Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK10277.5                           8 END     3          12       50                Unknown (protein for MGC:121309) [Xenopus tropicalis]
     2   2.0    0Xt7.1-CAAN7610.5                            3 END     3          12      100                Unknown (protein for MGC:121309) [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     3  42.0    0(repeat)                                    0 REP     79        433      718                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012075785 Xt7.1-CAAQ11019.3 - 24 ESTs
                                                                       .-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAQ11019.3                                                                                                                                                                                                          ACAGTGTTTTTTTTTTTTTTTTTTGTCTTGAAAGGTAGAAGAGAAGTGAAACTTTGTTTGCTGAGCTGTAGAGAAGTAGAATGACTAGCGGCATTAGTAATATTCAGGGCTTCCTTTTTAGCTGCTCGTCTGTGCAACATGTACAGCAGAGGAGGTTTGAAGGGTAGTTCTACTACTGCTGCAGAGGTATCTGCTGATCATCCATATTGTGTCTCTCTGATGGGCTGATTATGATAGGAACAGGGGAATGTGGATTGTAGTTCAACCATATGCACCAGTGACCAAGTACAGAGGCAGCAGTTAGTTGGCCATTAGTGTGGTGTGGATAGTGTAAAAAGTGGCACATAAATACACTTTTCTTTAATGCTACTCCCCCCATCATAGAGAAATACATTTCCCTAGATCAATGATCCCCAACCATAACCCAACCCAACTCATAAGCAACATGCTCACTAACCCCTTGGATGTTGCTCCCAGTGGCCTCAAACCAGGTGCTTATCTCCGATTTCCTGGCTTGGAGGCAAGTTTTGGAGCTATAAATACCATGTATAATGCCAATCAGTGCCTCCTGTAGGCTGCCAGTCCACATAGGGGCTACTAAATAGCCAATTATTTGGCACCCTTATTACCTTTTTGCTTGTGTTGCTCCCCAAATCTTTTTTACATTTTAATGTGGCTCATGTGTAAAAAAGGTTGGGGACCCCCGCCCTAGATAGAAAAATGAGGGATAAAGGGGTTTTACCTGAATAAAATGCTTTAGAAAGTCAGCTGCACTGAGGTCTGATTTCTAAGCTGTATTAGGTGAAGGGTGTGTTTTTATTATTGCCCCCTGGAAGCTGTTATCATTTCTGATGGGTGAATGAGCAGAGCCTACAGCTGTTTAGTCCCATCCATGTACCTCTGCTTTATTCATTGTTTTTAACTGACATAACTCCCAATATTTAGACTCTGTGTAGCCTTCCATGTCCTACACCTTGTGGAAAAAGAGGCTGCACTTTGAATTCCAAAGGTAACCCCTGTTCCAAAGTGGGGAGCGCTGGTACTACTTACTGTGGAGCTGAAAAGGATGGTATACCATCACACAAGTACAAATGAGTGACCTGGTCCTGTGACAGGTGTAACTGCTGGAATTTAAAGTGTAGGTACCTGCTGTTCAGATCACTAGACCGTAGTAAATTCTAACAGTGGGGTTCATTAGAGCCCCTGTGCAGCAGATCAGATCATCAGCCATGGAAAGAGCTGATTTGCTCCTGATGTTCCCTTAGGCTTATGCCACACATGGTGGATTCTCATTCTGTGGATTTCAGCTCTGTAATGCATGAATATGCATTTCAGCATCAAAATCTGCTCTGTGTGCATATTCCAGGCTTGACGCAGTGGCTTCAGGGGTAGACACAGAAGAGCATAAGGGGCGGATTCTCAGTCTGTGTTTGTCCAAAGGCCGATAATCTGTCATGTGTGGCATAAGCCCTGTGTTGTGGGGCACTCTGTAAATAGAAAGTCCCACAGAGAGACCATGAGGAGTGCAAGACTGGAAGTAAGGGAAAGGGGCTGAACACAAGCAATTTCTGCTATTTTAAAAAGAACGTAGGATTAATATAGAGGTTCTCTTCATTTTATACACTGTGTAAACCTAAAATGAAGGTATATGTTCCCTTTAAAAATGCCTATAAGCCATGGTGAAATAATTGGGTTGAAAATGGCATAAGTCTAGTAAGGTTATGCTGGTGTAGCTAAAACATTACATCAGATGTTCTTTTGCAATGATATGGTTTATGTGCTAGATGGATTTATGTTGGAAAGGGAAGCTCAGTGTTAGTACTAATGCCGCTAGAATGTTAATACCAGCATGCTGAATGGGCGAGGGTTCTTTTTTACAGCAGCAGAAGGATTCATGTTCCTAAATGTGCATGGATAGCAAGGCCTACAGTTCTGTTCTCTCCTTCCTGTGTGATTTACCATCTCAGGTTCAACAATAAAGTCTAATAAGGCCCAGTGTTTCTTAGATTTACCGGT
                                                  Xt7.1-CHK-1008229487                                                                                                                                                                                                                TTTTTTTTTTTTTTTTTTGTCTTGAAAGGTAGAAGAGAAGTGAAACTTTGTTTGCTGAGCTGTAGAGAAGTAGAATGACTAGCGGCATTAGTAATATTCAGGGCTTCCTTTTTAGCTGCTCGTCTGTGCAACATGTACAGCAGAGGAGGTTTGAAGGGTAGTTCTACTACTGCTGCAGAGGTATCTGCTGATCATCCATATTGTGTCTCTCTGATGGGCTGATTATGATAGGAACAGGGGAATGTGGATTGTAGTTCAACCATATGCACCAGTGACCAAGTACAGAGGCAGCAGTTAGTTGGCCATTAGTGTGGTGTGGATAGTGTAAAAAGTGGCACATAAATACACTTTTCTTTAATGCTACTCCCCCCATCATAGAGAAATACATTTCCCTAGATCAATGATCCCCAACCATAACCCAACCCAACTCATAAGCAACATGCTCACTAACCCCTTGGATGTTGCTCCCAGTGGCCTCAAACCAGGTGCTTATCTCCGATTTCCTGGCTTGGAGGCAAGTTTTGGAGCTATAAATACCATGTATAATGCCAATCAGTGCCTCCTGTAGGCTGCCAGTCCACATAGGGGCTACTAAATAGCCAATTATTTGGCACCCTTATTACCTTTTTGCTTGTGTTGCTCCCCAAATCTTTTTTACATTTTAATGTGGCTCATGTGTAAAAAAGGTTGGGGACCCCCGCCCTAGATAGAAAAATGAGGGATAAAGGGGTTTTACCTGAATAAAATGCTTTAGAAAGTCAGCTGCACTGAGGTCTGATTTCTAAGCTGTATTAGGTGAAGGGTGTGTTTTTATTATTGCCCCCTGGAAGCTGTTATCATTTCTGATGGGTGAATGAGCAGAGCCTACAGCTGTTTAGTCCCATCCATGTACCTCTGCTTTATTCATTGTTTTTAACTGACATAACTCCCAATATTTAGACTCTGTGTAGCCTTCCATGTCCTACACCTTGTGGAAAAAGAGGCTGCACTTTGAATTCCAAAGGTAACCCCTGTTCCAAAGTGGGGAGCGCTGGTACTACTTACTGTGGAGCTGAAAAGGATGGTATACCATCACACAAGTACAAATGAGTGACCTGGTCCTGTGACAGGTGTAACTGCTGGAATTTAAAGTGTAGGTACCTGCTGTTCAGATCACTAGACCGTAGTAAATTCTAACAGTGGGGTTCATTAGAGCCCCTGTGCAGCAGATCAGATCATCAGCCATGGAAAGAGCTGATTTGCTCCTGATGTTCCCTTAGGCTTATGCCACACATGGTGGATTCTCATTCTGTGGATTTCAGCTCTGTAATGCATGAATATGCATTTCAGCATCAAAATCTGCTCTGTGTGCATATTCCAGGCTTGACGCAGTGGCTTCAGGGGTAGACACAGAAGAGCATAAGGGGCGGATTCTCAGTCTGTGTTTGTCCAAAGGCCGATAATCTGTCATGTGTGGCATAAGCCCTGTGTTGTGGGGCACTCTGTAAATAGAAAGTCCCACAGAGAGACCATGAGGAGTGCAAGACTGGAAGTAAGGGAAAGGGGCTGAACACAAGCAATTTCTGCTATTTTAAAAAGAACGTAGGATTAATATAGAGGTTCTCTTCATTTTATACACTGTGTAAACCTAAAATGAAGGTATATGTTCCCTTTAAAAATGCCTATAAGCCATGGTGAAATAATTGGGTTGAAAATGGCATAAGTCTAGTAAGGTTATGCTGGTGTAGCTAAAACATTACATCAGATGTTCTTTTGCAATGATATGGTTTATGTGCTAGATGGATTTATGTTGGAAAGGGAAGCTCAGTGTTAGTACTAATGCCGCTAGAATGTTAATACCAGCATGCTGAATGGGCGAGGGTTCTTTTTTACAGCAGCAGAAGGATTCATGTTCCTAAATGTGCATGGATAGCAAGGCCTACAGTTCTGTTCTCTCCTTCCTGTGTGATTTACCATCTCAGGTTCAACAATAAAGTCTAATAAGGCCCAGTGTTTCTTAGATTT
                                                      consensus depths                                                                                                                                                                                                               2     2     2     2     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     2     2     2     2     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     7     7     7     7     7     7    11    11    12    12    13    13    13    13    13    13    12    13    15    15    16    16    16    16    17    17    17    18    17    18    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    17    18    17    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    17    17    17    17    17    17    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    15    16    13    16    13    16    12    15    12    15    12    15    12    15    12    15    12    15    12    15    12    15    11    14    10    13     5     8     3     4
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -A----------
                                                     Xt7.1-CAAQ11019.3                                                                                                                                                                                                                                                                                           TGA------------------------------------------------------ATG------------------------------------------------------------------------------ATG---TGA---TGATAG---------------------------------------------------------------------------TAG------------------------------TAA---------------ATG---------------TAG---------------TAG------------------TAA------------------------------TAA---------------------------------------------------------------------------------------------TAA------------------------------------TAG---------------------------------------------------------------------------------------------TAA---------------------------------ATG------------------------TAA------------------------TGA---------------------TAG------------------------------------------------TGA------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------TAA---------------------------------------------------------------------TGA---------------ATG------ATG---------------------------------ATG------------------------------------------------------------------------TAG------------------------------------------------------------------------TAA---------------------------TAG------------------------------------------------------------------------------------------------------TAG------------------------------------ATG---------------------------------------TGA---------------------------------------------------TAA---------------------------TGA---------------------------------------------------------ATG------------TAA---------------------------------------------------------------------------------------------------------------------------------------------TAATAA
  5   1   2       bld Eye       in                         CCAX2024.b1 AGAGACTTTGCTTTGCCAAGGAATAAGGCACAGCTGACTCCTTCGGCCTTCCAGCTCTTGCAGTGTCCTTCCTAAAACCTCCTCCCGCTCATTCCGCGTAGAACAACTTTTCTGGGCTGTGTGTAAGGGTAACCACCCTTCGGCACGTTCCACAATTCTGTCTCGACTTGTGTTGCTGCTTCTCATTCTTTCAAACCGGAAACAGTGTTTTTTTTTTTTTTTTTTGTCTTGAAAGGTAGAAGAGAAGTGAAACTTTGTTTGCTGAGCTGTAGAGAAGTAGAATGACTAGCGGCATTAGTAATATTCAGGGCTTCCTTTTTAGCTGCTCGTCTGTGCAACATGTACAGCAGAG
  3   1   2       bld Lun1      out                       CABD10593.3p                                                                                                                                              GCACGTCCAACAATTCTGTCTCGACTTGTGTTGCTGCTTCTCATTCTTTCAAACCGGAAAACAGTGTTTTTTTTTTTTTTTTTTGTCTTGAAAGGTAGAAGAGAAGTGAAACTTTGTTTGCTGAGCTGTAGAGAAGTAGAATGACTAGCGGCATTAGTAATATTCAGGGCTTCCTTTTTAGCTGCTCGTCTGTGCAACATGTACAGCAGAGGAGGTTTGAAGGGTAGTTCTACTACTGCTGCAGAGGTATCTGCTGATCATCCATATTGTGTCTCTCTGATGGGCTGATTATGATAGGAACAGGGGAATGTGGATTGTAGTTCAACCATATGCACCAGTGACCAAGTACAGAGGCAGCAGTTAGTTGGCCATTAGTGTGGTGTGGATAGTGTAAAAAGTGGCACATAAATACACTTTTCTTTAATGCTACTCCCCCCATCATAGAGAAATACATTTCCCTAGATCAATGATCCCCAACCATAACCCAACCCAACTCATAAGCAACAtgctcactaaccccttggatgttgctcccagtggcctcaaaccaggtgcttatctccgatttcctggcttggaggcaagttttggagctataaataccatgtataatgccaatcagtgcctcctgtaggctgccagtccacataggggctactaaatagccaattatttggcacccttattacctttttgcttgtgttgctccccaaatcttttttacattttaatgtggctcatgtgtaaaaaaggttggggaccccCGCCCTAGATAGAAAAATGAGGGATAAAGGGGTTTTACCTGAATAAAATGCTTTAGAAAGTC
  3  -1   2       bld Hrt1      ?                          CAAQ1942.3p                                                                                                                                                                                                                            TTTTTTGTCTTGAAAGGTAGAAGAGAAGTGAAACTTTGTTTGCTGAGCTGTAGAGAAGTAGAATGACTAGCGGCATTAGTAATATTCAGGGCTTCCTTTTTAGCTGCTCGTCTGTGCAACATGTACAGCAGAGGAGGTTTGAAGGGTAGTTCTACTACTGCTGCAGAGGTATCTGCTGATCATCCATATTGTGTCTCTCTGATGGGCTGATTATGATAGGAACAGGGGAATGTGGATTGTAGTTCAACCATATGCACCAGTGACCAAGTACAGAGGCAGCAGTTAGTTGGCCATTAGTGTGGTGTGGATAGTGTAAAAAGTGGCACATAAATACACTTTTCTTTAATGCTACTCCCCCCATCATAGAGAAATACATTTCCCTAGATCAATGATCCCCAACCATAACCCAACCCAACTCATAAGCAACAtgctcactaaccccttggatgttgctcccagtggcctcaaaccaggtgcttatctccgatttcctggcttggaggcaagttttggagctataaataccatgtataatgccaatcagtgcctcctgtaggctgccagtccacataggggctactaaatagccaattatttggcacccttattacctttttgcttgtgttgctccccaaatcttttttacattttaatgtggctcatgtgtaaaaaaggttggggaccccCGCCCTAGATAGAAAAATAAGGGATAAAGGGGTTTTACCTGAATAAAATGCTTTAGAAAGTCAGCTGCACTGAGGTCTGATTTCTAAGCTGTATTAGGTG
  3  -1   2       bld Int1      in                         CAAP7401.3p                                                                                                                                                                                                                                                                     GTCGAGCTGTAGAGAAGTAGAATGACTAGCGGCATTAGTAATATTCAGGGCTTCCTTTTTAGCTGCTCGTCTGTGCAACATGTACAGCAGAGGAGGTTTGAAGGGTAGTTCTACTACTGCTGCAGAGGTATCTGCTGATCATCCATATTGTGTCTCTCTGATGGGCTGATTATGATAGGAACAGGGGAATGTGGATTGTAGTTCAACCATATGCACCAGTGACCAAGTACAGAGGCAGCAGTTAGTTGGCCATTAGTGTGGTGTGGATAGTGTAAAAAGTGGCACATAAATACACTTTTCTTTAATGCTACTCCCCCCATCATAGAGAAATACATTTCCCTAGATCAATGATCCCCAACCATAACCCAACCCAACTCATAAGCAACAtgctcactaaccccttggatgttgctcccagtggcctcaaaccaggtgcttatctccgatttcctggcttggaggcaagttttggagctataaataccatgtataatgccaatcagtgcctcctgtaggctgccagtccacataggggctactaaatagccaattatttggcacccttattacctttttgcttgtgttgctccccaaatcttttttacattttaatgtggctcatgtgtaaaaaaggttggggaccccCGCCCTAGATAGAAAAATGAGGGATAAAGGGGTTTTACCTGAATAAAATGCTTTAGAAAGTCAGCTGCACTGAGGTCTGATTTCTAAGCTGTATTAGGTGAAGGGTGTGTTTTTATTATTGCCCCCTGGAAGCTGTTATCATTTCTGATGGGTGAATGAGCAGAGCCTACAGCTGTTTAGTCCCATCCATGTACCTCTGC
  5   1   2       bld Thy1      in                        CBST4264.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTAAAAAAGGTTGGGGACCCCCGCCCTAGATAGAAAAATGAGGGATAAAGGGGTTTTACCTGAATAAAATGCTTTAGAAAGTCAGCTGCACTGAGGTCTGATTTCTAAGCTGTATTAGGTGAAGGGTGTGTTTTTATTATTGCCCCCTGGAAGCTGTTATCATTTCTGATGGGTGAATGAGCAGAGCCTACAGCTGTTTAGTCCCATCCATGTACCTCTGCTTTATTCATTGTTTTTAACTGACATAACTCCCAATATTTAGACTCTGTGTAGCCTTCCATGTCCTACACCTTGTGGAAAAAGAGGCTGCACTTTGAATTCCAAAGGTAACCCCTGTTCCAAAGTGGGGAGCGCTGGTACTACTTACTGTGGAGCTGAAAAGGATGGTATACCATCACACAAGTACAAATGAGTGACCTGGTCCTGTGACAGGTGTAACTGCTGGAATTTAAAGTGTAGGTACCTGCTGTTCAGATCACTAGACCGTAGTAAATTCTAACAGTGGGGTTCATTAGAGCCCCTGTGCAGCAGATCAGATCATCAGCCATGGAAAGAGCTGATTTGCTCCTGATGTTCCCTTAGGCTTATGCCACACATGGTGGATTCTCATTCTGTGGATTTCAGCTCTGTAATGCATGAATATGCATTTCAGCATCAAAATCTGCTCTGTGTGCATATTCCAGGCTTGACGCAGTGGCTTCAGGGGTAGACACAGAAGAGCATAAGGGGCGGATTCTCAGTCTGTGTTTGTCCAAAGGCCGAT
  5   1   2       bld Tbd1      in                        CBXT14792.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAATGAGCAGAGCCTACAGCTGTTTAGTCCCATCCATGTACCTCTGCTTTATTCATTGTTTTTAACTGACATAACTCCCAATATTTAGACTCTGTGTAGCCTTCCATGTCCTACACCTTGTGGAAAAAGAGGCTGCACTTTGAATTCCAAAGGTAACCCCTGTTCCAAAGTGGGGAGCGCTGGTACTACTTACTGTGGAGCTGAAAAGGATGGTATACCATCACACAAGTACAAATGAGTGACCTGGTCCTGTGACAGGTGTAACTGCTGGAATTTAAAGTGTAGGTACCTGCTGTTCAGATCACTAGACCGTAGCAAATTCTAACAGTGGGGTTCATTAGAGCCCCTGTGCAGCAGATCAGATCATCAGCCATGGAAAGAGCTGATTTGCTCCTGATGTTCCCTTAGGCTTATGCCACACATGGTGGATTCTCATTCTGTGGATTTCAGCTCTGTAATGCATGAATATGCATTTCAGCATCAAAATCTGCTCTGTGTGCATATTCCAGGCTTGACGCAGTGGCTTCAGGGGTAGACACAGAAGAGCATAAGGGGCGGATTCTCAGTCTGTGTTTGTCCAAAGGCCGATAATCTGTCATGTGTGGCATAAGCCCTGTGTTGTGGGGCACTCTGTAAATAGAAAGTCCCACAGAGAGACCATGAGGAGTGCAAGACTGGAAGTAAGGGAAAGGGGCTGAACACAAGCAATTTCTGCTATTTTAAAAAGAACGTAGGATTAATATAGAGGTTCTCTTCATTTTATACA
  3  -1   2       bld Int1      in                        CAAP10605.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTAACTGACATAACTCCCAATATTTAGACTCTGTGTAGCCTTCCATGTCCTACACCTTGTGGAAAAAGAGGCTGCACTTTGAATTCCAAAGGTAACCCCTGTTCCAAAGTGGGGAGCGCTGGTACTACTTACTGTGGAGCTGAAAAGGATGGTATACCATCACACAAGTACAAATGAGTGACCTGGTCCTGTGACAGGTGTAACTGCTGGAATTTAAAGTGTAGGTACCTGCTGTTCAGATCACTAGACCGTAGTAAATTCTAACAGTGGGGTTCATTAGAGCCCCTGTGCAGCAGATCAGATCATCAGCCATGGAAAGAGCTGATTTGCTCCTGATGTTCCCTTAGGCTTATGCCACACATGGTGGATTCTCATTCTGTGGATTTCAGCTCTGTAATGCATGAATATGCATTTCAGCATCAAAATCTGCTCTGTGTGCATATTCCAGGCTTGACGCAGTGGCTTCAGGGGTAGACACAGAAGAGCATAAGGGGCGGATTCTCAGTCTGTGTTTGTCCAAAGGCCGATAATCTGTCATGTGTGGCATAAGCCCTGTGTTGTGGGGCACTCTGTAAATAGAAAGTCCCACAGAGAGACCATGAGGAGTGCAAGACTGGAAGTAAGGGAAAGGGGCTGAACACAAGCAATTTCTGCTATTTTAAAAAGAACGTAGGATTAATATAGAGGTTCTCTTCATTTTATACACTGTGTAAACCTAAAATGAAGGTATATGTTCCCTTTAAAAATGCCTATAAGCCATGGTGAAATAATTGGGTTGAAAATGGCATAAGTCTAGTAAGGTTATGCTGGTGTAGCTAANACATTACATC
  5   1   2       bld Eye       in                         CCAX2038.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGACATAACTCCCAATATTTAGACTCTGTGTAGCCTTCCATGTCCTACACCTTGTGGAAAAAGAGGCTGCACTTTGAATTCCAAAGGTAACCCCTGTTCCAAAGTGGGGAGCGCTGGTACTACTTACTGTGGAGCTGAAAAGGATGGTATACCATCACACAAGTACAAATGAGTGACCTGGTCCTGTGACAGGTGTAACTGCTGGAATTTAAAGTGTAGGTACCTGCTGTTCAGATCACTAGACCGTAGTAAATTCTAACAGTGGGGTTCATTAGAGCCCCTGTGCAGCAGATCAGATCATCAGCCATGGAAAGAGCTGATTTGCTCCTGATGTTCCCTTAGGCTTATGCCACACATGGTGGATTCTCATTCTGTGGATTTCAGCTCTGTAATGCATGAATATGCATTTCAGCATCAAAATCTGCTCTGTGTGCATATTCCAGGCTTGACGCAGTGGCTTCAGGGGTAGACACAGAAGAGCATAAGGGGCGGATTCTCAGTCTGTGTTTGTCCAAAGGCCGATAATCTGTCATGTGTGGCATAAGCCCTGTGTTGTGGGGCACTCTGTAAATAGAAAGTCCCACAGAGAGACCATGAGGAGTGCAAGACTGGAAGTAAGGGAAAGGGGCTGAACACAAGCAATTTCTGCTATTTTAAAAAGAACGTAGGATTAATATAGAGGTTCTCTTCATTTTATACACTGTGTAAACCTAAAATGAAGGTATATGTTCCCTTTAAAAATGCCTATAAGCCATGGTGAAATAATTGGGTTGAAAATGGCAT
  5   1   2       bld Hrt1      in                        CAAQ11019.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCAATTCGGCACGAGGCCAAGTGGGGAGCGCTGGTACTACTTACTGTGGAGCTGAAAAGGATGGTATACCATCACACAAGTACAAATGAGTGACCTGGTCCTGTGACAGGTGTAACTGCTGGAATTTAAAGTGTAGGTACCTGCTGTTCAGATCACTAGACCGTAGTAAATTCTAACAGTGGGGTTCATTAGAGCCCCTGTGCAGCAGATCAGATCATCAGCCATGGAAAGAGCTGATTTGCTCCTGATGTTCCCTTAGGCTTATGCCACACATGGTGGATTCTCATTCTGTGGATTTCAGCTCTGTAATGCATGAATATGCATTTCAGCATCAAAATCTGCTCTGTGTGCATATTCCAGGCTTGACGCAGTGGCTTCAGGGGTAGACACAGAAGAGCATAAGGGGCGGATTCTCAGTCTGTGTTTGTCCAAAGGCCGATAATCTGTCATGTGTGGCATAAGCCCTGTGTTGTGGGGCACTCTGTAAATAGAAAGTCCCACAGAGAGACCATGAGGAGTGCAAGACTGGAAGTAAGGGAAAGGGGCTGAACACAAGCAATTTCTGCTATTTTAAAAAGAACGTAGGATTAATATAGAGGTTCTCTTCATTTTATACACTGTGTAAACCTAAAATGAAGGTATATGTTCCCTTTAAAAATGCCTATAAGCCATGGTGAAATAATTGGGTTGAAAATGGCATAAGTCTAGTAAGGTTATGCTGGTGTAGCTAAAACATTACATCAGATGTTCTTTTGCAATGATATGGTTTATGTGCTAGATGGATTTATGTTGGAAAGGGAAGCTCAGTGTTAGTACTAATGCCGCTAGAATGNTAATACCAGCATGCTGAATGGGCGAAGGTTCTTTTTTACAGCAG
  5  -1   2       bld Int1      in                        CAAP10605.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTAGGTACCTGCTGTTCAGATCACTAGACCGTAGTAAATTCTAACAGTGGGGTTCATTAGAGCCCCTGTGCAGCAGATCAGATCATCAGCCATGGAAAGAGCTGATTTGCTCCTGATGTTCCCTTAGGCTTATGCCACACATGGTGGATTCTCATTCTGTGGATTTCAGCTCTGTAATGCATGAATATGCATTTCAGCATCAAAATCTGCTCTGTGTGCATATTCCAGGCTTGACGCAGTGGCTTCAGGGGTAGACACAGAAGAGCATAAGGGGCGGATTCTCAGTCTGTGTTTGTCCAAAGGCCGATAATCTGTCATGTGTGGCATAAGCCCTGTGTTGTGGGGCACTCTGTAAATAGAAAGTCCCACAGAGAGACCATGAGGAGTGCAAGACTGGAAGTAAGGGAAAGGGGCTGAACACAAGCAATTTCTGCTATTTTAAAAAGAACGTAGGATTAATATAGAGGTTCTCTTCATTTTATACACTGTGTAAACCTAAAATGAAGGTATATGTTCCCTTTAAAAATGCCTATAAGCCATGGTGAAATAATTGGGTTGAAAATGGCATAAGTCTAGTAAGGTTATGCTGGTGTAGCTAAAACATTACATCAGATGTTCTTTTGCAATGATATGGTTTATGTGCTAGATGGATTTATGTTGGAAAGGGAAGCTCAGTGTTAGTACTAATGCCGCTAGAATGTTAATACCAGCATGCTGAATGGGCGAGGGTTCTTTTTTACAGCAGCAGAAGGATTCATGTTCCTAAATGTGCATGGATAGCAAGGCCTACAGTTCTGTTCTCTCCTTCCTGTGTGATTTACCATCTCAGCCTCGG
  5   1   2       bld Tad5      in                         XZT43612.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTGTTCAGATCACTAGACCGTAGTAAATTCTAACAGTGGGGTTCATTAGAGCCCCTGTGCAGCAGATCAGATCATCAGCCATGGAAAGAGCTGATTTGCTCCTGATGTTCCCTTAGGCTTATGCCACACATGGTGGATTCTCATTCTGTGGATTTCAGCTCTGTAATGCATGAATATGCATTTCAGCATCAAAATCTGCTCTGTGTGCATATTCCAGGCTTGACGCAGTGGCTTCAGGGGTAGACACAGAAGAGCATAAGGGGCGGATTCTCAGTCTGTGTTTGTCCAAAGGCCGATAATCTGTCATGTGTGGCATAAGCCCTGTGTTGTGGGGCACTCTGTAAATAGAAAGTCCCACAGAGAGACCATGAGGAGTACAAGACTGGAAGTAAGGGAAAGGGGCTGAACACAAGCAATTTCTGCTATTTTAAAAAGAACGTAGGATTAATATAGAGGTTCTCTTCATTTTATACACTGTGTAAACCTAAAATGAAGGTATATGTTCCCTTTAAAAATGCCTATAAGCCATGGTGAAATAATTGGGTTGAAAATGGCATAAGTCTAGTAAGGTTATGCTGGTGTAGCTAAAACATTACATCAGATGTTCTTTTGCAATGATATGGTTTATGTGCTAGATGGATTTATGTTGGAAAGGGAAGCTCAGTGTTAGTACTAATGCCGCTAGAATGTTAATACCAGCATCTGAATGGGCGAGGGTTCTTTTTTACAGCAGCAGAAGGATTCATGTTCCTAAATGTGCATGGATAGCAAGGCCTACAGTTCTGTTCTCTCCTTCCTGTGTGATTTACCATCTCAGGTTCAACAATAAAGTCTAATAAGGCCCAGTGTTTC
  3   1   2       bld Tad5      in                         XZT43612.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGTGGGGTTCATTAGAGCCCCTGTGCAGCAGATCAGATCATCAGCCATGGAAAGAGCTGATTTGCTCNTGATGTTCCCTTAGGCTTATGCCACACATGGTGGATTCTCATTCTGTGGATTTCAGCTCTGTAATGCATGAATATGCATTTCAGCATCAAAATCTGCTCTGTGTGCATATTCCAGGCTTGACGCAGTGGCTTCAGGGGTAGACACAGAAGAGCATAAGGGGCGGATTCTCAGTCTGTGTTTGTCCAAAGGCCGATAATCTGTCATGTGTGGCATAAGCCCTGTGTTGTGGGGCACTCTGTAAATAGAAAGTCCCACAGAGAGACCATGAGGAGTACAAGACTGGAAGTAAGGGAAAGGGGCTGAACACAAGCAATTTCTGCTATTTTAAAAAGAACGTAGGATTAATATAGAGGTTCTCTTCATTTTATACACTGTGTAAACCTAAAATGAAGGTATATGTTCCCTTTAAAAATGCCTATAAGCCATGGTGAAATAATTGGGTTGAAAATGGCATAAGTCTAGTAAGGTTATGCTGGTGTAGCTAAAACATTACATCAGATGTTCTTTTGCAATGATATGGTTTATGTGCTAGATGGATTTATGTTGGAAAGGGAAGCTCAGTGTTAGTACTAATGCCGCTAGAATGTTAATACCAGCATCTGAATGGGCGAGGGTTCTTTTTTACAGCAGCAGAAGGATTCATGTTCCTAAATGTGCATGGATAGCAAGGCCTACAGTTCTGTTCTCTCCTTCCTGTGTGATTTACCATCTCAGGTTCAACAATAAAGTCTAATAAGGCCCAGTGTTTCTTAGATTTACCGGTAAAAAAAAAAAAAAAGG
  3   1   2       bld Te4       out                        CAAN7610.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTGGGGTTCATTAGAGCCCCTGTGCAGCAGATCAGATCATCAGCCATGGAAAGAGCTGATTTGCTCCTGATGTTCCCTTAGGCTTATGCCACACATGGTGGATTCTCATTCTGTGGATTTCAGCTCTGTAATGCATGAATATGCATTTCAGCATCAAAATCTGCTCTGTGTGCATATTCCAGGCTTGACGCAGTGGCTTCAGGGGTAGACACAGAAGAGCATAAGGGGCGGATTCTCAGTCTGTGTTTGTCCAAAGGCCGATAATCTGTCATGTGTGGCATAAGCCCTGTGTTGTGGGGCACTCTGTAAATAGAAAGTCCCACAGAGAGACCATGAGGAGTGCAAGACTGGAAGTAAGGGAAAGGGGCTGAACACAAGCAATTTCTGCTATTTTAAAAAGAACGTAGGATTAATATAGAGGTTCTCTTCATTTTATACACTGTGTAAACCTAAAATGAAGGTATATGTTCCCTTTAAAAATGCCTATAAGCCATGGTGAAATAATTGGGTTGAAAATGGCATAAGTCTAGTAAGGTTATGCTGGTGTAGCTAAAACATTACATCAGATGTTCTTTTGCAATGATATGGTTTATGTGCTAGATGGATTTATGTTGGAAAGGGAAGCTCAGTGTTAGTACTAATGCCGCTAGAATGTTAATACCAGCATGCTGAATGGGCGAGGGTTCTTTTTTACAGCAGCAGAAGGATTCATGTTCCTAAATGTGCATGGATAGCAAGGCCTACAGTTCTGTTCTCTCCTTCCTGTGTGATTTACCATCTCAGGTTCAACAATAAAGTCTAATAAGGC
  3   1   2      seed Hrt1      in                        CAAQ11019.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTGGGGTTCATTAGAGCCCCTGTGCAGCAGATCAGATCATCAGCCATGGAAAGAGCTGATTTGCTCCTGATGTTCCCTTAGGCTTATGCCACACATGGTGGATTCTCATTCTGTGGATTTCAGCTCTGTAATGCATGAATATGCATTTCAGCATCAAAATCTGCTCTGTGTGCATATTCCAGGCTTGACGCAGTGGCTTCAGGGGTAGACACAGAAGAGCATAAGGGGCGGATTCTCAGTCTGTGTTTGTCCAAAGGCCGATAATCTGTCATGTGTGGCATAAGCCCTGTGTTGTGGGGCACTCTGTAAATAGAAAGTCCCACAGAGAGACCATGAGGAGTGCAAGACTGGAAGTAAGGGAAAGGGGCTGAACACAAGCAATTTCTGCTATTTTAAAAAGAACGTAGGATTAATATAGAGGTTCTCTTCATTTTATACACTGTGTAAACCTAAAATGAAGGTATATGTTCCCTTTAAAAATGCCTATAAGCCATGGTGAAATAATTGGGTTGAAAATGGCATAAGTCTAGTAAGGTTATGCTGGTGTAGCTAAAACATTACATCAGATGTTCTTTTGCAATGATATGGTTTATGTGCTAGATGGATTTATGTTGGAAAGGGAAGCTCAGTGTTAGTACTAATGCCGCTAGAATGTTAATACCAGCATGCTGAATGGGCGAGGGTTCTTTTTTACAGCAGCAGAAGGATTCATGTTCCTAAATGTGCATGGATAGCAAGGCCTACAGTTCTGTTCTCTCCTTCCTGTGTGATTTACCATCTCAGGTTCAACAATAAAGTCTAATAAGGCCCAGTGTTTCTAG
  3   1   2       bld Brn3 5g3  out                       CAAK10277.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGTTCATTAGAGCCCCTGTGCAGCAGATCAGATCATCAGCCATGGAAAGAGCTGATTTGCTCCTGATGTTCCCTTAGGCTTATGCCACACATGGTGGATTCTCATTCTGTGGATTTCAGCTCTGTAATGCATGAATATGCATTTCAGCATCAAAATCTGCTCTGTGTGCATATTCCAGGCTTGACGCAGTGGCTTCAGGGGTAGACACAGAAGAGCATAAGGGGCGGATTCTCAGTCTGTGTTTGTCCAAAGGCCGATAATCTGTCATGTGTGGCATAAGCCCTGTGTTGTGGGGCACTCTGTAAATAGAAAGTCCCACAGAGAGACCATGAGGAGTGCAAGACTGGAAGTAAGGGAAAGGGGCTGAACACAAGCAATTTCTGCTATTTTAAAAAGAACGTAGGATTAATATAGAGGTTCTCTTCATTTTATACACTGTGTAAACCTAAAATGAAGGTATATGTTCCCTTTAAAAATGCCTATAAGCCATGGTGAAATAATTGGGTTGAAAATGGCATAAGTCTAGTAAGGTTATGCTGGTGTAGCTAAAACATTACATCAGATGTTCTTTTGCAATGATATGGTTTATGTGCTAGATGGATTTATGTTGGAAAGGGAAGCTCAGTGTTAGTACTAATGCCGCTAGAATGTTAATACCAGCATGCTGAATGGGCGAGGGTTCTTTTTTACAGCAGCAGAAGGATTCATGTTCCTAAATGTGCATGGATAGCAAGGCCTACAGTTCTGTTCTCTCCTTCCTGTGTGATTTACCATCTCAGGTTCAACAATAAAGTCTAATAAGGCCC
  5  -1   2       bld Int1      in                         CAAP7401.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATTAGAGCCCCTGTGCAGCAGATCAGATCATCAGCCATGGAAAGAGCTGATTTGCTCCTGATGTTCCCTTAGGCTTATGCCACACATGGTGGATTCTCATTCTGTGGATTTCAGCTCTGTAATGCATGAATATGCATTTCAGCATCAAAATCTGCTCTGTGTGCATATTCCAGGCTTGACGCAGTGGCTTCAGGGGTAGACACAGAAGAGCATAAGGGGCGGATTCTCAGTCTGTGTTTGTCCAAAGGCCGATAATCTGTCATGTGTGGCATAAGCCCTGTGTTGTGGGGCACTCTGTAAATAGAAAGTCCCACAGAGAGACCATGAGGAGTGCAAGACTGGAAGTAAGGGAAAGGGGCTGAACACAAGCAATTTCTGCTATTTTAAAAAGAACGTAGGATTAATATAGAGGTTCTCTTCATTTTATACACTGTGTAAACCTAAAATGAAGGTATATGTTCCCTTTAAAAATGCCTATAAGCCATGGTGAAATAATTGGGTTGAAAATGGCATAAGTCTAGTAAGGTTATGCTGGTGTAGCTAAAACATTACATCAGATGTTCTTTTGCAATGATATGGTTTATGTGCTAGATGGATTTATGTTGGAAAGGGAAGCTCAGTGTTAGTACTAATGCCGCTAGAATGTTAATACCAGCATGCTGAATGGGCGAGGGTTCTTTTTTACAGCAGCAGAAGGATTCATGTTCCTAAATGTGCATGGATAGCAAGGCCTACAGTTCTGTTCTCTCCTTCCTGTGTGATTTACCATCTCAGGTTCAACAATAAAGTCTAATAAGGCCCAGTGTTTCTTAG
  3   1   2       bld Tad5      out                        XZT25223.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCAGATCAGATCATCAGCCATGGAAAGAGCTGATTTGCTCCTGATGTCCCCTTAGGCTTATGCCACACATGGTGGATTCTCATTCTGTGGATTTCAGCTCTGTAATGCATGAATATGCATTTCAGCATCAAAATCTGCTCTGTGTGCATATTCCAGGCTTGACGCAGTGGCTTCAGGGGTAGACACAGAAGAGCATAAGGGGCGGATTCTCAGTCTGTGTTTGTCCAAAGGCCGATAATCTGTCATGTGTGGCATAAGCCCTGTGTTGTGGGGCACTCTGTAAATAGAAAGTCCCACAGAGAGACCATGAGGAGTACAAGACTGGAAGTAAGGGAAAGGGGCTGAACACAAGCAATTTCTGCTATTTTAAAAAGAACGTAGGATTAATATAGAGGTTCTCTTCATTTTATACACTGTGTAAACCTAAAATGAAGGTATATGTTCCCTTTAAAAATGCCTATAAGCCATGGTGAAATAATTGGGTTGAAAATGGCATAAGTCTAGTAAGGTTATGCTGGTGTAGCTAAAACATTACATCAGATGTTCTTTTGCAATGATATGGTTTATGTGCTAGATGGATTTATGTTGGAAAGGGAAGCTCAGTGTTAGTACTAATGCCGCTAGAATGTTAATACCAGCATGCTGAATGGGCGAGGGTTCTTTTTTACAGCAGCAGAAGGATTCATGTTCCTAAATGTGCATGGATAGCAAGGCCTACAGTTCTGTTCTCTCCTTCCTGTGTGATTTACCATCTCAGGTTCAACAATAAAGTCTAATAAGGCCCAGTGTTTCTTAGATTTACCGGTTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Thy1      in                        CBST4264.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATGTTCCCTTAGGCTTATGCCACACATGGTGGATTCTCATTCTGTGGATTTCAGCTCTGTAATGCATGAATATGCATTTCAGCATCAAAATCTGCTCTGTGTGCATATTCCAGGCTTGACGCAGTGGCTTCAGGGGTAGACACAGAAGAGCATAAGGGGCGGATTCTCAGTCTGTGTTTGTCCAAAGGCCGATAATCTGTCATGTGTGGCATAAGCCCTGTGTTGTGGGGCACTCTGTAAATAGAAAGTCCCACAGAGAGACCATGAGGAGTACAAGACTGGAAGTAAGGGAAAGGGGCTGAACACAAGCAATTTCTGCTATTTTAAAAAGAACGTAGGATTAATATAGAGGTTCTCTTCATTTTATACACTGTGTAAACCTAAAATGAAGGTATATGTTCCCTTTAAAAATGCCTATAAGCCATGGTGAAATAATTGGGTTGAAAATGGCATAAGTCTAGTAAGGTTATGCTGGTGTAGCTAAAACATTACATCAGATGTTCTTTTGCAATGATATGGTTTATGTGCTAGATGGATTTATGTTGGAAAGGGAAGCTCAGTGTTAGTACTAATGCCGCTAGAATGTTAATACCAGCATGCTGAATGGGCGAGGGTTCTTTTTTACAGCAGCAGAAGGATTCATGTTCCTAAATGTGCATGGATAGCAAGGCCTACAGTTCTGTTCTCTCCTTCCTGTGTGATTTACCATCTCAGGTTCAACAATAAAGTCTAATAAGGCCC
  3   1   2       bld Tbd1      in                        CBXT14792.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTCCCTTAGGCTTATGCCACACATGGTGGATTCTCATTCTGTGGATTTCAGCTCTGTAATGCATGAATATGCATTTCAGCATCAAAATCTGCTCTGTGTGCATATTCCAGGCTTGACGCAGTGGCTTCAGGGGTAGACACAGAAGAGCATAAGGGGCGGATTCTCAGTCTGTGTTTGTCCAAAGGCCGATAATCTGTCATGTGTGGCATAAGCCCTGTGTTGTGGGGCACTCTGTAAATAGAAAGTCCCACAGAGAGACCATGAGGAGTGCAAGACTGGAAGTAAGGGAAAGGGGCTGAACACAAGCAATTTCTGCTATTTTAAAAAGAACGTAGGATTAATATAGAGGTTCTCTTCATTTTATACACTGTGTAAACCTAAAATGAAGGTATATGTTCCCTTTAAAAATGCCTATAAGCCATGGTGAAATAATTGGGTTGAAAATGGCATAAGTCTAGTAAGGTTATGCTGGTGTAGCTAAAACATTACATCAGATGTTCTTTTGCAATGATATGGTTTATGTGCTAGATGGATTTATGTTGGAAAGGGAAGCTCAGTGTTAGTACTAATGCCGCTAGAATGTAATACCAGCATGCTGAATGGGCGAGGGTTCTTTTTTACAGCAGCAGAAGGATTCATGTTCCTAAATGTGCATGGATAGCAAGGCCTACAGTTCTGTTCTCTCCTTCCTGTGTGATTTACCATCTCAGGTTCAACAATAAAGTCTAATAAGGCCCAAAAAAAAAAAAAAA
  3   1   2       bld Brn3 5g3  out                       CAAK11630.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCTTATGCCACACATGGTGGATTCTCATTCTGTGGATTTCAGCTCTGTAATGCATGAATATGCATTTCAGCATCAAAATCTGCTCTGTGTGCATATTCCAGGCTTGACGCAGTGGCTTCAGGGGTAGACACAGAAGAGCATAAGGGGCGGATTCTCAGTCTGTGTTTGTCCAAAGGCCGATAATCTGTCATGTGTGGCATAAGCCCTGTGTTGTGGGGCACTCTGTAAATAGAAAGTCCCACAGAGAGACCATGAGGAGTGCAAGACTGGAAGTAAGGGAAAGGGGCTGAACACAAGCAATTTCTGCTATTTTAAAAAGAACGTAGGATTAATATAGAGGTTCTCTTCATTTTATACACTGTGTAAACCTAAAATGAAGGTATATGTTCCCTTTAAAAATGCCTATAAGCCATGGTGAAATAATTGGGTTGAAAATGGCATAAGTCTAGTAAGGTTATGCTGGTGTAGCTAAAACATTACATCAGATGTTCTTTTGCAATGATATGGTTTATGTGCTAGATGGATTTATGTTGGAAAGGGAAGCTCAGTGTTAGTACTAATGCCGCTAGAATGTTAATACCAGCATGCTGAATGGGCGAGGGTTCTTTTTTACAGCAGCAGAAGGATTCATGTTCCTAAATGTGCATGGATAGCAAGGCCTACAGTTCTGTTCTCTCCTTCCTGTGTGATTTACCATCTCAGGTTCAACAATAAAGTCTAATAAGG
  3   1   2       bld Eye       in                         CCAX2038.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCATTCTGTGGATTTCAGCTCTGTAATGCATGAATATGCATTTCAGCATCAAAATCTGCTCTGTGTGCATATTCCAGGCTTGACGCAGTGGCTTCAGGGGTAGACACAGAAGAGCATAAGGGGCGGATTCTCAGTCTGTGTTTGTCCAAAGGCCGATAATCTGTCATGTGTGGCATAAGCCCTGTGTTGTGGGGCACTCTGTAAATAGAAAGTCCCACAGAGAGACCATGAGGAGTGCAAGACTGGAAGTAAGGGAAAGGGGCTGAACACAAGCAATTTCTGCTATTTTAAAAAGAACGTAGGATTAATATAGAGGTTCTCTTCATTTTATACACTGTGTAAACCTAAAATGAAGGTATATGTTCCCTTTAAAAATGCCTATAAGCCATGGTGAAATAATTGGGTTGAAAATGGCATAAGTCTAGTAAGGTTATGCTGGTGTAGCTAAAACATTACATCAGATGTTCTTTTGCAATGATATGGTTTATGTGCTAGATGGATTTATGTTGGAAAGGGAAGCTCAGTGTTAGTACTAATGCCGCTAGAATGTTAATACCAGCATGCTGAATGGGCGAGGGTTCTTTTTTACAGCAGCAGAAGGATTCATGTTCCTAAATGTGCATGGATAGCAAGGCCTACAGTTCTGTTCTCTCCTTCCTGTGTGATTTACCATCTCAGGTTCAACAATAAAGTCTAATAAGGCCCAGTGTTTCTTAGATTTACCGGTTA
  3   1   2       chi Brn3      out                        CAAK3299.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTGTAGTTCAACCATTGGCACCAGTGGCCAAGTACAGAGGCAGCAGTTAGTTGGCCATTAGTGGGGTGTGGATAGTGTAAAAAGTGGCACATAAATACACTTTTCTTTAATGCTACTCCCCCCATCATAGAGAAATACATTTCCCTAGATCAATGATCCCCAACCATAAGCCCTGTGTTGTGGGGCACTCTGTAAATAGAAAGTCCCACAGAGAGACCATGAGGAGTACAAGACTGGAAGTAAGGGAAAGGGGCTGAACACAAGCAATTTCTGCTATTTTAAAAAGAACGTAGGATTAATATAGAGGTTCTCTTCATTTTATACACTGTGTAAACCTAAAATGAAGGTATATGTTCCCTTTAAAAATGCCTATAAGCCATGGTGAAATAATTGGGTTGAAAATGGCATAAGTCTAGTAAGGTTATGCTGGTGTAGCTAAAACATTACATCAGATGTTCTTTTGCAATGATATGGTTTATGTGCTAGATGGATTTATGTTGGAAAGGGAAGCTCAGTGTTAGTACTAATGCCGCTAGAATGTTAATACCAGCATGCTGAATGGGCGAGGGTTCTTTTTTACAGCAGCAGAAGGATTCATGTTCCTAAATGTGCATGGATAGCAAGGCCTACAGTTCTGTTCTCTCCTTCCTGTGTGATTTACCATCTCAGGTTCAACAATAAAGTCTAATAAGGCCCC
  3   1   2       bld Eye       in                         CCAX2024.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCATTTCAGCATCAAAATCTGCTCTGTGTGCATATTCCAGGCTTGACGCAGTGGCTTCAGGGGTAGACACAGAAGAGCATAAGGGGCGGATTCTCAGTCTGTGTTTGTCCAAAGGCCGATAATCTGTCATGTGTGGCATAAGCCCTGTGTTGTGGGGCACTCTGTAAATAGAAAGTCCCACAGAGAGACCATGAGGAGTGCAAGACTGGAAGTAAGGGAAAGGGGCTGAACACAAGCAATTTCTGCTATTTTAAAAAGAACGTAGGATTAATATAGAGGTTCTCTTCATTTTATACACTGTGTAAACCTAAAATGAAGGTATATGTTCCCTTTAAAAATGCCTATAAGCCATGGTGAAATAATTGGGTTGAAAATGGCATAAGTCTAGTAAGGTTATGCTGGTGTAGCTAAAACATTACATCAGATGTTCTTTTGCAATGATATGGTTTATGTGCTAGATGGATTTATGTTGGAAAGGGAAGCTCAGTGTTAGTACTAATGCCGCTAGAATGTTAATACCAGCATGCTGAATGGGCGAGGGTTCTTTTTTACAGCAGCAGAAGGATTCATGTTCCTAAATGTGCATGGATAGCAAGGCCTACAGTTCTGTTCTCTCCTTCCTGTGTGATTTACCATCTCAGGTTCAACAATAAAGTCTAATAAGGCCCAGTGTTTCTTAGATTTACCGGTTA
  5   1   2       bld Kid1                                 CABA9467.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATTTTATACACTGTGTAAACCTAAAATGAAGGTATATGTTCCCTTTAAAAATGCCTATAAGCCATGGTGAAATAATTGGGTTGAAAATGGCATAAGTCTAGTAAGGTTATGCTGGTGTAGCTAAAACATTACATCAGATGTTCTTTTGCAATGATATGGTTTATGTGCTAGATGGATTTATGTTGGAAAGGGAAGCTCAGTGTTAGTACTAATGCCGCTAGAATGTTAATACCAGCATGCTGAATGGGCGAGGGTTCTTTTTTACAGCAGCAGAAGGATTCATGTTCCTAAATGTGCATGGATAGCAAGGCCTACAGTTCTGTTCTCTCCTTCCTGTGTGATTTACCATCTCAGGTTCAACAATAAAGTCTAATAAGGCCCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaN

In case of problems mail me! (mike.gilchrist@crick.ac.uk)