATCGCTAAGGGCAATGGCACATGTTGTGATTTTGGCCACTTCTGTGCTCAGTATTTTTAATATTTTAGAGGGTAATGGCAAATTGCCTGAATTTGTGCCCACCACTTTCAGGCAATTACCACAGCATGCAGTGGAGGGCAAATTGGTACTGGTGCAAAGTTGCCCAGTGTGTCATATCCCTAAAAGAATGCAGTAATGAATTAGCTAATTTTTAAAGGGATAGAACCTGCAGATTTGCAAACTAGAAGTGTCAAAGCACTCAAGGGGTCACAACCACTGTGTAGACCATATACATTGGATATGGGGGGTCTATACACCCCTGCAAAATGGCAGGTTTTTGCTTAACAAAAAAAAAAACAAGATAAATCCTGCCACAACTTATTCCACATTTATTGCAAAATAAACAAATCAGAAACCTTTTAGTGAAAGAAGGAAAAGCAAA
                                                  Xt7.1-CHK-1008294258                                                                                                                                                                          TTAGGAGTCGTGTTTGCTAAATATGCTTGTCTGATTTATACATTGATATGGAATTGTAAACCAAGCTCTCCATTATACAGGCGTTAATGCTTACAAATATTTCTGTGCTCACAAAGCCATAGCAAGTCCATAGCAAATATTTCTTTTAGTTTCTTTTCCTAGACAGGTATGAGCTTTATTTGGTTATCATTTGCAGATTGTTCATCACATTTACATCCATTCCCCAGTGGGATTTAGAATATGAGATGTCCTGCCTATCACATGCACGCAACCGGCTTGCTTCACTTTCATAGGGGGCTCTGTAACCTGGCTGTATATTTTGTTTTCATTTATAATGTGGAAAGACTAAGCGATTTGCTGGATATGATGGAAAAGTGATTGCTGGACCAGCAGTTGAAAAGATAAAGCTAATGTTGGCTGGTTTCCTAGGGGTTAATATTTTGTCACTAGGACAGAAGTGCAGGATGTGACAGCACAGGCCTCGGATCTAGGGTGGCAATCAATCGATTGGTCTTATTAAGGAATCTCTATCAGCTAATGATTTAACATTTATATTTGTTTTAGAAATCTGAAAATGATCTGTTGTGCTTTGAGACTGCTGAATGTAAAATGCCCAGAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATCATCACTTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTTGATACACAGTTATTCCACACAATAGGCGTTGAGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAGTACAAGTACTTGTTTCTGTGGACACATTGAGTTCTTACATCTATCCTCTTATTGCAATGCAGACATAAGTTCTTTGTATTCTGCATCGCTAAGGGCAATGGCACATGTTGTGATTTTGGCCACTTCTGTGCTCAGTATTTTTAATATTTTAGAGGGTAATGGCAAATTGCCTGAATTTGTGCCCACCACTTTCAGGCAATTACCACAGCATGCAGTGGAGGGCAAATTGGTACTGGTGCAAAGTTGCCCAGTGTGTCATATCCCTAAAAGAATGCAGTAATGAATTAGCTAATTTTTAAAGGGATAGAACCTGCAGATTTGCAAACTAGAAGTGTCAAAGCACTCAAGGGGTCACAACCACTGTGTAGACCATATACATTGGATATGGGGGGTCTATACACCCCTGCAAAATGGCAGGTTTTTGCTTAACAAAAAAAAAAACAAGATAAATCCTGCCACAACTTATTCCACATTTATTGCAAAATAAACAAATCAGAAACCTTTTAGTGAAAGAAGGAAA
  0   1   1           Ski1 FL                          CABJ3077.FL-MGC                                                                                                                                                                    CTGTATTTAGGAGTCGTGTTTGCTAAATATGCTTGTCTGATTTATACATTGATATGGAATTGTAAACCAAGCTCTCCATTATACAGGCGTTAATGCTTACAAATATTTCTGTGCTCACAAAGCCATAGCAAGTCCATAGCAAATATTTCTTTTAGTTTCTTTTCCTAGACAGGTATGAGCTTTATTTGGTTATCATTTGCAGATTGTTCATCACATTTACATCCATTCCCCAGTGGGATTTAGAATATGAGATGTCCTGCCTATCACATGCACGCAACCGGCTTGCTTCACTTTCATAGGGGGCTCTGTAACCTGGCTGTATATTTTGTTTTCATTTATAATGTGGAAAGACTAAGCGATTTGCTGGATATGATGGAAAAGTGATTGCTGGACCAGCAGTTGAAAAGATAAAGCTAATGTTGGCTGGTTTCCTAGGGGTTAATATTTTGTCACTAGGACAGAAGTGCAGGATGTGACAGCACAGGCCTCGGATCTAGGGTGGCAATCAATCGATTGGTCTTATTAAGGAATCTCTATCAGCTAATGATTTAACATTTATATTTGTTTTAGAAATCTGAAAATGATCTGTTGTGCTTTGAGACTGCTGAATGTAAAATGCCCAGAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATCATCACTTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAGTACAAGTACTTGTTTCTGTGGACACATTGAGTTCTTACATCTATCCTCTTATTGCAATGCAGACATAAGTTCTTTGTATTCTGCATCGCTAAGGGCAATGGCACATGTTGTGATTTTGGCCACTTCTGTGCTCAGTATTTTTAATATTTTAGAGGGTAATGGCAAATTGCCTGAATTTGTGCCCACCACTTTCAGGCAATTACCACAGCATGCAGTGGAGGGCAAATTGGTACTGGTGCAAAGTTGCCCAGTGTGTCATATCCCTAAAAGAATGCAGTAATGAATTAGCTAATTTTTAAAGGGATAGAACCTGCAGATTTGCAAACTAGAAGTGTCAAAGCACTCAAGGGGTCACAACCACTGTGTAGACCATATACATTGGATATGGGGGGTCTATACACCCCTGCAAAATGGCAGGTTTTTGCTTAACAAAAAAAAAAACAAGATAAATCCTGCCACAACTTATTCCACATTTATTGCAAAATAAACAAATCAGAAACCTTTTAGTGAAAGAAGGAAAAGCAAAAAAA
  5   1   4      seed Ski1 FL   in                         CABJ3077.5p                                                                                                                                                                    CTGTATTTAGGAGTCGTGTTTGCTAAATATGCTTGTCTGATTTATACATTGATATGGAATTGTAAACCAAGCTCTCCATTATACAGGCGTTAATGCTTACAAATATTTCTGTGCTCACAAAGCCATAGCAAGTCCATAGCAAATATTTCTTTTAGTTTCTTTTCCTAGACAGGTATGAGCTTTATTTGGTTATCATTTGCAGATTGTTCATCACATTTACATCCATTCCCCAGTGGGATTTAGAATATGAGATGTCCTGCCTATCACATGCACGCAACCGGCTTGCTTCACTTTCATAGGGGGCTCTGTAACCTGGCTGTATATTTTGTTTTCATTTATAATGTGGAAAGACTAAGCGATTTGCTGGATATGATGGAAAAGTGATTGCTGGACCAGCAGTTGAAAAGATAAAGCTAATGTTGGCTGGTTTCCTAGGGGTTAATATTTTGTCACTAGGACAGAAGTGCAGGATGTGACAGCACAGGCCTCGGATCTAGGGTGGCAATCAATCGATTGGTCTTATTAAGGAATCTCTATCAGCTAATGATTTAACATTTATATTTGTTTTAGAAATCTGAAAATGATCTGTTGTGCTTTGAGACTGCTGAATGTAAAATGCCCAGAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATCATCACTTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAAT
  3   1   4      seed Ski1 FL   in                         CABJ3077.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAGTACAAGTACTTGTTTCTGTGGACACATTGAGTTCTTACATCTATCCTCTTATTGCAATGCAGACATAAGTTCTTTGTATTCTGCATCGCTAAGGGCAATGGCACATGTTGTGATTTTGGCCACTTCTGTGCTCAGTATTTTTAATATTTTAGAGGGTAATGGCAAATTGCCTGAATTTGTGCCCACCACTTTCAGGCAATTACCACAGCATGCAGTGGAGGGCAAATTGGTACTGGTGCAAAGTTGCCCAGTGTGTCATATCCCTAAAAGAATGCAGTAATGAATTAGCTAATTTTTAAAGGGATAGAACCTGCAGATTTGCAAACTAGAAGTGTCAAAGCACTCAAGGGGTCACAACCACTGTGTAGACCATATACATTGGATATGGGGGGTCTATACACCCCTGCAAAATGGCAGGTTTTTGCTTAACAAAAAAAAAAACAAGATAAATCCTGCCACAACTTATTCCACATTTATTGCAAAATAAACAAATCAGAAACCTTTTAGTGAAAGAAGGAAAAGCAAAAAAA
  5   1   2  SIG                                      Xt7.1-CABJ3561.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCGGAGTTGTTTTCGCCATGTTTTCTCAGGCGATCCAGTAGGGGAGCTCGCTAGAGAGAAGGGTCCCAGAAATCTGAAAATGATCTGTTGTGCTTTGAGACTGCTGAATGTAAAATGCCCAGAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATCATCACTTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAGTACAAG
                                                  Xt7.1-CHK-1008294256                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTGTTTTCGCCATGTTTTCTCAGGCGATCCAGTAGGGGAGCTCGCTAGAGAGAAGGGTCCCAGAAATCTGAAAATGATCTGTTGTGCTTTGAGACTGCTGAATGTAAAATGCCCAGAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATCATCACTTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAGxAxAxxACAAAA
  5   1   2   14  ext Te4  5g3  out                        CAAN1706.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGGCGGAGTTGTTTTCGCCATGTTTTCTCAGGCGATCCAGTAGGGGAGCTCGCTAGAGAGAAGGGTCCCAGAAATCTGAAAATGATCTGTTGTGCTTTGAGACTGCTGAATGTAAAATGCCCAGAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATCATCACTTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCCCACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAACACAGATACAGTTACCTGCATAGAAAACCTAAGCCAACTACTGNCTGCTGTTGACTGTAGCATTTGAAAGCAATAAC
  5   1   2   10  ext Te1  5g3  out                        CBWN1327.b1 .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCGGAGTTGTTTTCGCCATGTTTTCTCAGGCGATCCAGTAGGGGAGCTCGCTAGAGAGAAGGGTCCCAGAAATCTGAAAATGATCTGTTGTGCTTTGAGACTGCTGAATGTAAAATGCCCAGAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATCATTACTTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCT
  5   1   2   20  add Te1  5g                              CBWN3080.b1 ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCGAGAGAGAAGGGTCCCAGAAATTTGAAAATGATCTGTTGTACTTTGAGACTGCTGAATGTAAAATGCCCAGAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGGAAAAAGCTGTCTCACTGAGTCATCAGAATAGCCCAAAAAGATCATTACTTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAG
  5   1   2   10  ext Ski1 5g3  in                         CABJ3561.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTTCTCAGGCGATCCAGTAGGGGAGCTCGCTAGAGAGAAGGGTCCCAGAAATCTGAAAATGATCTGTTGTACTTTGAGACTGCTGAATGTAAAATGCCCAGAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATCATCACTTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATANACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAG
  5   1   3   10   nb Ovi1 5g3  in                        CABI12256.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGAGCTCGCTAGAGAGAAGGGTCCCAGAAATCTGAAAATGATCTGTTGTACTTTGAGACTGCTGAATGTAAAATGCCCAGAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATCATCACTTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCAT
  3  -1   2       ext Mus1      in                        CABH11314.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATAGGGCGAGAGGCAGAAATCAGATGCTGACTGATATTAAAAACTAAAGTGGGGAAACAAGATCATCACTTTTAAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATAAAAATTGGTTTGGCTAAA
  5   1   2   10  ext Mus1 5g3  in                         CABH8733.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATCGATTCGTCCTTTTAAGGAAGATTGTGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTT
  5   1   4   14 seed Te4  5g3  in                         CAAN2604.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGTCTGTTACAATGTCTGCCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCANATAATTAAAATTGGT
  3   1   2       ext Ski1 5g3  in                         CABJ3561.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAGTACAAGT
  3   1   3        nb Ovi1 5g3  in                        CABI12256.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTNTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAGTACAAAAAAA
  5  -1   2       ext Mus1      in                        CABH11314.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGGAGTGGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTNTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAGTACAAGTAAAAAAAAA
  3   1   2       ext Mus1 5g3  in                         CABH8733.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCTCATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATCTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAGTAC
  3   1   4      seed Te4  5g3  in                         CAAN2604.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATGAATAGATACGTCACTAATAAGTTTGATACACAGTTATTCCACACAATAGGCGTTGAGTTTCTCAATAAAGAGCTGGAAGTGGATGGTCATTTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTCGGAGCCTGAGAACTCCCTTTTATAGGGGTTCAGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAAAGTTTTCAAAACCTGACCAACTGGAAAAAGGAATTTATTTACTATGCAGATGTCAAAGATCCTGACAGCTTTCCTTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGCAGAGACAATGGAAATAATCCTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCT
  3   1   2       ext Gas       in                    TGas089g12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATGAAATACTTCACTGAAAAAAACAACAAAAAAACAAAAAAAAAAAAAAAAAA
  5   1   2       ext Gas       in                  TGas089g12.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTATTTTGAAACTAGTGCTAAAGATGCCACAAATGTTGCTGCAGCTTTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAGCTAATAAACACAGATACAGTTAACCTGCATAGAAAACCTAAGCCAACTACTGCTTGCTGTTGACTGTAGCATTTGAAAGGCAATAACCCTTTAACCCATTTAGCACTAAGTGAAACCAGCCATGCAAGCCCATAAAGATGGCGGTCATGCATGTAGCATTGTTTGGGTAAACAAAATGAAGAATATCTAATAATTAGGTCTGTGAGGACATCAAATAATTAAAATTGGTTTGGCTAAAACAGAGCTGTTCTAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATATTATTTTGACTTAGGATTTAATAAAATACTTCACTGAAAAAAACAACAAAAAAAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)