Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAJ15763.3                          95 END     1           1        1                WD repeat and FYVE domain containing 3 isoform 1 [Homo sapiens]
     2   2.0    0Xt7.1-XZT33107.5                            2 END     2           3      100                (no blast hit)
     3   2.0    0Xt7.1-CAAK5218.5                            2 END     1           1       50                PREDICTED: hypothetical protein [Strongylocentrotus purpuratus]

 This cluster: approximate FL confidence score = 99%

 1012075819 Xt7.1-CABD12528.3 - 65 ESTs
                                                                       ........-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABD12528.3                                       CTAGAGCGCGCAGTAGGAGGAGCGGAGAGCAGTGGGAGATGTGACCGGGGGACCCGGCGTGTGTCCTCCGCCCTGAGGCAGGCGGCATCCCTCCGCTGTTCGGGAGGAGGAGGAGGTGGCAGCGAGCATGGCGGACAAGGGCAGGCTGAGCTTCCCGGGGGCACTGAACAGGCCAGTGCCTATGAACCTCTTTGCTACCTGGGAAATAGACGGTTCCAGCCCCAGCTGCATCCCCAGGCTCTGCAGTCTAACTCTGAAGAAGCTTCTGGTGGTCAGGGAGCTGGACAAGGAGCATATTTCAGTGGTCATTGCAGTGAAGATGCAGGGATCCAAACGCATCCTGCGTTCTCATGAGATTGTTCTGCCCCCTGGTGGACAAGTGGAGACAGACCTGGCACTTACATTTTCATTGCAGTACCCTCACTTTCTGAAAAGGGAAGGAAATAAACTACAGATTATGCTTCAGAGGCGGAAAAGATACAAAAACCGAACGATTCTAGGTTACAAGACTCTAGCTGTCGGCAGCATTAACATGGCTGAGGTCATGCAGCATCCGACGGAAGGAAGCCAAGTCTTGAGCCTGTTTAGTAACATGAAGGAGGCATCGGCCAAAGTAGCAGAGATATGGATATTTTCACTCTCCAGTCAACCGATTGACCACGAAGACAGCACCATGCACACCAGCCAAAAAATCAAGTCCACAGATAACTATTCTGAGGAAGAGTATGAAAGTTTCTCCTCGGAGCAAGAAGCCAGTGATGATGCTGTGCAAGGACAGGATTTAGATGACGATGAATTCGATGTTGGGAAACCAAAGAAGCAGCGAAGAACGATAGTAAGAACGACGTCAATAACCAGGCAACAGAACTTCAAGCAGAAGGTGGTGGCGTTGTTACGGAGGTTTAAAGTTTCCGACGAGGTGCTCGACTCTGAGCAGGACCCAGGCGAGCATGTGCCGGAGGTTGAAGAGGACATGGACTTATTGTATGATACACTTGATATTGAGAACCCCAGTGACAGTGGCCCAGAGATGGAAGATGATGACAGTGTCCTTAGCACGCCCAAGCCAAAGCTAAAACCTTACTTCGAGGGCCTGTCCCACTCCAGCTCTCAGACAGAGATCGGCAGCTTACACAGTGCGAGAAGCCAGAGGGAATTACCCAGTCCGGTGGAAGTCCCTGAGAGACGGACATCGGGACCCAAGCCTCAGTCTGATTGTGTCTCTGATACAGTGTCGCTGGAGGCCGCTCAGCAAGAAGCCCAGGATGCAGAGTTGTCCACGCTGGATGTCTTCATTGAGAGGTTACCACCTAGTGGCAAGATTACCAAAACGGAATCCTTAATAATCCCTTCAACCAGGTTAGAAGGGAAACAGGCAGGACGCCGGGGCCGAAGTACATCTCTGAAGGAAAGGCAGCCGGCAAGGCCTCAGAATGAACGGGCCAACAGTCTTGATAATGAGCGCTCCCCCGACACAAGGAACCATCTACAGATACCCAGGAAAACAGTCTACGATCAGTTAAACCACATCCTGATTTCAGATGACCATCTACCTGAAAATATTATTCTCATCAACACGTCTGATTGGCAGGGCCAGCTTCTTTCCGACATCTTGCAAAAGCACGACCTTCCCTTAGTAGGCACGTGTTCCCCCGCTGACATCCAGGCAGCCTTCAATACAATAGTGTCCAGGATACAGCGCTATTGCAACTGCAATTCTCAGCCCCCAAACCCTGTGAAAGTGGCGGTGGCAGGAGCTCAGAATTACCTCAGTGCCGTGCTGAGAATGTTTGTAGAGCAGCTGTCACACAAGACTCCAGACTGGCTGGGCTACCTGAGGTTCCTCATCATCCCACTAGGATCTCACCCGGTTGCCAAGTATCTGGGATCAGTAGATTACAAGTACAACAACCTCTTTCAGGATCCAGCATGGAGGGATCTCTTCTCTAAACTGGATGCACAAACAGCGGTGCAAGACCCTCCAGATGTGGCGTCCCGCGTCACGCAGTATATCTCCGGAGCCAACTGTGCCCACCAGCTGCCCATTGCAGAGGCCATGCTCACTTACAAGCAGAAAAGCCCTGACGAAGACTCCTCACAGAAGTTCATACCTTTTGTTGGGGTGGTAAAAGTTGGTATTGTTGAGCAGTCCTCAGCAACCTCAGGGGATTCAGACGATGCTGCGCCGTCAGGTTCCACTGTACTCTCATCCACTCCGCCCTCCATTTCTCCCGCTGTGAAAGAAGCATCTCCCACTCCCCCCTCCTCTCCATCTGTTACGTCTGGGTTCTCCTCTTCGCCAAGCCAAAGCCCAGGAGGGGAACTCATGGGGCTCCAACTGGATTACTGGATTGCCGCCCCTTTCGCAGAGAAGAAGAAAGACTTGGAGAAGAAGGACTCCACCTCCGCCAAGAACACTTTGAAATGCACTTTCCGCTCGCTGCAGGTCAGCAGGCTTCCCAGCAACAGTGACGTCCCCTCTGCTCCCACAATGTCCATGACCGTTGTCATGAAGGAAAAAAACAAAAAAGTCATGTTTTTGCCGAAGAAGACAAAGGATAAAGAAGTGGAATCTAAGAGCCAATGTATCGAAGGCATCAGTAGACTCATTTGCACTGCAAAACACCAACAGAACATGCTCAGAGTGCTGATCGATGGAGTGGAATGGAACGACGTCAAGTTTTTCCAGTTGGCTGCACAGTGGTCCTCTCACGTCAAGCACTTTCCCATATGTATATTCGGACACTCTAAAGCCAACTTCTAGCCTTTTTACCAGGCGGATCCCTCTGACCCGACACTCCTCCCCCTCCCCCCCGCAGGCTGGATGTACGGATACCATACACTAATGAGTGCCAACTACTCTCTCCGAATTAAAACCATCCAGCTACGACTTCCTTTCACTTTATTATTATTTTTTTTTTTTACTATTGTTTTTATTATTGTGCAGATTATTTAAAGCTATGCTTGAAGTTACCTTTTTATATTAATTTTTAATTTTACTACCAAGGGAGGTTAAAACTTTAAAAAAAAAAAGGAACAAAAATAAAAAAACAAAAATAAAAAAAGTCTTAAGTACAACTGTTAACACACGACAGTAACTTTGGTACTCTAACGATTGGGTGAATAACTGCACTGCTTAATAACGTGTTACATGTTGTGGGGTGAATACCCGTTCTGATTGGTGTTTTGCTCTATTGGACGGGCCTGACGTAGGCAGAGAGAACTAAACTGCTACTTACAGTGAATGGTGTTTGCACTTTGCTCTGACTTTCTTGCCATCACGTTCTTCTTGGTTTGTCTGTTACATTGATCGTCAAGGGACGCAGCCTCGTTTCATAGAACACTAGCAGCTTGGTATGGAAGGGTGGGCTTGTATAGCTAGTGGCTTGGTAAGTTTCCTTGGCTTGGCTTTGTAGATAGGTTTCTGCCCTACTCACTGATCTTAATATGACCAGCAAATCCTTAAATGCTTTATTTATATGGGCCCATTAGGGGAGGAGTTACAGTAAGAATCATGAATGTCTACGAGACCCAGTGGATGCTGTCTCTAGTAACGGCTGCCCCTGGAATAAAAGACTACTTTTAACAGGACTATTATTCTGGTAGTTTTTAGATTTGTAGAGGTTAATTTGGAGGCGAGAAACTCACTCACCGTCTTCCCCCACCTTCTCTCTGATTTGCTGCTGCCTCCATTGAGATGATATAAAGCTATCCCTGCACCCTCTTGTACATACTTGGGCTGCAGAACCCAGCAGTGTGTCTGTGGGAGCCCCCAGTAGTGGGGTGGACCAGCTTGGGGAAGATGCAGTGCTTCTCAGCTTGTGGGTCAGTGCTTCTGTGTATGAGCTTTAAGGCCACATTGGCAGGGTTTTGTCTATTTCTTTCACAAAATTATGCAAAATGGACAATATTTTGACTGGTTATAAATGTCAGGCTGTGCATAATGTCTTGCCCTGGTGGTTCTATGTTAATATGCAATGCATTTTTGCATCCTCTGGTACAGACAGGGTAAAACTCATGGTCTAGAAACAGGGTAAGGCTCCATCTGTGATGATGTTTACCAAATGAAAGTCATGCCTGGATCCTTCAGCGTGGTTTGTGATGTCTTGGCCGTGGCGACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTAATTTTCCTGACTGTCCAACGACTACCACCAGCACATATTTGGGTCACACTTCAGCATTTGATGGTGATCCTTTTCACTGGCACAATGGGGCATGCCCATGTTTAAAGAACAAATCAGGAACTCTATAGTGTAAATCAGGCTGTCATTGGTAGGCCCTACGCAAACTGGCTTTGGTCTTGTGCATCACTTGACCTAACTCTTAATATAGCACAATATTCAGCAAGCGATGCGCTACCCTAGAGTGCATTCATCTCCAGTACTTCAGTGTTTATCAGGTAGACGGAAGGTTTGCTGTTTCACCATTGGATGGGACTTTGTTGTGTTGCAGTGCAATGCTCAGAGTAACCTTCAGAGGCTAAAGGCAGGTTTGTTGGTTGAGGCTTAGCCGGCAGTTCTGTATCCGCCGTACAGTACACAAAGGTTGGTCAGCAGGGAATGAGTCTTTTATAGTAGTTGACCTATTAGCTGTGATGTGGCTGCAGTGCAAGCCTATCTGACTGTGAAGGGGTTAAATACTTTGTTGTTCTGATTTTCCTTTCATAAATGCAACACTTTCATTAAAAAACTACAAACCTAAAAAAAAAA
                                                  Xt7.1-CHK-1008224636                                             CGCGCAGTAGGAGGAGCGGAGAGCAGTGGGAGATGTGACCGGGGGACCCGGCGTGTGTCCTCCGCCCTGAGGCAGGCGGCATCCCTCCGCTGTTCGGGAGGAGGAGGAGGTGGCAGCGAGCATGGCGGACAAGGGCAGGCTGAGCTTCCCGGGGGCACTGAACAGGCCAGTGCCTATGAACCTCTTTGCTACCTGGGAAATAGACGGTTCCAGCCCCAGCTGCATCCCCAGGCTCTGCAGTCTAACTCTGAAGAAGCTTCTGGTGGTCAGGGAGCTGGACAAGGAGCATATTTCAGTGGTCATTGCAGTGAAGATGCAGGGATCCAAACGCATCCTGCGTTCTCATGAGATTGTTCTGCCCCCTGGTGGACAAGTGGAGACAGACCTGGCACTTACATTTTCATTGCAGTACCCTCACTTTCTGAAAAGGGAAGGAAATAAACTACAGATTATGCTTCAGAGGCGGAAAAGATACAAAAACCGAACGATTCTAGGTTACAAGACTCTAGCTGTCGGCAGCATTAACATGGCTGAGGTCATGCAGCATCCGACGGAAGGAAGCCAAGTCTTGAGCCTGTTTAGTAACATGAAGGAGGCATCGGCCAAAGTAGCAGAGATATGGATATTTTCACTCTCCAGTCAACCGATTGACCACGAAGACAGCACCATGCACACCAGCCAAAAAATCAAGTCCACAGATAACTATTCTGAGGAAGAGTATGAAAGTTTCTCCTCGGAGCAAGAAGCCAGTGATGATGCTGTGCAAGGACAGGATTTAGATGACGATGAATTCGATGTTGGGAAACCAAAGAAGCAGCGAAGAACGATAGTAAGAACGACGTCAATAACCAGGCAACAGAACTTCAAGCAGAAGGTGGTGGCGTTGTTACGGAGGTTTAAAGTTTCCGATGAGGTGCTCGACTCTGAGCAGGACCCAGGCGAGCATGTGCCGGAGGTTGAAGAGGACATGGACTTATTGTATGATACACTTGATATTGAGAACCCCAGTGACAGTGGCCCAGAGATGGAAGATGATGACAGTGTCCTTAGCACGCCCAAGCCAAAGCTAAAACCTTACTTCGAGGGCCTGTCCCACTCCAGCTCTCAGACAGAGATCGGCAGCTTACACAGTGCGAGAAGCCAGAGGGAATTACCCAGTCCGGTGGAAGTCCCTGAGAGACGGACATCGGGACCCAAGCCTCAGTCTGATTGTGTCTCTGATACAGTGTCGCTGGAGGCCGCTCAGCAAGAAGCCCAGGATGCAGAGTTGTCCACGCTGGATGTCTTCATTGAGAGGTTACCACCTAGTGGCAAGATTACCAAAACGGAATCCTTAATAATCCCTTCAACCAGGTTAGAAGGGAAACAGGCAGGACGCCGGGGCCGAAGTACATCTCTGAAGGAAAGGCAGCCGGCAAGGCCTCAGAATGAACGGGCCAACAGTCTTGATAATGAGCGCTCCCCCGACACAAGGAACCATCTACAGATACCCAGGAAAACAGTCTACGATCAGTTAAACCACATCCTGATTTCAGATGACCATCTACCTGAAAATATTATTCTCATCAACACGTCTGATTGGCAGGGCCAGCTTCTTTCCGACATCTTGCAAAAGCACGACCTTCCCTTAGTAGGCACGTGTTCCCCCGCTGACATCCAGGCAGCCTTCAATACAATAGTGTCCAGGATACAGCGCTATTGCAACTGCAATTCTCAGCCCCCAAACCCTGTGAAAGTGGCGGTGGCAGGAGCTCAGAATTACCTCAGTGCCGTGCTGAGAATGTTTGTAGAGCAGCTGTCACACAAGACTCCAGACTGGCTGGGCTACCTGAGGTTCCTCATCATCCCACTAGGATCTCACCCGGTTGCCAAGTATCTGGGATCAGTAGATTACAAGTACAACAACCTCTTTCAGGATCCAGCATGGAGGGATCTCTTCTCTAAACTGGATGCACAAACAGCGGTGCAAGACCCTCCAGATGTGGCGTCCCGCGTCACGCAGTATATCTCCGGAGCCAACTGTGCCCACCAGCTGCCCATTGCAGAGGCCATGCTCACTTACAAGCAGAAAAGCCCTGACGAAGACTCCTCACAGAAGTTCATACCTTTTGTTGGGGTGGTAAAAGTTGGTATTGTTGAGCAGTCCTCAGCAACCTCAGGGGATTCAGACGATGCTGCGCCGTCAGGTTCCACTGTACTCTCATCCACTCCGCCCTCCATTTCTCCCGCTGTGAAAGAAGCATCTCCCACTCCCCCCTCCTCTCCATCTGTTACGTCTGGGTTCTCCTCTTCGCCAAGCCAAAGCCCAGGAGGGGAACTCATGGGGCTCCAACTGGATTACTGGATTGCCGCCCCTTTCGCAGAGAAGAAGAAAGACTTGGAGAAGAAGGACTCCACCTCCGCCAAGAACACTTTGAAATGCACTTTCCGCTCGCTGCAGGTCAGCAGGCTTCCCAGCAACAGTGACGTCCCCTCTGCTCCCACAATGTCCATGACCGTTGTCATGAAGGAAAAAAACAAAAAAGTCATGTTTTTGCCGAAGAAGACAAAGGATAAAGAAGTGGAATCTAAGAGCCAATGTATCGAAGGCATCAGTAGACTCATTTGCACTGCAAAACACCAACAGAACATGCTCAGAGTGCTGATCGATGGAGTGGAATGGAACGACGTCAAGTTTTTCCAGTTGGCTGCACAGTGGTCCTCTCACGTCAAGCACTTTCCCATATGTATATTCGGACACTCTAAAGCCAACTTCTAGCCTTTTTACCAGGCGGATCCCTCTGACCCGACACTCCTCCCCCTCCCCCCCGCAGGCTGGATGTACGGATACCATACACTAATGAGTGCCAACTACTCTCTCCGAATTAAAACCATCCAGCTACGACTTCCTTTCACTTTATTATTATTTTTTTTTTTTACTATTGTTTTTATTATTGTGCAGATTATTTAAAGCTATGCTTGAAGTTACCTTTTTATATTAATTTTTAATTTTACTACCAAGGGAGGTTAAAACTTTAAAAAAAAAAAGGAACAAAAATAAAAAAACAAAAATAAAAAAAGTCTTAAGTACAACTGTTAACACACGACAGTAACTTTGGTACTCTAACGATTGGGTGAATAACTGCACTGCTTAATAACGTGTTACATGTTGTGGGGTGAATACCCGTTCTGATTGGTGTTTTGCTCTATTGGACGGGCCTGACGTAGGCAGAGAGAACTAAACTGCTACTTACAGTGAATGGTGTTTGCACTTTGCTCTGACTTTCTTGCCATCACGTTCTTCTTGGTTTGTCTGTTACATTGATCGTCAAGGGACGCAGCCTCGTTTCATAGAACACTAGCAGCTTGGTATGGAAGGGTGGGCTTGTATAGCTAGTGGCTTGGTAAGTTTCCTTGGCTTGGCTTTGTAGATAGGTTTCTGCCCTACTCACTGATCTTAATATGACCAGCAAATCCTTAAATGCTTTATTTATATGGGCCCATTAGGGGAGGAGTTACAGTAAGAATCATGAATGTCTACGAGACCCAGTGGATGCTGTCTCTAGTAACGGCTGCCCCTGGAATAAAAGACTACTTTTAACAGGACTATTATTCTGGTAGTTTTTAGATTTGTAGAGGTTAATTTGGAGGCGAGAAACTCACTCACCGTCTTCCCCCACCTTCTCTCTGATTTGCTGCTGCCTCCATTGAGATGATATAAAGCTATCCCTGCACCCTCTTGTACATACTTGGGCTGCAGAACCCAGCAGTGTGTCTGTGGGAGCCCCCAGTAGTGGGGTGGACCAGCTTGGGGAAGATGCAGTGCTTCTCAGCTTGTGGGTCAGTGCTTCTGTGTATGAGCTTTAAGGCCACATTGGCAGGGTTTTGTCTATTTCTTTCACAAAATTATGCAAAATGGACAATATTTTGACTGGTTATAAATGTCAGGCTGTGCATAATGTCTTGCCCTGGTGGTTCTATGTTAATATGCAATGCATTTTTGCATCCTCTGGTACAGACAGGGTAAAACTCATGGTCTAGAAACAGGGTAAGGCTCCATCTGTGATGATGTTTACCAAATGAAAGTCATGCCTGGATCCTTCAGCGTGGTTTGTGATGTCTTGGCCGTGGCGACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTAATTTTCCTGACTGTCCAACGACTACCACCAGCACATATTTGGGTCACACTTCAGCATTTGATGGTGATCCTTTTCACTGGCACAATGGGGCATGCCCATGTTTAAAGAACAAATCAGGAACTCTATAGTGTAAATCAGGCTGTCATTGGTAGGCCCTACGCAAACTGGCTTTGGTCTTGTGCATCACTTGACCTAACTCTTAATATAGCACAATATTCAGCAAGCGATGCGCTACCCTAGAGTGCATTCATCTCCAGTACTTCAGTGTTTATCAGGTAGACGGAAGGTTTGCTGTTTCACCATTGGATGGGACTTTGTTGTGTTGCAGTGCAATGCTCAGAGTAACCTTCAGAGGCTAAAGGCAGGTTTGTTGGTTGAGGCTTAGCCGGCAGTTCTGTATCCGCCGTACAGTACACAAAGGTTGGTCAGCAGGGAATGAGTCTTTTATAGTAGTTGACCTATTAGCTGTGATGTGGCTGCAGTGCAAGCCTATCTGACTGTGAAGGGGTTAAATACTTTGTTGTTCTGATTTTCCTTTCATAAATGCAACACTTTCATTAAAAAACTxxAAxxCTAAAAAAAAAAAAAAAA
                                                      consensus depths                                            2     2     3     3     3     3     4     4     5     6     6     6     6     6     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     6     8     7     8     7     9     7    10     7     9     7     9     7     9     6     9     6     9     5     8     4     7     4     8     4     8     5     8     5     8     5     8     5     8     5     8     5     8     4     8     3     8     3     8     4     9     5     7     5     7     5     7     5     7     4     6     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     6     6     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     6     4     6     4     6     4     6     4     6     4     6     4     6     5     7     5     7     5     7     5     7     5     7     5     7     4     7     5     7     5     7     5     7     5     7     5     7     5     7     4     6     4     6     3     5     3     5     3     5     3     5     3     5     5     7     4     7     4     7     4     7     4     7     4     6     4     6     4     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     8     7     8     7     7     7     7    10    10    10    10    10    10    10    11    11    12    11    12    11    12    12    13    12    13    13    14    13    14    13    14    13    14    13    14    11    14    13    14    13    14    11    12    12    12    11    12    11    11    11    11    10    12    10    12    11    12    11    12    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    14    13    14    13    14    13    14    12    14    12    14    13    14    10    14    12    14    12    14    11    14    12    14    11    14    12    14    12    14     7    12     8    12     8    11     8    12     8    12     8    11     8    11     8    12    10    12    10    12     9    12     6     7     8     8     8     8     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    11    10    11    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    10    10    10    10    10    10    10    10    10    11    12    11    12    11    12    11    12    11    12    11    12    10    11    10    11    11    12    11    12    11    12    10    12    10    12    10    12    10    11    10    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11    10    12    10    12     9    11     9    10     8    10     8    10     7     9     8    10     6     8     6     8     6     7     6     7     6     7     5     6     7     8     7     8     7     8    10    11    11    12     9    12    11    12    13    14    13    14    13    14    14    15    14    15    14    15    14    15    14    15    17    18    18    19    19    20    19    19    19    19    20    20    20    20    20    20    20    20    19    20    20    20    20    20    20    20    20    20    20    20    19    20    19    19    18    18    17    18    17    18    17    18    17    18    17    18    17    18    17    17    17    17    17    17    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    15    15    13    15    15    15    15    15    15    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    13    15     4     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----C-------
                                               BLH ATG     127     629                                       
                                               BLH MIN     121     195                                       
                                               BLH OVR     127     403                                       
                                               EST CLI     -18       1                                       
                                               ORF LNG     127     238                                       
                                                                                                                                                                                                                                                                 PREDICTED - Ce ---- 1e-067     NP_505387.1 putative protein, with a coiled coil domain, of bilaterial origin (89.4 kD)(5J694) [Caenorhabditis elegans] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - ?? ---- 2e-081     XP_699793.1 PREDICTED: similar to Phosphofurin acidic cluster sorting protein 1 (PACS-1), partial [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 3e-112     NP_732935.2 CG5405-PC, isoform C [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PREDICTED - Sp ---- 2e-117     XP_796424.2 PREDICTED: similar to PACS1L protein, partial [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PREDICTED - Dr ---- 0          XP_697488.1 PREDICTED: similar to phosphofurin acidic cluster sorting protein 1 [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Hs ==== 0          NP_056012.1 phosphofurin acidic cluster sorting protein 2 [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PREDICTED = Mm ==== 0          XP_203601.6 PREDICTED: similar to phosphofurin acidic cluster sorting protein 2 isoform 1 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                   PREDICTED = Gg ==== 0          XP_422219.2 PREDICTED: similar to PACS1L protein [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Xl ==== 0          AAI30133.1 Unknown (protein for IMAGE:6863450) [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABD12528.3                                        TAG---------TAG---------------------------------------------------------TGA---------------------------------------------------ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG---------ATG---------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------ATG---------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------TAA---------TGA---------------------------------------------TAA---------------------------TAA------------------------------------TAA------------------------TAA------------TAA------------------------ATG---------------------TGA---------------------------TGA---------------------------------TGAATG------------------------------------------------------------TGA---------------------------------------------------------------------TAG------------------------------------------------------------------TGA------------TAAATG---------------------------------------------ATG---------------------ATG------------------------------------------TAA------------------------TAG------------TAA---------------------------------------------TGA---------------------ATG---TAA------------------------------------------------------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------------------TGA---------------------------ATG------------------ATG------------------------------------------TAA------------------------------------TGATGA---------------------------------------------TGA---------------------------------------------------------------------------TAA------TGA------------------------------------------------TGA---TGA------------------------ATG---ATG------------------------------TAA------------------------------------------------------------TAA---------TAG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------TGA---------------TGA---------------------------------------------------------------------TGA---------------------------------------------TAA
                                                                   ORF                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   2       bld Gas1 5g                            IMAGE:6989136                     GACGCGCTCACTGGGGCTCTAGAGCGCGCAGTAGGAGGAGCGGAGAGCAGTGGGAGATGTGACCGGGGGACCCGGCGTGTGTCCTCCGCCCTGAGGCAGGCGGCATCCCTCCGCTGTTCGGGAGGAGGAGGAGGTGGCAGCGAGCATGGCGGACAAGGGCAGGCTGAGCTTCCCGGGGGCACTGAACAGGCCAGTGCCTATGAACCTCTTTGCTACCTGGGAAATAGACGGTTCCAGCCCCAGCTGCATCCCCAGGCTCTGCAGTCTAACTCTGAAGAAGCTTCTGGTGGTCAGGGAGCTGGACAAGGAGCATATTTCAGTGGTCATTGCAGTGAAGATGCAGGGATCCAAACGCATCCTGCGTTCTCATGAGATTGTTCTGCCCCCTGGTGGACAAGTGGAGACAGACCTGGCACTTACATTTTCATTGCAGTACCCTCACTTTCTGAAAAGGGAAGGAAATAAACTACAGATTATGCTTCAGAGGCGGAAAAGATACAAAAACCGAACGATTCTAGGTTACAAGACTCTAGCTGTCGGCAGCATTAACATGGCTGAGGTCTTGCAGCATCCGACGGAATGAAGCCAAGTCTTGAGCCTGTTTAGTAACATGAAAGAGGCATCGGCCCAAGTAACAGAGATATGGATATTTCCCCTCTCCCGTCAACCGATTGACCACGAAGACAGCACCCTTGCACCCCGGCCCAAAAAATCGAGTCCCCCGAAAACCAATTCGGAGGAAGAATATGAAAGTTTCCTCCCGGGACCAAAAAACCCAGTGGAATATGCCTTTGGCAAGGGACCGGGATTCTAGAATGAACAATGAATTTCCGAGTGTGTGGGAAAACCCCAGAAAACCCCGCGACAAACTGATTTTTTAAGAACCGCACTTTCAATTAACCAAGCTAACCGATAACCTTCCAGGCCAGAAAGGGGGGTGGGGCGGTTTTTTTTACGGAGGTTTTTAAAAGTTTCCCCAAACAAAGGGTGCCTAGCACTTCCTGAGAGGAGGAACA
  5   1   2   10  bld Bone 5g3  in                       CBTC11808.fwd ......................................CTAGAGCGCGCAGTAGGAGGAGCGGAGAGCAGTGGGAGATGTGACCGGGGGACCCGGCGTGTGTCCTCCGCCCTGAGGCAGGCGGCATCCCTCCGCTGTTCGGGAGGAGGAGGAGGTGGCAGCGAGCATGGCGGACAAGGGCAGGCTGAGCTTCCCGGGGGCACTGAACAGGCCAGTGCCTATGAACCTCTTTGCTACCTGGGAAATAGACGGTTCCAGCCCCAGCTGCATCCCCAGGCTCTGCAGTCTAACTCTGAAGAAGCTTCTGGTGGTCAGGGAGCTGGACAAGGAGCATATTTCAGTGGTCATTGCAGTGAAGATGCAGGGATCCAAACGCATCCTGCGTTCTCATGAGATTGTTCTGCCCCCTGGTGGACAAGTGGAGACAGACCTGGCACTTACATTTTCATTGCAGTACCCTCACTTTCTGAAAAGGGAAGGAAATAAACTACAGATTATGCTTCAGAGGCGGAAAAGATACAAAAACCGAACGATTCTAGGTTACAAGACTCTAGCTGTCGGCAGCATTAACATGGCTGAGGTCATGCAGCATCCGACGGAAGGAAGCCAAGTCTTGAGCCTGTTTAGTAACATGAAGGAGGCATCGGCCAAAGTAGCAGAGATATGGATATTTTCACTCTCCAGTCAACCGATTGACCACGAAGACAGCACCATGCACACCAGCCAAAAAATCAAGTCCACAGATA
  5   1   2       bld Neu0 5g3  in                     NISC_ng15a03.y1                                               CGCAGTAGGAGGAGCGGAGAGCAGTGGGAGATGTGACCGGGGGACCCGGCGTGTGTCCTCCGCCCTGAGGCAGGCGGCATCCCTCCGCTGTTCGGGAGGAGGAGGAGGTGGCAGCGAGCATGGCGGACAAGGGCAGGCTGAGCTTCCCGGGGGCACTGAACAGGCCAGTGCCTATGAACCTCTTTGCTACCTGGGAAATAGACGGTTCCAGCCCCAGCTGCATCCCCAGGCTCTGCAGTCTAACTCTGAAGAAGCTTCTGGTGGTCAGGGAGCTGGACAAGGAGCATATTTCAGTGGTCATTGCAGTGAAGATGCAGGGATCCAAACGCATCCTGCGTTCTCATGAGATTGTTCTGCCCCCTGGTGGACAAGTGGAGACAGACCTGGCACTTACATTTTCATTGCAGTACCCTCACTTTCTGAAAAGGGAAGGAAATAAACTACAGATTATGCTTCAGAGGCGGAAAAGATACAAAAACCGAACGATTCTAGGTTACAAGACTCTAGCTGTCGGCAGCATTAACATGGCTGAGGTCATGCAGCATCCGACGGAAGGAAGCCAAGTCTTGAGCCTGTTTAGTAACATG
  5   1   2   14  bld Brn3 5g3  in                        CAAK10798.5p ....................................................................AGTGGGAGATGTGACCGGGGGACCCGGCGTGTGTCCTCCGCCCTGAGGCAGGCGGCATCCCTCCGCTGTTCGGGAGGAGGAGGAGGTGGCAGCGAGCATGGCGGACAAGGGCAGGCTGAGCTTCCCGGGGGCACTGAACAGGCCAGTGCCTATGAACCTCTTTGCTACCTGGGAAATAGACGGTTCCAGCCCCAGCTGCATCCCCAGGCTCTGCAGTCTAACTCTGAAGAAGCTTCTGGTGGTCAGGGAGCTGGACAAGGAGCATATTTCAGTGGTCATTGCAGTGAAGATGCAGGGATCCAAACGCATCCTGCGTTCTCATGAGATTGTTCTGCCCCCTGGTGGACAAGTGGAGACAGACCTGGCACTTACATTTTCATTGCAGTACCCTCACTTTCTGAAAAGGGAAGGAAATAAACTACAGATTATGCTTCAGAGGCGGAAAAGATACAAAAACCGAACGATTCTAGGTTACAAGACTCTAGCTGTCGGCAGCATTAACATGGCTGAGGTCATGCAGCATCCGACGGAAGGAAGCCAAGTCTTGAGCCTGTTTAGTAACATGAAGGAGGCATCGGCCAAAGTAGCAGAGATATGGATATTTTCACTCTCCAGTCAACCGATTGACCACGAAGACAGCACCATGCACACCAGCCAAAAAATCAAGTCCACAGATAACTATTCTGAGGAAGAGTATGAAAGTTTCTCCTCGGAGCAAGAAGCCAGTGATGATGCTGTGCAAGGACAGGATTTAGATGACGATGAATTCGATGTTGGGAAACCAAAGAAGCAGCGAAGAACGATAGTAAGAACGACGTCNATAACCAGGCAACAGAACTTCAGCAGAAGGTGGTGGCGTTGTTACGGAGGTTTAAGTTTCCGATGAGGTGCTCGACTCTG
  5   1   2   14  bld Te4  PIPE in                        CAAN10030.5p ............................................................................ATGTGACCGGGGGACCCGGCGTGTGTCCTCCGCCCTGAGGCAGGCGGCATCCCTCCGCTGTTCGGGAGGAGGAGGAGGTGGCAGCGAGCATGGCGGACAAGGGCAGGCTGAGCTTCCCGGGGGCACTGAACAGGCCAGTGCCTATGAACCTCTTTGCTACCTGGGAAATAGACGGTTCCAGCCCCAGCTGCATCCCCAGGCTCTGCAGTCTAACTCTGAAGAAGCTTCTGGTGGTCAGGGAGCTGGACAAGGAGCATATTTCAGTGGTCATTGCAGTGAAGATGCAGGGATCCAAACGCATCCTGCGTTCTCATGAGATTGTTCTGCCCCCTGGTGGACAAGTGGAGACAGACCTGGCACTTACATTTTCATTGCAGTACCCTCACTTTCTGAAAAGGGAAGGAAATAAACTACAGATTATGCTTCAGAGGCGGAAAAGATACAAAAACCGAACGATTCTAGGTTACAAGACTCTAGCTGTCGGCAGCATTAACATGGCTGAGGTCATGCAGCATCCGACGGAAGGAAGCCAAGTCTTGAGCCTGTTTAGTAACATGAAGGAGGCATCGGCCAAAGTAGCAGAGATATGGATATTTTCACTCTCCAGTCAACCGATTGACCACGAAGACAGCACCATGCACACCAGCCAAAAAATCAAGTCCACAGATAACTATTCTGAGGAAGAGTATGAAAGTTTCTCCTCGGNAGCAGAAGCCAGTGATGATGCTGTGNCAGGACAGGATTTAGATGACGATGAATTCGATGTTGGGAAACCAAGAAGCAGCGAAGAACGATACANCAGAACTTCAAGCAGAAGGTGGTGGCGTTGT
  5   1   2       bld Gas  5g                        TGas012i19.p1kSP6                                                                                       CCCGGGGGGCGTGTGTCCTCCGCCCTTGAGCAGGCGGCATCCCTCCGCTGTTCGGGAGGAGGAGGAGGTGGCAGCGAGCATGGCGGACAAGGGCAGGCTGAGCTTCCCGGGGGCACTGAACAGGCCAGTGCCTATGAACCTCTTTGCTACCTGGGAAATAGACGGTTCCAGCCCCAGCTGCATCCCCAGGCTCTGCAGTCTAACTCTGAAGAAGCTTCTGGTGGTCAGGGAGCTGGACAAGGAGCATATTTCAGTGGTCATTGCAGTGAAGATGCAGGGATCCAAACGCATCCTGCGTTCTCATGAGATTGTTCTGCCCCCTGGTGGACAAGTGGAGACAGACCTGGCACTTACATTTTCATTGCAGTACCCTCACTTTCTGAAAAGGGAAGGAAATAAACTACAGATTATGCTTCAGAGGCGGAAAAGATACAAAAACCGAACGATTCTAGGTTACAAGACTCTAGCTGTCGGCAGCATTAACATGGCTGAGGTCATGCAGCATCCGACGGAAGGAAGCCAAGTCTTGAGCCTGTTTAGTAACATGACAGAGGCATCGGCCAAAGTAGCAGAGATATGGATATTTTCACTC
  5   1   2   14  bld Brn3 5g3  in                         CAAK1480.5p ...................................................................................................................GCAGGCGGCATCCCTCCGCTGTTCGGGAGGAGGAGGAGGTGGCAGCGAGCATGGCGGACAAGGGCAGGCTGAGCTTCCCGGGGGCACTGAACAGGCCAGTGCCTATGAACCTCTTTGCTACCTGGGAAATAGACGGTTCCAGCCCCAGCTGCATCCCCAGGCTCTGCAGTCTAACTCTGAAGAAGCTTCTGGTGGTCAGGGAGCTGGACAAGGAGCATATTTCAGTGGTCATTGCAGTGAAGATGCAGGGATCCAAACGCATCCTGCGTTCTCATGAGATTGTTCTGCCCCCTGGTGGACAAGTGGAGACAGACCTGGCACTTACATTTTCATTGCAGTACCCTCACTTTCTGAAAAGGGAAGGAAATAAACTACAGATTATGCTTCAGAGGCGGAAAAGATACAAAAACCGAACGATTCTAGGTTACAAGACTCTAGCTGTCGGCAGCATTAACATGGCTGAGGTCATGCAGCATCCGACGGAAGGAAGCCAAGTCTTGAGCCTGTTTAGTAACATGAAGGAGGCATCGGCCAAAGTAGCAGAGATATGGATATTTTCACTCTCCAGTCAACCGATTGACCACGAAGACAGCACCATGCACACCAGCCAAAAAATCAAGTCCACAGATAACTATTCTGAGGAAGAGTATGAAAGTTTCTCCTCGGAGCAAGAAGCCAGTGATGATGCTGTGCAAGGACAGGATTTAGATGACGATGAATTCGATGTTGGGAAACCAAAGAAGCAGCGAAGAACGATACAACAGAACTTNCAGCAGAAGGTGGTGGCGTTGTTAC
  5   1   2       bld Egg       in                   TEgg059i07.p1kSP6                                                                                                                          GGCATCCCTCCGCTGTTCGGGAGGAGGAGGAGGTGGCAGCGAGCATGGCGGACAAGGGCAGGCTGAGCTTCCCGGGGGCACTGAACAGGCCAGTGCCTATGAACCTCTTTGCTACCTGGGAAATAGACGGTTCCAGCCCCAGCTGCATCCCCAGGCTCTGCAGTCTAACTCTGAAGAAGCTTCTGGTGGTCAGGGAGCTGGACAAGGAGCATATTTCAGTGGTCATTGCAGTGAAGATGCAGGGATCCAAACGCATCCTGCGTTCTCATGAGATTGTTCTGCCCCCTGGTGGACAAGTGGAGACAGACCTGGCACTTACATTTTCATTGCAGTACCCTCACTTTCTGAAAAGGGAAGGAAATAAACTACAGATTATGCTTCAGAGGCGGAAAAGATACAAAAACCGAACGATTCTAGGTTACAAGACTCTAGCTGTCGGCAGCATTAACATGGCTGAGGTCATGCAGCATCCGACGGAAGGAAGCCAAGTCTTGAGCCTGTTTAGTAACATGAAGGAGGCATCGGCCAAAGTAGCAGAGATATGGATATTTTCACTCTCCAGTCAACCGATTGACCACGAAGACAGCACCATGCACACCAGCCAAAAAATCAAGTCCACAGATAACTATTCTGAG
  3  -1   2       bld Ski1      in                        CABJ11195.3p                                                                                                                                                                                                                                           CTCACAGGAGGGCAGGTGAAGGGAAGTTCCCCTTTAGGAGCCATTTATTTATTTTAGAATGTTGGTGACTGGCCTATTTGTTGCAACATTTTAAGTGGTCTTTGTTTTTTTTAACATTTTTTTTATGGCTGTTTAAACAATATCCTGTTGCCAGGGTCACTGACCCCCTCAGCAACCAAAATAAACTGTTGCTCTGTTAGGCTTCAGTTCTATTCAGGAAGCCTTTTCTCTTCAATGCAAAGTCTCTTATTCAGACCTCTATGTGCTTGGACCCTTGCAGCCATATAACAATTTCAAAAGAGAAATACCGGTACATTCTTGGGGTGAATTCAGTAGTTTCTATGCCTCTCATTTCAAGTCACCCCAGATCATGGAATCTAAACACCAACCCGACAGGATTTTCCAGAAGAAGGCGTAGCAGGTTCCTACATCCCAGACAGAACTAGTTCCAACAGTGCTGCAGTGCTGACTAACTCTTATTTATAGCCGTCTCCATGAAAGCTGGATAATAAATCCCTGTTGGTTTTTCGTTGCCTTTTTTATGTTTCTGCGATATGTTCTGCCAATGTAACCGCAACGTCTTCCCCTTTGTGTCTTATCCCGCCAACCCTTGCTGGCCTGCCCGACCAGAGCTTTCATGTCATGTTTTCTGCTCGTTTACAGCAACAGAACTTCAAGCAGAAGGTGGTGGCGTTGTTACGGAGGTTTAAAGTTTCCGACGAGGTGCTCGACTCTGAGCAGGACCCAGGCGAGCATGTGCCGGAGGTTGAAGAGGACATGGACTTATTGTATGATACACTTGATATTGAGAACCCCAGTGACAGTGGCCCAGAGATGGAAGATGATGACAGTGTCCTTAGCACGCCCAAGCCAAAGCTAAAAACTTACTTCGAGGGCCTGT
  5   1   2       bld Egg0                                 dad80h01.y3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGGGCAGGGCTATGGATCTCTTCACTCTCCAGTCAACCGATTGACCACGAAGACAGCACCATGCACACCAGCCAAAAAATCAAGTCCACAGATAACTATTCTGAGGAAGAGTATGAAAGTTTCNTCCTTCGGAGCAAGAAGCCAGTGATGATGCTGTGCAAGGACAGGATTTAGATGACGATGAATTCGATGTTGGGAAACCAAAGAAGCAGCGAAGAACGATAGTAAGAACGACGTCAATAACCAGGCAACAGAACTTCAAGCAGAAGGTGGTGGCGTTGTTACGGAGGTTTAAAGTTTCCGATGA
  5   1   2       bld Egg                            TEgg044e09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTATATTGGATATTTTCACTCTCCAGTCAACCGATTGACCACGAAGACAGCACCATGCACACCAGCCAAAAAATCAAGTCCACAGATAACTATTCTGAGGAAGAGTATGAAAGTTTCTCCTCGGAGCAAGAAGCCAGTGATGATGCTGTGCAAGGACAGGATTTAGATGACGATGAATTCGATGTTGGGAAACCAAAGAAGCAGCGAAGAACGATAGTAAGAACGACGTCAATAACCAGGCAACAGAACTTCAAGCAGAAGGTGGTGGCGTTGTTACGGAGGTTTAAAGTTTCCGATGAGGTGCTCGACTCTGAGCAGGACCCAGGCGAGCATGTGCCGGAGGTTGAAGAGGACATGGACTTATTGTATGATACACTTGATATTGAGAACCCCAGTGACAGTGGCCCAGAGATGGAAGATGATGACAGTGTCCTTAGCACGCCCAAGCCAAAGCTAAAACCTTACTTCGAGGGCCTGTCCCACTCCAGCTCTCAGACAGAGATCGGCAGCTTACACAGTGCGAGAAGCCAGAGGGAATTACCCAGTCCGGTGGAAGTCCCTGAGAGACGGACATCGGGACCCAAGCCTCAGTCTGATTGTGTCTCTGATACAGTGTCGCTGGAGGCCGCTCAGCAAGAAGCCC
  5   1   2       bld Neu                            TNeu028p11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCTGTTGGTTTTTCGTTGCCTTTTTTATGTTTCTGCGATATGTTCTGCCAATGTAACCGCAACGTCTTCCCCTTTGTGTCTTATCCCGCCAACCCTTGCTGGCCTGCCCGACCAGAGCTTTCATGTCATGTTTTCTGCTCGTTTACAGCAACAGAACTTCAAGCAGAAGGTGGTGGCGTTGTTACGGAGGTTTAAAGTTTCCGACGAGGTGCTCGACTCTGAGCAGGACCCAGGCGAGCATGTGCCGGAGGTTGAAGAGGACATGGACTTATTGTATGATACACTTGATATTGAGAACCCCAGTGACAGTGGCCCAGAGATGGAAGATGATGACAGTGTCCTTAGCACGCCCAAGCCAAAGCTAAAACCTTACTTCGAGGGCCTGTCCCACTCCAGCTCTCAGACAGAGATCGGCAGCTTACACAGTGCAAGAAGCCAGAGGGAATTACCCAGTCCGGTGGAAGTCCCTGAGAGACGGACATCGGGACCCAAGCCTCAGTCTGATTGTGTCTCAGATACAGTGTCGCTGGAGGCTGCTCAGCAAGAAGCCCAGGATGCAGAGCTGTCCACACTGGATGTCTTCATTGAGAGGTTACCACCTAGTGGCAAGATTACCAAAACGGAATCCTTA
  5   1   2       bld TbA                            TTbA062p24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCAATAACCAGGCAACAGAACTTCAAGCAGAAGGTGGTGGCGTTGTTACGGAGGTTTAAAGTTTCCGATGAGGTGCTCGACTCTGAGCAGGACCCAGGCGAGCATGTGCCGGAGGTTGAAGAGGACATGGACTTATTGTATGATACACTTGATATTGAGAACCCCAGTGACAGTGGCCCAGAGATGGAAGATGATGACAGTGTCCTTAGCACGCCCAAGCCAAAGCTAAAACCTTACTTCGAGGGCCTGTCCCACTCCAGCTCTCAGACAGAGATCGGCAGCTTACACAGTGCGAGAAGCCAGAGGGAATTACCCAGTCCGGTGGAAGTCCCTGAGAGACGGACATCGGGACCCAAGCCTCAGTCTGATTGTGTCTCTGATACAGTGTCGCTGGAGGCCGCTCAGCAAGAAGCCCAGGATGCAGAGTTGTCCACGCTGGATGTCTTCATTGAGAGGTTACCACCTAGTGGCAAGATTACCAAAACGGAATCCTTAATAATCCCTTCAACCAGGTTAGAAGGGAAACAGGCAGGACGCCGGGGCCGAAGTACATCTCTGAAGGAAAGGCAGCCGGCAAGGCCTCAGAATGAACGGGCCAACAGTCTTGATAATGAGCGCTCCCCCGACACAAGGAACCATCTACAGATACCCAGGAAAACAGTCTACGATCAGTTAAACCACATCCTGATTTCAGATGACCATCTACCTGANAATATTATTCTCATCAACACGTCTGATTGGCAGGGCCAGCTTCTTTC
  5   1   2       bld Brn4      in                        CAAL22258.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCCACTCCAGCTCTCAGACAGAGATCGGCAGCTTACACAGTGCGAGAAGCCAGAGGGAATTACCCAGTCCGGTGGAAGTCCCTGAGAGACGGACATCGGGACCCAAGCCTCAGTCTGATTGTGTCTCTGATACAGTGTCGCTGGAGGCCGCTCAGCAAGAAGCCCAGGATGCAGAGTTGTCCACGCTGGATGTCTTCATTGAGAGGTTACCACCTAGTGGCAAGATTACCAAAACGGAATCCTTAATAATCCCTTCAACCAGGTTAGAAGGGAAACAGGCAGGACGCCGGGGCCGAAGTACATCTCTGAAGGAAAGGCAGCCGGCAAGGCCTCAGAATGAACGGGCCAACAGTCTTGATAATGAGCGCTCCCCCGACACAAGGAACCATCTACAGATACCCAGGAAAACAGTCTACGATCAGTTAAACCACATCCTGATTTCAGATGACCATCTACCTGAAAATATTATTCTCATCAACACGTCTGATTGGCAGGGCCAGCTTCTTTCCGACATCTTGCAAAAGCACGACCTTCCCTTAGTAGGCACGTGTTCCCCCGCTGACATCCAGGCAGCCTTCAATACAATAGTGTCCAGGATACAGCGCTATTGCAACTGCAATTCTCAGCCCCCAAACCCTGTGAAAGTGGCGGTGGCAGGAGCTCAGAATTACCTCAGTGCCGTGCTGAGAATGTTTGTAGAGCAGCTGTCACACAAGACTCCAGACTGGCTGGGCTACCTGAGGTTCCTCATCATCCCACTAGGATCTCACCCGGTTGCCAAGTATCTGGGATCAGTAGATTATCAGTATCACAACCTCTTTCAGGATCCAGCATGGAGGGATCTCTTCTCTAAACTGGATGCACAAACAGCGGTGCAAGACCCTC
  5   1   2       bld Brn3      in                          CAAK537.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCTGATACAGTGTCGCTGGAGGCCGCTCAGCAAGAAGCCCAGGATGCAGAGTTGTCCACGCTGGATGTCTTCATTGAGAGGTTACCACCTAGTGGCAAGATTACCAAAACGGAATCCTTAATAATCCCTTCAACCAGGTTAGAAGGGAAACAGGCAGGACGCCGGGGCCGAAGTACATCTCTGAAGGAAAGGCAGCCGGCAAGGCCTCAGAATGAACGGGCCAACAGTCTTGATAATGAGCGCTCCCCCGACACAAGGAACCATCTACAGATACCCAGGAAAACAGTCTACGATCAGTTAAACCACATCCTGATTTCAGATGACCATCTACCTGAAAATATTATTCTCATCAACACGTCTGATTGGCAGGGCCAGCTTCTTTCCGACATCTTGCAAAAGCACGACCTTCCCTTAGTAGGCACGTGTTCCCCCGCTGACATCCAGGCAGCCTTCAATACAATAGTGTCCAGGATACAGCGCTATTGCAACTGCAATTCTCAGCCCCCAAACCCTGTGAAAGTGGCGGTGGCAGGAGCTCAGAATTACCTCAGTGCCGTGCTGAGAATGTTTGTAGAGCAGCTGTCACACAAGACTCCAGACTGGCTGGGCTACCTGAGGTTCCTCATCATCCCACTAGGATCTCACCCGGTTGCCAAGTATCTGGGATCAGTAGATTACAAGTACAACAACCTCTTTCAGGATCCAGCATGGAGGGATCTCTTCTCTAAACTGGATGCACAAACAGCGGTGCAAGACCCTCCAGATGTGGCGTCCCGCGTCACGCAGTATATC
  5   1   2       bld Brn3      in                        CAAK13013.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCGCTCAGCAAGAAGCCCAGGATGCAGAGTTGTCCACGCTGGATGTCTTCATTGAGAGGTTACCACCTAGTGGCAAGATTACCAAAACGGAATCCTTAATAATCCCTTCAACCAGGTTAGAAGGGAAACAGGCAGGACGCCGGGGCCGAAGTACATCTCTGAAGGAAAGGCAGCCGGCAAGGCCTCAGAATGAACGGGCCAACAGTCTTGATAATGAGCGCTCCCCCGACACAAGGAACCATCTACAGATACCCAGGAAAACAGTCTACGATCAGTTAAACCACATCCTGATTTCAGATGACCATCTACCTGAAAATATTATTCTCATCAACACGTCTGATTGGCAGGGCCAGCTTCTTTCCGACATCTTGCAAAAGCACGACCTTCCCTTAGTAGGCACGTGTTCCCCCGCTGACATCCAGGCAGCCTTCAATACAATAGTGTCCAGGATACAGCGCTATTGCAACTGCAATTCTCAGCCCCCAAACCCTGTGAAAGTGGCGGTGGCAGGAGCTCAGAATTACCTCAGTGCCGTGCTGAGAATGTTTGTAGAGCAGCTGTCACACAAGACTCCAGACTGGCTGGGCTACCTGAGGTTCCTCATCATCCCACTAGGATCTCACCCGGTTGCCAAGTATCTGGGATCAGTAGATTACAAGTACAACAACCTCTTTCAGGATCCAGCATGGAGGGATCTCTTCTCTAAACTGGATGCACAAACAGCGGTGCAAGACCCTCCAGATGTGGCGTCCCGCGTCACGCAGTATATCTCCGGAGCCAACTGTGCCCACCAGCTGCCCATTGCAGAGGCCATGCTCACTTACAAGCAGAAAAGGAAAAAGAGCTTTCATTTTGATTTTACCTTAAGCCCTGACGAAGAC
  5   1   2       bld Te5       in                        CAAO10582.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCGACACAAGGAACCATCTACAGATACCCAGGAAAACAGTCTACGATCAGTTAAACCACATCCTGATTTCAGATGACCATCTACCTGAAAATATTATTCTCATCAACACGTCTGATTGGCAGGGCCAGCTTCTTTCCGACATCTTGCAAAAGCACGACCTTCCCTTAGTAGGCACGTGTTCCCCCGCTGACATCCAGGCAGCCTTCAATACAATAGTGTCCAGGATACAGCGCTATTGCAACTGCAATTCTCAGCCCCCAAACCCTGTGAAAGTGGCGGTGGCAGGAGCTCAGAATTACCTCAGTGCCGTGCTGAGAATGTTTGTAGAGCAGCTGTCACACAAGACTCCAGACTGGCTGGGCTACCTGAGGTTCCTCATCATCCCACTAGGATCTCACCCGGTTGCCAAGTATCTGGGATCAGTAGATTACAAGTACAACAACCTCTTTCAGGATCCAGCATGGAGGGATCTCTTCTCTAAACTGGATGCACAAACAGCGGTGCAAGACCCTCCAGATGTGGCGTCCCGCGTCACGCAGTATATCTCCGGAGCCAACTGTGCCCACCAGCTGCCCATTGCAGAGGCCATGCTCACTTACAAGCAGAAAAGCCCTGACGAAGACTCCTCACAGAAGTTCATACCTTTTGTTGGGGTGGTAAAAGTTGGTATTGTTGAGCAGTCCTCAGCAACCTCAGGGGATTCAGACGATGCTGCGCCGTCAGGTTCCACTGTACTCTCATCCACTCCGCCCTCCATTTCTCCCGCTGTGAAAGAAGCATCTCCCACTCCCCCCCCTCTCTCATCTGTTACGTCTGGGGT
  5   1   2       bld Brn4      in                         CAAL6213.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTAGCTTCTCACTGTTCGTCTCCTCGTCTATTTGGTGTTTCCAAAGCTAACACTTTGTTTTTCAATAGGTGGTAAAAGTTGGTATTGTTGAGCAGTCCTCAGCAACCTCAGGTAAGGTTCTGCTACTTCTAACGATCATTATAAGCCTCTCCCTAGTGCCCGTTGAGTTAGGGCTTTATTATACAGGGGGGTCAATTAATTACTTCTTTCCTCCCTGAAGAACCAGAGAGATGGTGTCCAGTGTAAACTAAGTGACATAGCACTGGGAAAACTACATGGCTGATAATATGGAAGATTTCCCAAGGCTTCCAAGAGTCATTATGGGACCAGTTATCCTCTACATGCCCCTGAAGGCATCTATCTGATAACTTTATTTTGTATATAATCATATATATTGCCTTCACCAAAGGCCCAAAAAAGCAATTCAACCTCCATTCTTGGGCACATATAAGATATTAAACTCATAAATTAACCCCCATCCTTACTTATCCTTTATAAATCAACACCCTACAGCCAAGAATTCTGAAAATCTTACCTTATATAGATAATTATCCCTTTTAGACATCCATTAGCCATATTTTACAGTCTGACCCTATTTACATTGCTTACAGGGGATTCAGACGATGCTGCGCCGTCAGGTTCCACTGTACTCTCATCCACTCCGCCCTCCATTTCTCCCGCTGTGAAAGAAGCATCTCCCACTCCCCCCTCCTCTCCATCTGTTACGTCTGGGTTCTCCTCTTCGCCAAGCCAAAGCCCAGGAGGGGAACTCATGGGGCTCCAACTGGATTACTGGATTGCCGCCCCTTTCGCAG
  3   1   2       bld Brn2      out                       CAAJ17036.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATACAGGGGGGTCAATTAATTACTTCTTTCCTCCCTGAAGAACCAGAGAGATGGTGTCCAGTGTAAACTAAGTGACATAGCACTGGGAAAACTACATGGCTGATAATATGGAAGATTTCCCAAGGCTTCCAAGAGTCATTATGGGACCAGTTATCCTCTACATGCCCCTGAAGGCATCTATCTGATAACTTTATTTTGTATATAATCATATATATTGCCTTCACCAAAGGCCCAAAAAAGCAATTCAACCTCCATTCTTGGGCACATATAAGATATTAAACTCATAAATTAACCCCCATCCTTACTTATCCTTTATAAATCAACACCCTACAGCCAAGAATTCTGAAAATCTTACCTTATATAGATAATTATCCCTTTTAGACATCCATTAGCCATATTTTACAGTCTGACCCTATTTACATTGCTTACAGGGGATTCAGACGATGCTGCGCCGTCAGGTTCCACTGTACTCTCATCCACTCCGCCCTCCATTTCTCCCGCTGTGAAAGAAGCATCTCCCACTCCCCCCTCCTCTCCATCTGTTACGTCTGGGTTCTCCTCTTCGCCAAGCCAAAGCCCAGGAGGGGAACTCATGGGGCTCCAACTGGATTACTGGATTGCCGCCCCTTTCGCAGAGAAGAAGAAAGACTTGGAGAAGAAGGACTCCACCTCCGCCAAGAACACTTTGAAATGCACTTTCCGCTCGCTGCAGGTCAGCAGGCTTCCCAGCAACAGTGACGTCCCCTCTGCTCCCACAATGTCCATGACCGTTGTCATGAAGG
  3   1   2       bld Brn3      in                          CAAK537.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCAGACTGGCTGGGCTACCTGAGGTTCCTCATCATCCCACTAGGATCTCACCCGGTTGCCAAGTATCTGGGATCAGTAGATTACAAGTACAACAACCTCTTTCAGGATCCAGCATGGAGGGATCTCTTCTCTAAACTGGATGCACAAACAGCGGTGCAAGACCCTCCAGATGTGGCGTCCCGCGTCACGCAGTATATCTCCGGAGCCAACTGTGCCCACCAGCTGCCCATTGCAGAGGCCATGCTCACTTACAAGCAGAAAAGCCCTGACGAAGACTCCTCACAGAAGTTCATACCTTTTGTTGGGGTGGTAAAAGTTGGTATTGTTGAGCAGTCCTCAGCAACCTCAGGGGATTCAGACGATGCTGCGCCGTCAGGTTCCACTGTACTCTCATCCACTCCGCCCTCCATTTCTCCCGCTGTGAAAGAAGCATCTCCCACTCCCCCCTCCTCTCCATCTGTTACGTCTGGGTTCTCCTCTTCGCCAAGCCAAAGCCCAGGAGGGGAACTCATGGGGCTCCAACTGGATTACTGGATTGCCGCCCCTTTCGCAGAGAAGAAGAAAGACTTGGAGAAGAAGGACTCCACCTCCGCCAAGAACACTTTGAAATGCACTTTCCGCTCGCTGCAGGTCAGCAGGCTTCCCAGCAACAGTGACGTCCCCTCTGCTCCCACAATGTCCATGACCGTTGTCATGAAGG
  3   1   2       bld Brn3 5g3  in                        CAAK10798.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGCTCACTTACAAGCAGAAAAGCCCTGACGAAGACTCCTCACAGAAGTTCATACCTTTTGTTGGGGTGGTAAAAGTTGGTATTGTTGAGCAGTCCTCAGCAACCTCAGGGGATTCAGACGATGCTGCGCCGTCAGGTTCCACTGTACTCTCATCCACTCCGCCCTCCATTTCTCCCGCTGTGAAAGAAGCATCTCCCACTCCCCCCTCCTCTCCATCTGTTACGTCTGGGTTCTCCTCTTCGCCAAGCCAAAGCCCAGGAGGGGAACTCATGGGGCTCCAACTGGATTACTGGATTGCCGCCCCTTTCGCAGAGAAGAAGAAAGACTTGGAGAAGAAGGACTCCACCTCCGCCAAGAACACTTTGAAATGCACTTTCCGCTCGCTGCAGGTCAGCAGGCTTCCCAGCAACAGTGACGTCCCCTCTGCTCCCACAATGTCCATGACCGTTGTCATGAAGGAAAAAAACAAAAAAGTCATGTTTTTGCCGAAGAAGACAAAGGATAAAGAAGTGGAATCTAAGAGCCAATGTATCGAAGGCATCAGTAGACTCATTTGCACTGCAAAACACCAACAGAACATGCTCAGAGTGCTGATCGATGGAGTGGAATGGAACGACGTCAAGTTTTTCCAGTTGGCTGCACAGTGGTCCTCTCACGTCAAGCACTTTCCCATATGTATATTCGGACACTCTAAAGCCAACTTCTAGCCTTTTTACCAGGCGGATCCCTCTGACCCGACACTCCTCCCCCTCCCCCCCGCAGGCTGGATGTACGGATACCATACACTAATGAGTGCCAACTACTCTCTCCGAATTAAAACCATCCAGCTACG
  5   1   2       bld AbdN                               IMAGE:7020824                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCACTTACAAGCAGAAAAGCCCTGACGAAGACTCCTCACAGAAGTTCATACCTTTTGTTGGGGTGGTAAAAGTTGGTATTGTTGAGCAGTCCTCAGCAACCTCAGGGGATTCAGACGATGCTGCGCCGTCAGGTTCCACTGTACTCTCATCCACTCCGCCCTCCATTTCTCCCGCTGTGAAAGAAGCATCTCCCACTCCCCCCTCCTCTCCATCTGTTACGTCTGGGTTCTCCTCTTCGCCAAGCCAAAGCCCAGGAGGGGAACTCATGGGGCTCCAACTGGATTACTGGATTGCCGCCCCTTTCGCAGAGAAGAAGAAAGACTTGGAGAAGAAGGACTCCACCTCCGCCAAGAACACTTTGAAATGCACTTTCCGCTCGCTGCAGGTCAGCAGGCTTCCCAGCAACAGTGACGTCCCCTCTGCTCCCACAATGTCCATGACCGTTGTCATGAAGGAAAAAAACAAAAAAGTCATGTTTTTGCCGAAGAAGACAAAGGATAAAGAAGTGGAATCTAAGAGCCAATGTATCGAAGGCATCAGTAGACTCATTTGCACTGCAAAACACCAACAGAACATGCTCAGAGTGCTGATCGATGGAGTGGAATGGAACGACGTCNAGTTTTTCCAGTTGGCTGCACAGTGGTCCTCTCACGTCAAGCACTTTTCCATATGTATATTCGGACACTCTAAAGGCAACTTCTAGCCTTTTTACCAGGCGGATCCCTCTGACCCGANAANNTCTCCCCCTCCCCCCCGCAGGGCTGGATGTACGGGATACCATACACCTAATGAGTGCCCACCTACTCTCCTCCGAATTAAACCCATCCCAGCTACGAACTTCCTTTTCAATTTAATAATTAATTTTTTTTTTTTTTACAAATGGGTA
  3   1   2       bld Te5       in                        CAAO10582.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTGTGAAAGAAGCATCTCCCACTCCCCCCTCCTCTCCATCTGTTACGTCTGGGTTCTCCTCTTCGCCAAGCCAAAGCCCAGGAGGGGAACTCATGGGGCTCCAACTGGATTACTGGATTGCCGCCCCTTTCGCAGAGAAGAAGAAAGACTTGGAGAAGAAGGACTCCACCTCCGCCAAGAACACTTTGAAATGCACTTTCCGCTCGCTGCAGGTCAGCAGGCTTCCCAGCAACAGTGACGTCCCCTCTGCTCCCACAATGTCCATGACCGTTGTCATGAAGGAAAAAAACAAAAAAGTCATGTTTTTGCCGAAGAAGACAAAGGATAAAGAAGTGGAATCTAAGAGCCAATGTATCGAAGGCATCAGTAGACTCATTTGCACTGCAAAACACCAACAGAACATGCTCAGAGTGCTGATCGATGGAGTGGAATGGAACGACGTCAAGTTTTTCCAGTTGGCTGCACAGTGGTCCTCTCACGTCAAGCACTTTCCCATATGTATATTCGGACACTCTAAAGCCAACTTCTAGCCTTTTTACCAGGCGGATCCCTCTGACCCGACACTCCTCCCCCTCCCCCCCGCAGGCTGGATGTACGGATACCATACACTAATGAGTGCCAACTACTCTCTCCGAATTAAAACCATCCAGCTACG
  3   1   2       bld Egg       in                    TEgg059i07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACTCCCCCCTCCTCTCCATCTGGTTANGTTGGGTTCTCCTCTTCGCCAAGCCAAAGCCCAGGAGGGGAACTCATGGGGCTCCAACTGGATTACTGGATTGCCGCCCCTTTCGCAGAGAAGAAGAAAGACTTGGAGAAGAAGGACTCCACCTCCGCCAAGAACACTTTGAAATGCACTTTCCGCTCGCTGCAGGTCAGCAGGCTTCCCAGCAACAGTGACGTCCCCTCTGCTCCCACAATGTCCATGACCGTTGTCATGAAGGAAAAAAACAAAAAAGTCATGTTTTGCCGAAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Brn3      in                        CAAK13013.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCGCCAAGCCAAAGCCCAGGAGGGGAACTCATGGGGCTCCAACTGGATTACTGGATTGCCGCCCCTTTCGCAGAGAAGAAGAAAGACTTGGAGAAGAAGGACTCCACCTCCGCCAAGAACACTTTGAAATGCACTTTCCGCTCGCTGCAGGTCAGCAGGCTTCCCAGCAACAGTGACGTCCCCTCTGCTCCCACAATGTCCATGACCGTTGTCATGAAGGAAAAAAACAAAAAAGTCATGTTTTTGCCGAAGAAGACAAAGGATAAAGAAGTGGAATCTAAGAGCCAATGTATCGAAGGCATCAGTAGACTCATTTGCACTGCAAAACACCAACAGAACATGCTCAGAGTGCTGATCGATGGAGTGGAATGGAACGACGTCAAGTTTTTCCAGTTGGCTGCACAGTGGTCCTCTCACGTCAAGCACTTTCCCATATGTATATTCGGACACTCTAAAGCCAACTTCTAGCCTTTTTACCAGGCGGATCCCTCTGACCCGACACTCCTCCCCCTCCCCCCCGCAGGCTGGATGTACGGATACCATACACTAATGAGTGCCAACTACTCTCTCCGAATTAAAACCATCCAGCTACGACTTCCTTTCACTTTATTATTATTTTTTTTTTTTACTATTGTTTTTATTATTGTGCAGATTATTTAAAGCTATGCTTGAAGTTACCTTTTTATATTAATTTTTAATTTTACTACCAAGGGAGGTTAAAACTTTAAAAAAAAAAAGGAACAAAAATAAAAAAACAAAAAT
  5  -1   2       bld Ski1      in                        CABJ11195.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCGCCAAGCCAAAGCCCAGGAGGGGAACTCATGGGGCTCCAACTGGATTACTGGATTGCCGCCCCTTTCGCAGAGAAGAAGAAAGACTTGGAGAAGAAGGACTCCACCTCCGCCAAGAACACTTTGAAATGCACTTTCCGCTCGCTGCAGGTCAGCAGGCTTCCCAGCAACAGTGACGTCCCCTCTGCTCCCACAATGTCCATGACCGTTGTCATGAAGGAAAAAAACAAAAAAGTCATGTTTTTGCCGAAGAAGACAAAGGATAAAGAAGTGGAATCTAAGAGCCAATGTATCGAAGGCATCAGTAGACTCATTTGCACTGCAAAACACCAACAGAACATGCTCAGAGTGCTGATCGATGGAGTGGAATGGAACGACGTCAAGTTTTTCCAGTTGGCTGCACAGTGGTCCTCTCACGTCAAGCACTTTCCCATATGTATATTCGGACACTCTAAAGCCAACTTCTAGCCTTTTTACCAGGCGGATCCCTCTGACCCGACACTCCTCCCCCTCCCCCCCGCAGGCTGGATGTACGGATACCATACACTAATGAGTGCCAACTACTCTCTCCGAATTAAAACCATCCAGCTACGACTTCCTTTCACTTTATTATTATTTTTTTTTTTTTACTATTGTTTTTATTATTGTGCAGATTATTTAAAGCTATGCTTGAAGTTACCTTTTTATATTAATTTTTAATTTTACTACCAAGGGAGGTTAAAACTTTAAAAAAAAAAAAGGAACAAAAATAAAAAAAC
  3   1   2       bld Brn4      in                         CAAL6213.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCCAAGCCAAAGCCCAGGAGGGGAACTCATGGGGCTCCAACTGGATTACTGGATTGCCGCCCCTTTCGCAGAGAAGAAGAAAGACTTGGAGAAGAAGGACTCCACCTCCGCCAAGAACACTTTGAAATGCACTTTCCGCTCGCTGCAGGTCAGCAGGCTTCCCAGCAACAGTGACGTCCCCTTTGCTCCCACAATGTCCATGACCGTTGTCATGAAGGAAAAAAACAAAAAAGTCATGTTTTTGCCGAAGAAGACAAAGGATAAAGAAGTGGAATTTAAGAGCCAATGTATCGAAGGCATCAGTAGACTCATTTGCACTGCAAAACACCAACAGAACATGCTCAGAGTGCTGATCGATGGAGTGGAATGGAACGACGTCAAGTTTTTCCAGTTGGCTGCACAGTGGTCCTCTCACGTCAAGCACTTTCCCATATGTATATTCGGACACTCTAAAGCCAACTTTTAGCCTTTTTACCAGGGGGATCCCTTTGACCCGACACTCCTCCCCCTCCCCCCCGCAAGCTGGATGTACGGATACCATACACTAATGAGTGCCAACTACTCTCTCCGAATTAAAACCATCCAGCTACGACTTCCTTTCACTTTATTATTATTTTTTTTTTTTACTATTGTTTTTATTATTGTGCAGATTATTTAAAGCTATGCTTGAAGTTACCTTTTTATATTAATTTTTAATTTTACTACCAAGGGAGGTTAAAACTTT
  3   1   2       bld Neu0 5g3  in                     NISC_ng15a03.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCAACTGGATTACTGGATTGCCGCCCCTTTCGCAGAGAAGAAGAAAGACTTGGAGAAGAAGGACTCCACCTCCGCCAAGAACACTTTGAAATGCACTTTCCGCTCGCTGCAGGTCAGCAGGCTTCCCAGCAACAGTGACGTCCCCTCTGCTCCCACAATGTCCATGACCGTTGTCATGAAGGAAAAAAAACAAAAAAGTCATGTTTTTGCCGAAGAAGACAAAGGATAAAGAAGTGGAATCTAAGAGCCAATGTATCGAAGGCATCAGTAGACTCATTTGCACTGCAAAACACCAACAGAACATGCTCAGAGTGCTGATCGATGGAGTGGAATGGAACGACGTCAAGTTTTTCCAGTTGGCTGCACAGTGGTCCTCTCACGTCAAGCACTTTCCCATATGTATATTCGGACACTCTAAAGCCAACTTCTAGCCTTTTTACCAGGCGGATCCCTCTGACCCGACACTCCTCCCCCTCCCCCCCGCAGGCTGGATGTACGGATACCATACACTAATGAGTGCCAACTACTCTCTCCGAATTAAAACCATCCAGCTACGAAAAAAAAAAAAAAAG
  3   1   2       bld Tad5      out                        XZT33107.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTGCCGCCCCTTTCGCAGAGAAGAAGAAAGACTTGGAGAAGAAGGACTCCACCTCCGCCAAGAACACTTTGAAATGCACTTTCCGCTCGCTGCAGGTCAGCAGGCTTCCCAGCAACAGTGAGGTCCCCTTTGCTCCCACAATGTCCATGACCGTTGTCTTGAAGGAAAAAAACAAAAAAGTCATGTTTTTGCCGAAGAAGACAAAGGATAAAGAAGTGGAATTTAAGAGCCAATGTATGGAAGGCATCAGTAGACTCATTTGCACTGCAAAACACCAACAGAACATGCTCAGAGTGTTGATCGATGGAGTGGAATGGAACGACGTCAAGTTTTTCCAGTTGGGTGCACAGGGGTCCTTTCACGTCAAGCACTTTCCCATATGTATATTTGGACACTTTAAAGCCAACTTTTAGCCTTTTTACCAGGGGGATCCTTTTGACCGGACACTCCTCCCCCTCCCCCCCGCAGGGGGGATGTACGGATACCATACACTAATGGGTGCCAACTACTCTTTCCGAATTAAAACCATCCAGGTAGGACTTCCTTTCACTTTATTATTATTTTTTTTTTTTACTATTGTTTTTATTATTGGGCAGATTATTTAAAGCTATGCTTGAAGTTACCTTTTTATATTAATTTTTAATTTTACTACCAAGGGGGGTTAAACCTTT
  3   1   2       bld Bone 5g3  in                       CBTC11808.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTTCGCAGAGAAGAAGAAAGACTTGGAGAAGAAGGACTCCACCTCCGCCAAGAACACTTTGAAATGCACTTTCCGCTCGCTGCAGGTCAGCAGGCTTCCCAGCAACAGTGACGTCCCCTCTGCTCCCACAATGTCCATGACCGTTGTCATGAAGGAAAAAAACAAAAAAGTCATGTTTTTGCCGAAGAAGACAAAGGATAAAGAAGTGGAATCTAAGAGCCAATGTATCGAAGGCATCAGTAGACTCATTTGCACTGCAAAACACCAACAGAACATGCTCAGAGTGCTGATCGATGGAGTGGAATGGAACGACGTCAAGTTTTTCCAGTTGGCTGCACAGTGGTCCTCTCACGTCAAGCACTTTCCCATATGTATATTCGGACACTCTAAAGCCAACTTCTAGCCTTTTTACCAGGCGGATCCCTTTGACCCGACACTCCTCCCCCTCCCCCCCGCAGGCTGGATGTACGGATACCATACACTAATGAGTGCCAACTACTCTCTCCGAATTAAAACCATCCAGCTACGACTTCCTTTCACTTTATTATTATTTTTTTTTTTTACTATTGTTTTTATTATTGTGCAGATTATTTAAAGCTATGCTTGAAGTTACCTTTTTATATTAATTTTTAATTTTACTACCAAGGGAGGTTAAAACTTT
  3   1   2       bld Brn4      in                        CAAL22258.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGACTTGGAGAAGAAGGACTCCCCCTCCGCCAAGAACACTTTGAAATGCACTTTCCGCTCGCTGCAGGTCAACAGGCTTCCCAGCAACAGGGAAGTCCCCTTTGTTCCCCCAATGTCCATGACCGTTGTCTTGAAGGAAAAAAACAAAAAAGTCATGTTTTTTCCGAAGAAGCCAAAGGATAAAGAAGTGGAATTTTAGAGCCAATGTTTCGAAGGCATCAGTAGACTCTTTTGCCCTGCAAAACCCCAACAGAACATGCTCAGAGTGCTGATCGATGGAGTGGAATGGAACGACGTCAAGTTTTTCCAGTTGGGTGCACAGGGGTCCTTTCACGTCAAGCACTTTCCCATATGTATATTTGGACACTTTAAAACCAACTTTTAGCCTTTTTTCCAGGGGGATCCTTTTGACCCGACACTCCTCCCCCTCCCCCCCGCAAGCGGGATGTACGGATTCCATCCCCTAATGGGGGCCAACTACTCTTTCCGAATTAAAACCATCCAGGTACGACTTCCTTTCACTTTATTATTATTTTTTTTTTTTACTATTGTTTTTATTATTGGGCAGATTATTTAAAGCTATGCTTGAAGTTCCCTTTTTATATTAATTTTTAATTTTCCCCCCAAGGGGGGTTAAAACTTTT
  3   1   2       bld Te4  PIPE in                        CAAN10030.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCAAGAACACTTTGAAATGCACTTTCCGCTCGCTGCAGGTCAGCAGGCTTCCCAGCAACAGTGACGTCCCCTCTGCTCCCACAATGTCCATGACCGTTGTCATGAAGGAAAAAAACAAAAAAGTCATGTTTTTGCCGAAGAAGACAAAGGATAAAGAAGTGGAATCTAAGAGCCAATGTATCGAAGGCATCAGTAGACTCATTTGCACTGCAAAACACCAACAGAACATGCTCAGAGTGCTGATCGATGGAGTGGAATGGAACGACGTCAAGTTTTTCCAGTTGGCTGCACAGTGGTCCTCTCACGTCAAGCACTTTCCCATATGTATATTCGGACACTCTAAAGCCAACTTCTAGCCTTTTTACCAGGGGGATCCCTTTGACCCGACACTCCTCCCCCTCCCCCCCGCAGGCTGGATGTACGGATACCATACACTAATGAGTGCCAACTACTCTCTCCGAATTAAAACCATCCAGCTACGACTTCCTTTCACTTTATTATTATTTTTTTTTTTTACTATTGTTTTTATTATTGGGCAGATTATTTAAAGCTATGCTTGAAGTTACCTTTTTATATTAATTTTTAATTTTACTACCAAGGGGGGTTAAAACTTTAAAAAAAAAAAGGAACAAAAATAAAAAAACAAAAAT
  5   1   2       bld TpA  5x3  out                  TTpA050n08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAAAGAAGTGGAATCTAAGAGCCAATGTATCGAAGGCATCAGTAGACTCATTTGCACTGCAAAACACCAACAGAACATGCTCAGAGTGCTGATCGATGGAGTGGAATGGAACGACGTCAAGTTTTTCCAGTTGGCTGCACAGTGGTCCTCTCACGTCAAGCACTTTCCCATATGTATATTCGGACACTCTAAAGCCAACTTCTAGCCTTTTTACCAGGCGGATCCCTCTGACCCGACACTCCTCCCCCTCCCCCCCGCAGGCTGGATGTACGGATACCATACACTAATGAGTGCCAACTACTCTCTCCGAATTAAAACCATCCAGCTACGACTTCCTTTCACTTTATTATTATTTTTTTTTTTACTATTGTTTTTATTATTGTGCAGATTATTTAAAGCTATGCTTGAAGTTACCTTTTTATATTAATTTTTAATTTTACTACCAAGGGAGGTTAAAACTTTAAAAAAAAAAAGGAACAAAAATAAAAAAACAAAAATAAAAAAAGTCTTAAGTACAACTGTTAACACACGACAGTAACTTTGGTACTCTAACGATTGGGTGAATAACTGCACTGCTTAATAACGTGTTACATGTTGTGGGGTGAATACCCGTTCTGATTGGTGTTTTGCTCTATTGGACGGGCCTGACGTAGGCAGAGAGAACTAAACTGCTACTTACAGTGAATGGTGTTTGCACTTTGCTCTGACTTTCTTGCCATCACGTTCTTCTTGGTTTGTCTGTTACATTGATCGTCAAGGGACGCAGCCTCGTTTCATAGAACACTAGCAGCTTGGTATGGAAGGGTGGGCTTGTATAGCTAGTGGCTTGGTA
  5   1   2       bld Ski1      in                         CABJ9241.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGCAAAACACCAACAGAACATGCTCAGAGTGCTGATCGATGGAGTGGAATGGAACGACGTCAAGTTTTTCCAGTTGGCTGCACAGTGGTCCTCTCACGTCAAGCACTTTCCCATATGTATATTCGGACACTCTAAAGCCAACTTCTAGCCTTTTTACCAGGCGGATCCCTCTGACCCGACACTCCTCCCCCTCCCCCCCGCAGGCTGGATGTACGGATACCATACACTAATGAGTGCCAACTACTCTCTCCGAATTAAAACCATCCAGCTACGACTTCCTTTCACTTTATTATTATTTTTTTTTTTTACTATTGTTTTTATTATTGTGCAGATTATTTAAAGCTATGCTTGAAGTTACCTTTTTATATTAATTTTTAATTTTACTACCAAGGGAGGTTAAAACTTTAAAAAAAAAAAGGAACAAAAATAAAAAAACAAAAATAAAAAAAGTCTTAAGTACAACTGTTAACACACGACAGTAACTTTGGTACTCTAACGATTGGGTGAATAACTGCACTGCTTAATAACGTGTTACATGTTGTGGGGTGAATACCCGTTCTGATTGGTGTTTTGCTCTATTGGACGGGCCTGACGTAGGCAGAGAGAACTAAACTGCTACTTACAGTGAATGGTGTTTGCACTTTGCTCTGACTTTCTTGCCATCACGTTCTTCTTGGTTTGTCTGTTACATTGATCGTCAAGGGACGCAGCCTCGTTTCATAGAACACTAGCAGCTTGGTATGGAAGGGTGGGCTTGTATAGCTAGTGGCTTGGTAAGTTTCCTTGGCTTGGCTTTGTAGATAGGTTTCTGCCCTACTCACTGATCTTAATATGACCAGCAAATCCTTAAATGCTTTATTTATATGGGCCCATTAGGGGAGGAGTTACAGTAAGAATCATGAATGTCTA
  3  -1   2       bld Thy1                                CBST9182.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGCACAGTTGGTCCTCTCACGTCAAGCACTTTCCCATATGTATATTCGGACACTCTAAAGCCAACTTCTAGCCTTTTTACCAGGCGGATCCCTCTGACCCGACACTCCTCGCCCTCCCCCCCGCAGGCTGGATGTACGGATACCATACACTAATGAGTGCCAACTACTCTCTCCGAATTAAAACCATCCAGCTACGGNNAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Eye       in                         CCAX3516.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTTTTTTACTATTGTTTTTATTATTGTGCAGATTATTTAAAGCTATGCTTGAAGTTACCTTTTTATATTAATTTTTAATTTTACTACCAAGGGAGGTTAAAACTTTAAAAAAAAAAAAGGAACAAAAATAAAAAAACAAAAATAAAAAAAGTCTTAAGTACAACTGTTAACACACGACAGTAACTTTGGTACTCTAACGATTGGGTGAATAACTGCACTGCTTAATAACGTGTTACATGTTGTGGGGTGAATACCCGTTCTGATTGGTGGTTTGCTCTATTGGACGGGCCTGACGTAGGCAGAGAGAACTAAACTGCTACTTACAGTGAATGGTGTTTGCACTTTGCTCTGACTTTCTTGCCATCACGTTCTTCTTGGTTTGTCTGTTACATTGATCGTCAAGGGACGCAGCCTCGTTTCATAGAACACTAGCAGCTTGGTATGGAAGGGTGGGCTTGTATAGCTAGTGGCTTGGTAAGTTTCCTTGGCTTGGCTTTGTAGATAGGTTTCTGCCCTACTCACTGATCTTAAAATGACCAGCAAATCCTTAAATGCTTTATTTATATGGGCCCATTAGGGGAGGAGTTACAGTAAGAATCATGAATGTCTACGAGACCCAGTGGATGCTGTCTCTAGTAACGGCTGCCCCTGGAATAAAAGACTACTTTAACAGGACTATATCTGGTAGTTTTAGATTTGTAG
  5   1   2       bld In63                            IMAGE:8960157.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGTTTTTATTTTTGACGATAAAAAAATTATTAAATCGCCCCTTTTTATATTAATTTTTAATTTTACTACCAAGGGAGGTTAAAACTTTAAAAAAAAAAAGGAACAAAAATAAAAAAACAAAAATAAAAAAAGTCTTAAGTACAACTGTTAACACACGACAGTAACTTTGGTACTCTAACGATTGGGTGAATAACTGCACTGCTTAATAACGTGTTACATGTTGTGGGGTGAATACCCGTTCTGATTGGTGTTTTGCTCTATTGGACGGGCCTGACGTAGGCAGAGAGAACTAAACTGCTACTTACAGTGAATGGTGTTTGCACTTTGCTCTGACTTTCTTGCCATCACGTTCTTCTTGGTTTGTCTGTTACATTGATCGTCAAGGGACGCAGCCTCGTTTCATAGAACACTAGCAGCTTGGTATGGAAGGGTGGGCTTGTATAGCTAGTGGCTTGGTAAGTTTCCTTGGCTTGGCTTTGTAGATAGGTTTCTGCCCTACTCACTGATCTTAATATGACCAGCAAATCCTTAAATGCTTTATTTATATGGGCCCATTAGGGGAGGAGTTACAGTAAGAATCATGAATGTCTACGAGACCCAGTGGATGCTGTCTCTAGTAACGGCTGCCCCTGGAATAAAAGACTACTTTTAACAGGACTATTATTCTGGTAGTTTTTAGATTTGTAGAGGTTAATTTGGAGGCGAGAACTCACTCACCGTCTTCCCCCACCTTCTCTCTGATTTGCTGCTGCCTCCATTGAGATGATATAAAGCTATCCCTGCACCCTCTTGTACATACTGGGCTGCAGACCCAGCATGTGTCTGTGGAGCCCCAGTATGGGTGACAGCTGGAGATGCATGCTCTCAGCTGTGGTCATGCTTCTGGTATGACTTAGCCACATGGCAGG
  5   1   2       bld Tad5      in                         XZT66619.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTGAAGTTACCCTTTTTATATTAATTTTTAATTTTACTACCAAGGGAGGTTAAAACTTTAAAAAAAAAAAGGAACAAAAATAAAAAAACAAAAATAAAAAAAGTCTTAAGTACAACTGTTAACACACGACAGTAACTTTGGTACTCTAACGATTGGGTGAATAACTGCACTGCTTAATAACGTGTTACATGTTGTGGGGTGAATACCCGTTCTGATTGGTGTTTTGCTCTATTGGACGGGCCTGACGTAGGCAGAGAGAACTAAACTGCTACTTACAGTGAATGGTGTTTGCACTTTGCTCTGACTTTCTTGCCATCACGTTCTTCTTGGTTTGTCTGTTACATTGATCGTCAAGGGACGCAGCCTCGTTTCATAGAACACTAGCAGCTTGGTATGGAAGGGTGGGCTTGTATAGCTAGTGGCTTGGTAAGTTTCCTTGGCTTGGCTTTGTAGATAGGTTTCTGCCCTACTCACTGATCTTAATATGACCAGCAAATCCTTAAATGCTTTATTTATATGGGCCCATTAGGGGAGGAGTTACAGTAAGAATCATGAATGTCTACGAGACCCAGTGGATGCTGTCTCTAGTAACGGCTGCCCCTGGAATAAAAGACTACTTTTAACAGGACTATTATTCTGGTAGTTTTTAGATTTGTAGAGGTTAATTTGGAGGCGAGAAACTCACTCACCGTCTTCCCCCACCTTCTCTCTGATTTGCTGCTGCCTCCATTGAGATGATATAAAGCTATCCCTGCACCCTCTTGTACATACTTGGGCTGCAGAACCCAGCAGTGTGTCTGTGGGAGCCCCCAGTAGTGGGGTGGACCAGCTTGNGGAAGATGCAGTGCTTCTC
  5   1   2       bld Eye       in                         CCAX6748.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAACTTTAAAAAAAAAAAAGGAACAAAAATAAAAAAACAAAAATAAAAAAAGTCTTAAGTACAACTGTTAACACACGACAGTAACTTTGGTACTCTAACGATTGGGTGAATAACTGCACTGCTTAATAACGTGTTACATGTTGTGGGGTGAATACCCGTTCTGATTGGTGTTTTGCTCTATTGGACGGGCCTGACGTAGGCAGAGAGAACTAAACTGCTACTTACAGTGAATGGTGTTTGCACTTTGCTCTGACTTTCTTGCCATCACGTTCTTCTTGGTTTGTCTGTTACATTGATCGTCAAGGGACGCAGCCTCGTTTCATAGAACACTAGCAGCTTGGTATGGAAGGGTGGGCTTGTATAGCTAGTGGCTTGGTAAGTTTCCTTGGCTTGGCTTTGTAGATAGGTTTCTGCCCTACTCACTGATCTTAAAATGACCAGCAAATCCTTAAATGCTTTATTTATATGGGCCCATTAGGGGAGGAGTTACAGTAAGAATCATGAATGTCTACGAGACCCAGTGGATGCTGTCTCTAGTAACGGCTGCCCCTGGAATAAAAGACTACTTTTAACAGGACTATTATTCTGGTAGTTTTTAGATTTGTAGAGGTTAATTTGGAGGCGAGAAACTCACCGTTTTCCCCCACCTTCTCTCTGATTTGCTGCTGCCTCCATTGAGATGATATAAAGCTATCCCTGCACCCTCTTGTACATACTTGGGCTGCAGAACCCAGCAGTGTGT
  5   1   2       bld Limb      in                         CBSU573.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAAAATAAAAAAACAAAAATAAAAAAAGTCTTAAGTACAACTGTTAACACACGACAGTAACTTTGGTACTCTAACGATTGGGTGAATAACTGCACTGCTTAATAACGTGTTACATGTTGTGGGGTGAATACCCGTTCTGATTGGTGTTTTGCTCTATTGGACGGGCCTGACGTAGGCAGAGAGAACTAAACTGCTACTTACAGTGAATGGTGTTTGCACTTTGCTCTGACTTTCTTGCCATCACGTTCTTCTTGGTTTGTCTGTTACATTGATCGTCAAGGGACGCAGCCTCGTTTCATAGAACACTAGCAGCTTGGTATGGAAGGGTGGGCTTGTATAGCTAGTGGCTTGGTAAGTTTCCTTGGCTTGGCTTTGTAGATAGGTTTCTGCCCTACTCACTGATCTTAATATGACCAGCAAATCCTTAAATGCTTTATTTATATGGGCCCATTAGGGGAGGTGTTACAATAAGAATCATGAATGTCTACGAGACCCAGTGGATGCTGTCTCTAGTAACGGCTGCCCCTGGAATAAAAGACTACTTTTAACAGGACTATTATTCTGGTAGTTTTTAGATTTGTAGAGGTTAATTTGGAGGCGAGAAACTCACTCACCGTCTTCCCCCACCTTCTCTCTGATTTGCTGCTGCCTCCATTGAGATGATATAAAGCTATCCCTGCACCCTCTTGTACATACTTGGGCTGCAA
  5   1   2       bld Tad5      in                         XZT54942.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAAAAAAACAAAAATAAAAAAAGTCTTAAGTACAACTGTTAACACACGACAGTAACTTTGGTACTCTAACGATTGGGTGAATAACTGCACTGCTTAATAACGTGTTACATGTTGTGGGGTGAATACCCGTTCTGATTGGTGTTTTGCTCTATTGGACGGGCCTGACGTAGGCAGAGAGAACTAAACTGCTACTTACAGTGAATGGTGTTTGCACTTTGCTCTGACTTTCTTGCCATCACGTTCTTCTTGGTTTGTCTGTTACATTGATCGTCAAGGGACGCAGCCTCGTTTCATAGAACACTAGCAGCTTGGTATGGAAGGGTGGGCTTGTATAGCTAGTGGCTTGGTAAGTTTCCTTGGCTTGGCTTTGTAGATAGGTTTCTGCCCTACTCACTGATCTTAATATGACCAGCAAATCCTTAAATGCTTTATTTATATGGGCCCATTAGGGGAGGAGTTACAGTAAGAATCATGAATGTCTACGAGACCCAGTGGATGCTGTCTCTAGTAACGGCTGCCCCTGGAATAAAAGACTACTTTTAACAGGACTATTATTCTGGTAGTTTTTAGATTTGTAGAGGTTAATTTGGAGGCGAGAAACTCACTCACCGTCTTCCCCCACCTTCTCTCTGATTTGCTGCTGCCTCCATTGAGATGATATAAAGCTATCCCTGCACCCTCTTGTACATACTTGGGCTGCAGAACCCAGCAGTGTGTCTGTGGGAGCCCCCAGTAGTGNGGTGGACCAGCTTGNGGAAGATGCAGTGCTTCTCAGCTTGTGGGTCAGTGCTTCTGTGTATGAGCTTTAAGGCCACATTGGCAGGGTTTTGTCTA
  5   1   2       bld Brn4                                CAAL22392.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAAAAACAAAAATAAAAAAAGTCTTAAGTACAACTGTTAACACACGACAGTAACTTTGGTACTCTAACGATTGGGTGAATAACTGCACTGCTTAATAACGTGTTACATGTTGTGGGGTGAATACCCGTTCTGATTGGTGTTTTGCTCTATTGGACGGGCCTGACGTAGGCAGAGAGAACTAAACTGCTACTTACAGTGAATGGTGTTTGCACTTTGCTCTGACTTTCTTGCCATCACGTTCTTCTTGGTTTGTCTGTTACATTGATCGTCAAGGGACGCAGCCTCGTTTCATAGAACACTAGCAGCTTGGTATGGAAGGGTGGGCTTGTATAGCTAGTGGCTTGGTAAGTTTCCTTGGCTTGGCTTTGTAGATAGGTTTCTGCCCTACTCACTGATCTTAATATGACCAGCAAATCCTTAAATGCTTTATTTATATGGGCCCATTAGGGGAGGAGTTACAGTAAGAATCATGAATGTCTACGAGACCCAGTGGATGCTGTCTCTAGTAACGGCTGCCCCTGGAATAAAAGACTACTTTTAACAGGACTATTATTCTGGTAGTTTTTAGATTTGTAGAGGTTAATTTGGAGGCGAGAAACTCACTCACCGTCTTCCCCCACCTTCTCTCTGATTTGCTGCTGCCTCCATTGAGATGATATAAAGCTATCCCTGCACCCTCTTGTACATACTTGGGCTGCAGAACCCAGCAGTGTGTCTGTGGGAGCCCCCAGTAGTGGGGTGGACCAGCTTGGGGAAGATGCAGTGCTTCTCAGC
  5   1   2       bld Gas7                                 XZG13485.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACGACAGTAACTTTGGTACTCTAACGATTGGGTGAATAACTGCACTGCTTAATAACGTGTTACATGTTGTGGGGTGAATACCCGTTCTGATTGGTGTTTTGCTCTATTGGACGGGCCTGACGTAGGCAGAGAGAACTAAACTGCTACTTACAGTGAATGGTGTTTGCACTTTGCTCTGACTTTCTTGCCATCACGTTCTTCTTGGTTTGTCTGTTACATTGATCGTCAAGGGACGCAGCCTCGTTTCATAGAACACTAGCAGCTTGGTATGGAAGGGTGGGCTTGTATAGCTAGTGGCTTGGTAAGTTTCCTTGGCTTGGCTTTGTAGATAGGTTTCTGCCCTACTCACTGATCTTAATATGACCAGCAAATCCTTAAATGCTTTATTTATATGGGCCCATTAGGGGAGGAGTTACAGTAAGAATCATGAATGTCTACGAGACCCAGTGGATGCTGTCTCTAGTAACGGCTGCCCCTGGAATAAAAGACTACTTTTAACAGGACTATTATTCTGGTAGTTTTTAGATTTGTAGAGGTTAATTTGGAGGCGAGAAACTCACTCACCGTCTTCCCCCACCTTCTCTCTGATTTGCTGCTGCCTCCATTGAGATGATATAAAGCTATCCCTGCACCCTCTTGTACATACTTGGGCTGCAGAACCCAGCAGTGTGTCTGTGGGAGCCCCCAGTAGTGGGGTGGACCAGCT
  5   1   2       bld In54                            IMAGE:8945063.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGTGGTTAATTAAACGAGCACAAACGATTCGAATTCGTCCCGAATACCCGTTCTGATTGGTGTTTTGCTCTATTGGACGGGCCTGACGTAGGCAGAGAGAACTAAACTGCTACTTACAGTGAATGGTGTTTGCACTTTGCTCTGACTTTCTTGCCATCACGTTCTTCTTGGTTTGTCTGTTACATTGATCGTCAAGGGACGCAGCCTCGTTTCATAGAACACTAGCAGCTTGGTATGGAAGGGTGGGCTTGTATAGCTAGTGGCTTGGTAAGTTTCCTTGGCTTGGCTTTGTAGATAGGTTTCTGCCCTACTCACTGATCTTAATATGACCAGCAAATCCTTAAATGCTTTATTTATATGGGCCCATTAGGGGAGGAGTTACAGTAAGAATCATGAATGTCTACGAGACCCAGTGGATGCTGTCTCTAGTAACGGCTGCCCCTGGAATAAAAGACTACTTTTAACAGGACTATTATTCTGGTAGTTTTTAGATTTGTAGAGGTTAATTTGGAGGCGAGAAACTCACTCACCGTCTTCCCCCACCTTCTCTCTGATTTGCTGCTGCCTCCATTGAGATGATATAAAGCTATCCCTGCACCCTCTTGTACATACTTGGGCTGCAGAACCCAGCAGTGTGTCTGTGGGAGCCCCCAGTTAGTGGGGTGGACCAGCTTGGGGAAGATGCAGTGCTTCTCAGCTTGTGGGGTCAGTGCTTCTGTGTATGAGCTTTAAGGCCACATTGGCACGGTTTGTCTATTTTCTTTCACAAATTATGCAAATGGAACAATATTTTGACTGGTTATAAATGTCAGCTGTGCATAATTGTCCTTGCCCTGGTGATTCTAGGTTAAAATGCAATGCCATTTGCCATCTCTCTGGGTAACGAACCGGTAACACTCATGGTTCTACAACCATGTCTAAGCCTCATCGTGGACTGAAGCTTACCATAATGACAGCATCGTCCCTGGAATCTCTCTGCATGCGCT
  5   1   2       bld Lun1      in                        CABD12528.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGATCTTAAAATGACCAGCAAATCCTTAAATGCTTTATTTATATGGGCCCATTAGGGGAGGAGTTACAGTAAGAATCATGAATGTCTACGAGACCCAGTGGATGCTGTCTCTAGTAACGGCTGCCCCTGGAATAAAAGACTACTTTTAACAGGACTATTATTCTGGTAGTTTTTAGATTTGTAGAGGTTAATTTGGAGGCGAGAAACTCACCGTTTTCCCCCACCTTCTCTCTGATTTGCTGCTGCCTCCATTGAGATGATATAAAGCTATCCCTGCACCCTCTTGTACATACTTGGGCTGCAGAACCCAGCAGTGTGTCTGTGGGAGCCCCCGGTAGTGGGGTGGACCAGCTTGGGGAAGATGCAGTGCTTCTCAGCTTGTGGGTCAGTGCTTCTGTGTATGAGCTTTAAGGCCACATTGGCAGGGTTTTGTCTATTTCTTTCACAAAATTATGCAAAATGGACAATATTTTGACTGGTTATAAATGTCAGGCTGTGCATAATGTCTTGCCCTGGTGGTTCTATGTTAATATGCAATGCATTTTTGCATCCTCTGGTACAGACAGGGTAAAACTCATGGTCTAGAAACAGGGTAAGGCTCCATCTGTGATGATGTTTACCAAATGAAAGTCATGCCTGGATCCTTCAGCGTGGTTTGTGATGTCTTGGCCGTGGCGACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTCATTTTCCTGACTGTCCAACGACTACCACCAGCACATATTTGGGTCACACTTCAGCATTTGATGGTGATCCTTTCCACTGGCACAATGGGGCATGCCCATG
  5   1   2       bld Brn4      in                         CAAL7465.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATATGACCAGCAAATCCTTAAATGCTTTATTTATATGGGCCCATTAGGGGAGGAGTTACAGTAAGAATCATGAATGTCTACGAGACCCAGTGGATGCTGTCTCTAGTAACGGCTGCCCCTGGAATAAAAGACTACTTTTAACAGGACTATTATTCTGGTAGTTTTTAGATTTGTAGAGGTTAATTTGGAGGCGAGAAACTCACTCACCGTCTTCCCCCACCTTCTCTCTGATTTGCTGCTGCCTCCATTGAGATGATATAAAGCTATCCCTGCACCCTCTTGTACATACTTGGGCTGCAGAACCCAGCAGTGTGTCTGTGGGAGCCCCCAGTAGTGGGGTGGACCAGCTTGGGGAAGATGCAGTGCTTCTCAGCTTGTGGGTCAGTGCTTCTGTGTATGAGCTTTAAGGCCACATTGGCAGGGTTTTGTCTATTTCTTTCACAAAATTATGCAAAATGGACAATATTTTGACTGGTTATAAATGTCAGGCTGTGCATAATGTCTTGCCCTGGTGGTTCTATGTTAATATGCAATGCATTTTTGCATCCTCTGGTACAGACAGGGTAAAACTCATGGTCTAGAAACAGGGTAAGGCTCCATCTGTGATGATGTTTACCAAATGAAAGTCATGCCTGGATCCTTCAGCGTGGTTTGTGATGTCTTGGCCGTGGCGACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTAATTTTCCTGACTGTCCAACGACTACCACCAGCACATATTTGGGTCACACTTCAGCATTTGATGGTGATCCTTTCCACTGGCAC
  5   1   2       bld Te3       in                         CAAM7053.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGATGCTGTCTCTAGTAACGGCTGCCCCTGGAATAAAAGACTACTTTTAACAGGACTATTATTCTGGTAGTTTTTAGATTTGTAGAGGTTAATTTGGAGGCGAGAAACTCACTCACCGTCTTCCCCCACCTTCTCTCTGATTTGCTGCTGCCTCCATTGAGATGATATAAAGCTATCCCTGCACCCTCTTGTACATACTTGGGCTGCAGAACCCAGCAGTGTGTCTGTGGGAGCCCCCAGTAGTGGGGTGGACCAGCTTGGGGAAGATGCAGTGCTTCTCAGCTTGTGGGTCAGTGCTTCTGTGTATGAGCTTTAAGGCCACATTGGCAGGGTTTTGTCTATTTCTTTCACAAAATTATGCAAAATGGACAATATTTTGACTGGTTATAAATGTCAGGCTGTGCATAATGTCTTGCCCTGGTGGTTCTATGTTAATATGCAATGCATTTTTGCATCCTCTGGTACAGACAGGGTAAAACTCATGGTCTAGAAACAGGGTAAGGCTCCATCTGTGATGATGTTTACCAAATGAAAGTCATGCCTGGATCCTTCAGCGTGGTTTGTGATGTCTTGGCCGTGGCGACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTAATTTTCCTGACTGTCCAACGACTACCACCAGCACATATTTGGGTCACACTTCAGCATTTGATGGTGATCCTTTTCACTGGCACAATGGGGCATGCCCATGTTTAAAGAACAATCAGGAACTCTATAGTGTAAATCAGGCTGTCATTGGTAGGCCCTACGCAAACTGGCTTTGGTCTTGTGCATCACTT
  5   1   2       bld Te1       in                         CBWN6852.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATCCCTGCACCCTCTTGTACATACTTGGGCTGCAGAACCCAGCAGTGTGTCTGTGGGAGCCCCCAGTAGTGGGGTGGACCAGCTTGGGGAAGATGCAGTGCTTCTCAGCTTGTGGGTCAGTGCTTCTGTGTATGAGCTTTAAGGCCACATTGGCAGGGTTTTGTCTATTTCTTTCACAAAATTATGCAAAATGGACAATATTTTGACTGGTTATAAATGTCAGGCTGTGCATAATGTCTTGCCCTGGTGGTTCTATGTTAATATGCAATGCATTTTTGCATCCTCTGGTACAGACAGGGTAAAACTCATGGTCTAGAAACAGGGTAAGGCTCCATCTGTGATGATGTTTACCAAATGAAAGTCATGCCTGGATCCTTCAGCGTGGTTTGTGATGTCTTGGCCGTGGCGACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTAATTTTCCTGACTGTCCAACGACTACCACCAGCACATATTTGGGTCACACTTCAGCATTTGATGGTGATCCTTTTCACTGGCACAATGGGGCATGCCCATGTTTAAAGAACAAATCAGGAACTCTATAGTGTAAATCAGGCTGTCATTGGTAGGCCCTACGCAAACTGGCTTTGGTCTTGTGCATCACTTGACCTAACTCTTAATATAGCACAATATT
  5   1   2       bld Tad5                                 XZT31811.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTTTTTTTTTAGTGCTTCTCAGCTTGTGGGTCAGTGCTTCTGTGTATGAGCTTTAAGGCCACATTGGCAGGGTTTTGTCTATTTCTTTCACAAAATTATGCAAAATGGACAATATTTTGACTGGTTATAAATGTCAGGCTGTGCATAATGTCTTGCCCTGGTGGTTCTATGTTAATATGCAATGCATTTTTGCATCCTCTGGTACAGACAGGGTAAAACTCATGGTCTAGAAACAGGGTAAGGCTCCATCTGTGATGATGTTTACCAAATGAAAGTCATGCCTGGATCCTTCAGCGTGGTTTGTGATGTCTTGGCCGTGGCGACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTAATTTTCCTGACTGTCCAACGACTACCACCAGCACATATTTGGGTCACACTTCAGCATTTGATGGTGATCCTTTTCACTGGCACAATGGGGCATGCCCATGTTTAAAGAACAAATCAGGAACTCTATAGTGTAAATCAGGCTGTCATTGGTAGGCCCTACGCAAACTGGCTTTGGTCTTGTGCATCACTTGACCTAACTCTTAATATAGCACAATATTCAGCAAGCGATGCGCTACCCTAGAGTGCATTCATCTCCAGTACTTCAGTGTTTATCAGGTAGACGGAAGGTTTGCTGTTTCACCATTGGATGGGACTTTGTTGTGTTGCAGTGCAATGCTCAGAGTAACCTTCAGAGGCTAAAGGCAGGTTTGTTGGTTGAGGCTT
  3   1   2       bld Lun1      in                        CABD12528.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCTTTCACAAAATTATGCAAAATGGACAATATTTTGACTGGTTATAAATGTCAGGCTGTGCATAATGTCTTGCCCTGGTGGTTCTATGTTAATATGCAATGCATTTTTGCATCCTCTGGTACAGACAGGGTAAAACTCATGGTCTAGAAACAGGGTAAGGCTCCATCTGTGATGATGTTTACCAAATGAAAGTCATGCCTGGATCCTTCAGCGTGGTTTGTGATGTCTTGGCCGTGGCGACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTCATTTTCCTGACTGTCCAACGACTACCACCAGCACATATTTGGGTCACACTTCAGCATTTGATGGTGATCCTTTCCACTGGCACAATGGGGCATGCCCATGTTTAAAGAACAAATCAGGAACTCTATAGTGTAAATCAGGCTGTCATTGGTAGGCCCTACGCAAACTGGCTTTGGTCTTGTGCATCACTTGACCTAACTCTTAATATAGCACAATATTCAGCAAGCGATGCGCTACCCTAGAGTGCATTCATCTCCAGTACTTCAGTGTTTATCAGGTAGACGGAAGGTTTGCTGTTTCACCATTGGATGGGACTTTGTTGTGTTGCAGTGCAATGCTCAGAGTAACCTTCAGAGGCTAAAGGCAGGTTTGTTGGTTGAGGCTTAGCCGGCAGTTCTGTATCCGCCGTACAGTACACAAAGGTTGGTCAGCAGGGAATGAGTCTTTTATAGTAGTTGACCTATTAGCTGTGATGTGGCTGCAGTGCAAGCCTATCTGACTGTGAAGGGGTTAAATACTTTGTTGTTCTGATTTTCCTTTCATAAATGCAACACTTTCATTAAAAAACTACAAACACT
  3   1   2      seed Ski1      in                         CABJ9241.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAATTATGCAAAATGGACAATATTTTGACTGGTTATAAATGTCAGGCTGTGCATAATGTCTTGCCCTGGTGGTTCTATGTTAATATGCAATGCATTTTTGCATCCTCTGGTACAGACAGGGTAAAACTCATGGTCTAGAAACAGGGTAAGGCTCCATCTGTGATGATGTTTACCAAATGAAAGTCATGCCTGGATCCTTCAGCGTGGTTTGTGATGTCTTGGCCGTGGCGACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTAATTTTCCTGACTGTCCAACGACTACCACCAGCACATATTTGGGTCACACTTCAGCATTTGATGGTGATCCTTTTCACTGGCACAATGGGGCATGCCCATGTTTAAAGAACAAATCAGGAACTCTATAGTGTAAATCAGGCTGTCATTGGTAGGCCCTACGCAAACTGGCTTTGGTCTTGTGCATCACTTGACCTAACTCTTAATATAGCACAATATTCAGCAAGCGATGCGCTACCCTAGAGTGCATTCATCTCCAGTACTTCAGTGTTTATCAGGTAGACGGAAGGTTTGCTGTTTCACCATTGGATGGGACTTTGTTGTGTTGCAGTGCAATGCTCAGAGTAACCTTCAGAGGCTAAAGGCAGGTTTGTTGGTTGAGGCTTAGCCGGCAGTTCTGTATCCGCCGTACAGTACACAAAGGTTGGTCAGCAGGGAATGAGTCTTTTATAGTAGTTGACCTATTAGCTGTGATGTGGCTGCAGTGCAAGCCTATCTGACTGTGAAGGGGTTAAATACTTTGTTGTTCTGATTTTCCTTTCATAAATGCAACACTTTCATTAAAAAACTACAAACACT
  3   1   2       bld TpA       out                   TTpA050l06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTGGTTATAAATGTCAGGCTGTGCATAATGTCTGCCCCTGGTGGTTCTATGTTAATATGCAATGCATTTTTGCATCCTCTGGTACAGACAGGGTAAAACTCATGGTCTAGAAACAGGGTAAGGCTCCATCTGTGATGATGTTTACCAAATGAAAGTCATGCCTGGATCCTTCAGCGTGGTTTGTGATGTCTTGGCCGTGGCGACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTAATTTTCCTGACTGTCCAACGACTACCACCAGCACATATTTGGGTCACACTTCAGCATTTGATGGTGATCCTTTTCACTGGCACAATGGGGCATGCCCATGTTTAAAGAACAAATCAGGAACTCTATAGTGTAAATCAGGCTGTCATTGGTAGGCCCTACGCAAACTGGCTTTGGTCTTGTGCATCACTTGACCTAACTCTTAATATAGCACAATATTCAGCAAGCGATGCGCTACCCTAGAGTGCATTCATCTCCAGTACTTCAGTGTTTATCAGGTAGACGGAAGGTTTGCTGTTTCACCATTGGATGGGACTTTGTTGTGTTGCAGTGCAATGCTCAGAGTAACCTTCAGAGGCTAAAGGCAGGTTTGTTGGTTGAGGCTTAGCCGGCAGTTCTGTATCCGCCGTACAGTACACAAAGGTTGGTCAGCAGGGAATGAGTCTTTTATAGTAGTTGACCTATTAGCTGTGATGTGGCTGCAGTGCAAGCCTATCTGACTGTGAAGGGGTTAAATACTTTGTTGTTCTGATTTTCCTTTCATAAATGCAACACTTTCATTAAAAACTACAAACACTAAAAAAAAAAAAAAAAA
  5   1   2       bld Brn1      out                         CABL609.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTGGTTATAAATGTCAGGCTGTGCATAATGTCTTGCCCTGGTGGTTCTATGTTAATATGCAATGCATTTTTGCATCCTCTGGTACAGACAGGGTAAAACTCATGGTCTAGAAACAGGGTAAGGCTCCATCTGTGATGATGTTTACCAAATGAAAGTCATGCCTGGATCCTTCAGCGTGGTTTGTGATGTCTTGGCCGTGGCGACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTAATTTTCCTGACTGTCCAACGACTACCACCAGCACATATTTGGGTCACACTTCAGCATTTGATGGTGATCCTTTTCACTGGCACAATGGGGCATGCCCATGTTTAAAGAACAAATCAGGAACTCTATAGTGTAAATCAGGCTGTCATTGGTAGGCCCTACGCAAACTGGCTTTGGTCTTGTGCATCACTTGACCTAACTCTTAATATAGCACAATATTCAGCAAGCGATGCGCTACCCTAGAGTGCATTCATCTCCAGTACTTCAGTGTTTATCAGGTAGACGGAAGGTTTGCTGTTTCACCATTGGATGGGACTTTGTTGTGTTGCAGTGCAATGCTCAGAGTAACCTTCAGAGGCTAAAGGCAGGTTTGTTGGTTGAGGCTTAGCCGGCAGTTCTGTATCCGCCGTACAGTACACAAAGGTTGGTCAGCAGGGAATGAGTCTTTTATAGTAGTTGACCTATTAGCTGTGATGTGGCTGCAGTGCAAGCCTATCTGACTGTGAAGGGGTTAAATACTTTGTTGTTCTGATTTTCCTTTCATAAATGCAACACTTTCATTAAAAAACTACAAACACTAGTTGCCTC
  3   1   2       bld Te3       in                         CAAM7053.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTATAAAATGTCAGGCTGTGCATAATGTCTGCCCTGGGTGGTTCTATGTTAATATGCAATGCATTTTTGCATCCTCTGGTACAGACAGGGTAAAACTCATGGTCTAGAAACAGGGTAAGGCTCCATCTGTGATGATGTTTACCAAATGAAAGTCATGCCTGGATCCTTCAGCGTGGTTTGTGATGTCTTGGCCGTGGCGACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTAATTTTCCTGACTGTCCAACGACTACCACCAGCACATATTTGGGTCACACTTCAGCATTTGATGGTGATCCTTTTCACTGGCACAATGGGGCATGCCCATGTTTAAAGAACAAATCAGGAACTCTATAGTGTAAATCAGGCTGTCATTGGTAGGCCCTACGCAAACTGGCTTTGGTCTTGTGCATCACTTGACCTAACTCTTAATATAGCACAATATTCAGCAAGCGATGCGCTACCCTAGAGTGCATTCATCTCCAGTACTTCAGTGTTTATCAGGTAGACGGAAGGTTTGCTGTTTCACCATTGGATGGGACTTTGTTGTGTTGCAGTGCAATGCTCAGAGTAACCTTCAGAGGCTAAAGGCAGGTTTGTTGGTTGAGGCTTAGCCGGCAGTTCTGTATCCGCCGTACAGTACACAAAGGTTGGTCAGCAGGGAATGAGTCTTTTATAGTAGTTGACCTATTAGCTGTGATGTGGCTGCAGTGCAAGCCTATCTGACTGTGAAGGGGTTAAATACTTTGTTGTTCTGATTTTCCTTTCATAAATGCAACACTTTCATTAAAAAACTACAAACACT
  5   1   2       bld Brn2                                  CAAJ459.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGTGAAGGGGTTAAATACTTTGTTGTTCTGGTGGTTCTATGTTAATATGCAATGCATTTTTGCATCCTCTGGTACAGACAGGGTAAAACTCATGGTCTAGAAACAGGGTAAGGCTCCATCTGTGATGATGTTTACCAAATGAAAGTCATGCCTGGATCCTTCAGCGTGGTTTGTGATGTCTTGGCCGTGGCGACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTAATTTTCCTGACTGTCCAACGACTACCACCAGCACATATTTGGGTCACACTTCAGCATTTGATGGTGATCCTTTTCACTGGCACAATGGGGCATGCCCATGTTTAAAGAACAAATCAGGAACTCTATAGTGTAAATCAGGCTGTCATTGGTAGGCCCTACGCAAACTGGCTTTGGTCTTGTGCATCACTTGACCTAACTCTTAATATAGCACAATATTCAGCAAGCGATGCGCTACCCTAGAGTGCATTCATCTCCAGTACTTCAGTGTTTATCAGGTAGACGGAAGGTTTGCTGTTTCACCATTGGATGGGACTTTGTTGTGTTGCAGTGCAATGCTCAGAGTAACCTTCAGAGGCTAAAGGCAGGTTTGTTGGTTGAGGCTTAGCCGGCAGTTCTGTATCCGCCGTACAGTACACAAAGGTTGGTCAGCAGGGAATGAGTCTTTTATAGTAGTTGACCTATTAGCTGTGATGTGGCTGCAGTGCAAGCCTATCTGACTGTGAAGGGGTTAAATACTTTGTTGTTCTGATTTTCCTTTCATAAATGCAACACTTTCATTAAAAACTACAAACACTAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT66619.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTATGTTAATATGCAATGCATTTTTGCATCCTCTGGTACAGACAGGGTAAAACTCATGGTCTAGAAACAGGGTAAGGCTCCATCTGTGATGATGTTTACCAAATGAAAGTCATGCCTGGATCCTTCAGCGTGGTTTGTGATGTCTTGGCCGTGGCGACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTAATTTTCCTGACTGTCCAACGACTACCACCAGCACATATTTGGGTCACACTTCAGCATTTGATGGTGATCCTTTTCACTGGCACAATGGGGCATGCCCATGTTTAAAGAACAAATCAGGAACTCTATAGTGTAAATCAGGCTGTCATTGGTAGGCCCTACGCAAACTGGCTTTGGTCTTGTGCATCACTTGACCTAACTCTTAATATAGCACAATATTCAGCAAGCGATGCGCTACCCTAGAGTGCATTCATCTCCAGTACTTCAGTGTTTATCAGGTAGACGGAAGGTTTGCTGTTTCACCATTGGATGGGACTTTGTTGTGTTGCAGTGCAATGCTCAGAGTAACCTTCAGAGGCTAAAGGCAGGTTTGTTGGTTGAGGCTTAGCCGGCAGTTCTGTATCCGCCGTACAGTACACAAAGGTTGGTCAGCAGGGAATGAGTCTTTTATAGTAGTTGACCTATTAGCTGTGATGTGGCTGCAGTGCAAGCCTATCTGACTGTGAAGGGGTTAAATACTTTGTTGTTCTGATTTTCCTTTCATAAATGCAACACTTTCATTAAAAAACTAC
  3   1   2       bld Brn4      in                         CAAL7465.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGTTAATATGCAATGCATTTTTGCATCCTCTGGTACAGACAGGGTAAAACTCATGGTCTAGAAACAGGGTAAGGCTCCATCTGTGATGATGTTTACCAAATGAAAGTCATGCCTGGATCCTTCAGCGTGGTTTGTGATGTCTTGGCCGTGGCGACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTAATTTTCCTGACTGTCCAACGACTACCACCAGCACATATTTGGGTCACACTTCAGCATTTGATGGTGATCCTTTCCACTGGCACAATGGGGCATGCCCATGTTTAAAGAACAAATCAGGAACTCTATAGTGTAAATCAGGCTGTCATTGGTAGGCCCTACGCAAACTGGCTTTGGTCTTGTGCATCACTTGACCTAACTCTTAATATAGCACAATATTCAGCAAGCGATGCGCTACCCTAGAGTGCATTCATCTCCAGTACTTCAGTGTTTATCAGGTAGACGGAAGGTTTGCTGTTTCACCATTGGATGGGACTTTGTTGTGTTGCAGTGCAATGCTCAGAGTAACCTTCAGAGGCTAAAGGCAGGTTTGTTGGTTGAGGCTTAGCCGGCAGTTCTGTATCCGCCGTACAGTACACAAAGGTTGGTCAGCAGGGAATGAGTCTTTTATAGTAGTTGACCTATTAGCTGTGATGTGGCTGCAGTGCAAGCCTATCTGACTGTGAAGGGGTTAAATACTTTGTTGTTCTGATTTTCCTTTCATAAATGCAACACTTTCATTAAAAAACTACAAAC
  3   1   2       bld Brn3 5g3  in                         CAAK1480.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TACAGACAGGGTAAAACTCATGGTCTAGAAACAGGGTAAGGCTCCATCTGTGATGATGTTTACCAAATGAAAGTCATGCCTGGATCCTTCAGCGTGGTTTGTGATGTCTTGGCCGTGGCGACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTAATTTTCCTGACTGTCCAACGACTACCACCAGCACATATTTGGGTCACACTTCAGCATTTGATGGTGATCCTTTCCACTGGCACAATGGGGCATGCCCATGTTTAAAGAACAAATCAGGAACTCTATAGTGTAAATCAGGCTGTCATTGGTAGGCCCTACGCAAACTGGCTTTGGTCTTGTGCATCACTTGACCTAACTCTTAATATAGCACAATATTCAGCAAGCGATGCGCTACCCTAGAGTGCATTCATCTCCAGTACTTCAGTGTTTATCAGGTAGACGGAAGGTTTGCTGTTTCACCATTGGATGGGACTTTGTTGTGTTGCAGTGCAATGCTCAGAGTAACCTTCAGAGGCTAAAGGCAGGTTTGTTGGTTGAGGCTTAGCCGGCAGTTCTGTATCCGCCGTACAGTACACAAAGGTTGGTCAGCAGGGAATGAGTCTTTTATAGTAGTTGACCTATTAGCTGTGATGTGGCTGCAGTGCAAGCCTATCTGACTGTGAAGGGGTTAAATACTTTGTTGTTCTGATTTTCCTTTCATAAATGCAACACTTTCATTAAAAAACTACAAACACT
  3   1   2       bld Sto1      in                         CABG6405.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTACCAAATGAAAGTCATGCCTGGATCCTTCAGCGTGGTTTGTGATGTCTTGGCCGTGGCGACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTAATTTTCCTGACTGTCCAACGACTACCACCAGCACATATTTGGGTCACACTTCAGCATTTGATGGTGATCCTTTTCACTGGCACAATGGGGCATGCCCATGTTTAAAGAACAAATCAGGAACTCTATAGTGTAAATCAGGCTGTCATTGGTAGGCCCTACGCAAACTGGCTTTGGTCTTGTGCATCACTTGACCTAACTCTTAATATAGCACAATATTCAGCAAGCGATGCGCTACCCTAGAGTGCATTCATCTCCAGTACTTCAGTGTTTATCAGGTAGACGGAAGGTTTGCTGTTTCACCATTGGATGGGACTTTGTTGTGTTGCAGTGCAATGCTCAGAGTAACCTTCAGAGGCTAAAGGCAGGTTTGTTGGTTGAGGCTTAGCCGGCAGTTCTGTATCCGCCGTACAGTACACAAAGGTTGGTCAGCAGGGAATGAGTCTTTTATAGTAGTTGACCTATTAGCTGTGATGTGGCTGCAGTGCAAGCCTATCTGACTGTGAAGGGGTTAAATACTTTGTTGTTCTGATTTTCCTTTCATAAATGCAACACTTTCATTAAAAAACTACAAAC
  5   1   2       bld Sto1      in                         CABG6405.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTACCAAATGAAAGTCATGCCTGGATCCTTCAGCGTGGTTTGTGATGTCTTGGCCGTGGCGACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTAATTTTCCTGACTGTCCAACGACTACCACCAGCACATATTTGGGTCACACTTCAGCATTTGATGGTGATCCTTTTCACTGGCACAATGGGGCATGCCCATGTTTAAAGAACAAATCAGGAACTCTATAGTGTAAATCAGGCTGTCATTGGTAGGCCCTACGCAAACTGGCTTTGGTCTTGTGCATCACTTGACCTAACTCTTAATATAGCACAATATTCAGCAAGCGATGCGCTACCCTAGAGTGCATTCATCTCCAGTACTTCAGTGTTTATCAGGTAGACGGAAGGTTTGCTGTTTCACCATTGGATGGGACTTTGTTGTGTTGCAGTGCAATGCTCAGAGTAACCTTCAGAGGCTAAAGGCAGGTTTGTTGGTTGAGGCTTAGCCGGCAGTTCTGTATCCGCCGTACAGTACACAAAGGTTGGTCAGCAGGGAATGAGTCTTTTATAGTAGTTGACCTATTAGCTGTGATGTGGCTGCAGTGCAAGCCTATCTGACTGTGAAGGGGTTAAATACTTTGTTGTTCTGATTTTCCTTTCATAAATGCAACACTTTCATTAAAAAACTACAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Limb      in                         CBSU573.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AATGAAAGTCATGCCTGGATCCTTCAGCGTGGTTTGTGATGTCTTGGCCGTGGCGACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTCATTTTCCTGACTGTCCAACGACTACCACCAGCACATATTTGGGTCACACTTCAGCATTTGATGGTGATCCTTTCCACTGGCACAATGGGGCATGCCCATGTTTAAAGAACAAATCAGGAACTCTATAGTGTAAATCAGGCTGTCATTGGTAGGCCCTACGCAAACTGGCTTTGGTCTTGTGCATCACTTGACCTAACTCTTAATATAGCACAATATTCAGCAAGCGATGCGCTACCCTAGAGTGCATTCATCTCCAGTACTTCAGTGTTTATCAGGTAGACGGAAGGTTTGCTGTTTCACCATTGGATGGGACTTTGTTGTGTTGCAGTGCAATGCTCAGAGTAACCTTCAGAGGCTAAAGGCAGGTTTGTTGGTTGAGGCTTAGCCGGCAGTTCTGTATCTGCCGTACAGTACACAAAGGTTGGTCAGCAGGGAATGAGTCTTTTATAGTAGTTGACCTATTAGCTGTGATGTGGCTGCAGTGCAAGCCTATCTGACTGTGAAGGGGTTAAATACTTTGTTGTTCTGATTTTCCTTTCATAAATGCAACACTTTCATTAAAAAACTACAAACAC
  3   1   2       bld Eye       in                         CCAX6748.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGATCCTTCAGCGTGGTTTGTGATGTCTTGGCCGTGGCGACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTCATTTTCCTGACTGTCCAACGACTACCACCAGCACATATTTGGGTCACACTTCAGCATTTGATGGTGATCCTTTCCACTGGCACAATGGGGCATGCCCATGTTTAAAGAACAAATCAGGAACTCTATAGTGTAAATCAGGCTGTCATTGGTAGGCCCTACGCAAACTGGCTTTGGTCTTGTGCATCACTTGACCTAACTCTTAATATAGCACAATATTCAGCAAGCGATGCGCTACCCTAGAGTGCATTCATCTCCAGTACTTCAGTGTTTATCAGGTAGACGGAAGGTTTGCTGTTTCACCATTGGATGGGACTTTGTTGTGTTGCAGTGCAATGCTCAGAGTAACCTTCAGAGGCTAAAGGCAGGTTTGTTGGTTGAGGCTTAGCCGGCAGTTCTGTATCCCCCGTACAGTACACAAAGGTTGGTCAGCAGGGAATGAGTCTTTTATAGTAGTTGACCTATTAGCTGTGATGTGGCTGCAGTGCAAGCCTATCTGACTGTGAAGGGGTTAAATACTTTGTTGTTCTGATTTTCCTTTCATAAATGCAACACTTTCATTAAAAAACTACAAACACTA
  3   1   2       bld Te1       in                         CBWN6852.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTTCAGCGTGGTTTGTGATGTCTTGGCCGTGGCGACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTAATTTTCCTGACTGTCCAACGACTACCACCAGCACATATTTGGGTCACACTTCAGCATTTGATGGTGATCCTTTTCACTGGCACAATGGGGCATGCCCATGTTTAAAGAACAAATCAGGAACTCTATAGTGTAAATCAGGCTGTCATTGGTAGGCCCTACGCAAACTGGCTTTGGTCTTGTGCATCACTTGACCTAACTCTTAATATAGCACAATATTCAGCAAGCGATGCGCTACCCTAGAGTGCATTCATCTCCAGTACTTCAGTGTTTATCAGGTAGACGGAAGGTTTGCTGTTTCACCATTGGATGGGACTTTGTTGTGTTGCAGTGCAATGCTCAGAGTAACCTTCAGAGGCTAAAGGCAGGTTTGTTGGTTGAGGCTTAGCCGGCAGTTCTGTATCCGCCGTACAGTACACAAAGGTTGGTCAGCAGGGAATGAGTCTTTTATAGTAGTTGACCTATTAGCTGTGATGTGGCTGCAGTGCAAGCCTATCTGACTGTGAAGGGGTTAAATACTTTGTTGTTCTGATTTTCCTTTCATAAATGCAACACTTTCATTAAAAAACTACAAACAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT54942.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTCATTGGTTTTGCTGTCCGTTGCTAGATATAGATTGCAGTGTGCTTCAACTTTCTTTTAATTTTCCGGACTGTCCAAGGACTACCCCCAGCACATATTTGGGTCCCACTTCAGCATTTGATGGTGATCCTTTTCACGGGCCCAATGGGGCATGCCCATGTTTAAAGAACAAATCAGGAACTCTATAGTGTAAATCAGGCTGTCATTGGTAGGCCCTACGCAAACTGGCTTTGGTTTTGTGCATCACTTGACCTAACTTTTAATATAGCCCAATTTTCAGCAAGGGATGCGCTACCCTAGAGTGCATTCATTTCCAGTACTTCAGTGTTTTTCAGGTAGACGGAAGGTTTGCTGTTTCCCCATTGGATGGGACTTTGTTGTGTTGCAGTGCAATGCTCAGAGTAACCTTCAGAGGCTAAAGGCAGGTTTTTTGGTTGAGGTTTAGCCGGCAGTTCTGTTTCCCCCGTCCAGTACCCAAAGGTTGGTCACCAGGGAATGAGTTTTTTATAGTAGTTGACCTTTTAGCTGTGATGGGGCTGCAGTCCAAGCCTTTTTGACTGTGAAGGGGTTAAATACTTTGTTGTTTTGATTTTCCTTTCAAAAATGCAACCCTTTCATTAAAAAACTCCAACCCCT
  3   1   2       bld Eye       in                         CCAX3516.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTTTTTATAGTAGTTGACCTATTAGCTGTGATGTGGCTGCAGTGCAAGCCTATCTGACTGTGAAGGGGTTAAATACTTTGTTGTTCTGATTTTCCTTTCATAAATGCAACACTTTCATTAAAAAACTACAAACACTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)