Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     1  95.0    0(repeat)                                    0 REP     86       1945     2138                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012075931 Xt7.1-CAAP12410.3 - 49 ESTs
                                                                       ........-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAP12410.3                                                                                                                                                     CGGGTCGCATTACCAGCCATTGGCTTTCTGTGTTAGCTGCTTTTTTTCTAGGCGCCACCATGACGGGAGGAAAGGAGCTAGGGGCGGCTGTGGCGTTGTATGAACGGCTGCAGAAGCTCTCCTGTCCATGTTTAGAGGGTGTGTATCTCACAGATCCTCAGAGTATACATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGATGTCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCTGTTCAAGAACAGTTATCATCTTTAAAGGAATCTCAAACAGACATTAAAGTAAAAGAAATTGCCAAGCTTTGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAAAGGACATGCCAGCCCTCTCAAACAGATCTCCTTTATAGAGCAGCTATTGGATGTCATCCAGTTTCCTGACATAATTTCAAATAATGTCACACTTGAATCGTTGTCTCACAGCACAGAAAAAAATATTGTAACCTGCATTCGAGAAAACGAAGAGTTTTTGAAAGAATTATTTTCCAGTCCTCATTTTTATGCCACCCTTAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTATTCTAACGGCTGAGGAATCTCTTCAGAAAAGGGCACCCCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAGAAGAGTGTGTGGATCTCTGCAGCTCTGTGGCTGATGGTGATAAAGTTATTCAGACTCTGAGGCTGGCCTTGACTGATTTCCATCAACTGACTGTAGCCTTTAATCAAGTTTATGTGAATGAGTTCCAGGAGCACTGTGGCCATCCTACCCCTCAGATGAGCCCTGCGGGACCTTTTTTCCAATCTGTCCACCAGTCACTTAGCACCTGCTGCAAGGAGCTTGAATCCATTGCCCAGTTTACAGAAACTTCTGAGAAAATTGTAAATGTGGTGAATGAGAGGTATCAGTCTAAGGAGAAATGGTCAGGAAGCTCTATTTCCACACTGTATGAGAAAATGAAGGAACTGAGACAGAGCTATGAGGCATTTCAACAAAGTTCATTGCAGGACTGAAGAACTATGAGCCATTGGAACTTCCATGCTACCACAAAAACCATGTATTTTAAAAATGACGGTTGGAATAAAAGCATGCTACCTACTACCCCTTTTCATATTGCATTAGAGGGTGGAAAAGGCATCTACCAAAAACTTTGTTCATCCAGGATAATCCTATATGAAGAAAACACATCCATTTTACATTGATACCGTTTTGTCTGCTGGATTAATAGACATTTCGACTGTAGGATAACAAACATAACCATTTTAAGGATGCTACTTTTAAAACACCAAGTAATAAACAAGACCCATTGCTGTTAAATACTGGCGGCTACTTTTGTACAGGTGAACAGTAACTGTTTTATAAAGCATTTCTGATCTTAGATGCTAGCTATGCTGTTATTAAGAAGATATGAGATTGCTCTTGGCAAAATATTTAGTGCCTACTTATCTATTTCATGCTAACTGATTCAGACAGGTGTGTGCTTGCCTGTGGCAATAAACAGGCCAGCAATACAATTTCAAAAATAAGAACAAACAGCCAAAAGTATAAATTTATTGCAATTCACACGTTTACGGCCTCACAGGCCCTTTTTCACGTTTGTATCGAACAGTGTATTCGTTAAGCTTTAAGTAACCACCCGTGGTGGTGTCTCCATGTATTTCCAGCAATTGGGTAAGAATTGATAATGTTCTTAGTGTAATTGTACTTTACAATTGGGCAGCATATTATATACAGTCTGTCATTTGTAACTTTTATCAGGTAGGCCCCAGTGAATTGTAATGATCTAATGTTTTAAAAGTGAAAAATATGAAAATGGACTGTTTTTAATTATGAACGCTCACTCTGTGGATACTTAGGGTGAAGACACACACAGCTACTTGTCACAGCTACAAAATGTCAGAAAATACCCTGCCATAGACAGTACCGAGAATTGCCTCTGCTAAAACACACATAGAGACAATTATCAGTAAATGATCAGCATTGTCTATTTTTGTATCTGTGACAAGTAGCTGATACTAGTAGCTCTGTGTGTCTTTACCATTAGTGGACTATATGTTTAGACCAATTGGTCAATACAGCACTTCTGTTCTGTTTATTTAATTGGTGTGTGGAGGTAAGGAGACACACCCCGGATGGTCACTTAAAGCTTAACTCACGCACTGTTCGGTACACACTTGAAAAAGAGCTAGCTCAAAACATGTTGTGTGGATACCACTACATTTGCACTTTTGAAAGTAAACCTGCATT
                                                  Xt7.1-CHK-1008225820                                                                                                                                                           GCATTACCAGCCATTGGCTTTCTGTGTTAGCTGCTTTTTTTCTAGGCGCCACCATGACGGGAGGAAAGGAGCTAGGGGCGGCTGTGGCGTTGTATGAACGGCTGCAGAAGCTCTCCTGTCCATGTTTAGAGGGTGTGTATCTCACAGATCCTCAGAGTATACATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGATGTCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCTGTTCAAGAACAGTTATCATCTTTAAAGGAATCTCAAACAGACATTAAAGTAAAAGAAATTGCCAAGCTTTGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAAAGGACATGCCAGCCCTCTCAAACAGATCTCCTTTATAGAGCAGCTATTGGATGTCATCCAGTTTCCTGACATAATTTCAAATAATGTCACACTTGAATCGTTGTCTCACAGCACAGAAAAAAATATTGTAACCTGCATTCGAGAAAACGAAGAGTTTTTGAAAGAATTATTTTCCAGTCCTCATTTTTATGCCACCCTTAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTATTCTAACGGCTGAGGAATCTCTTCAGAAAAGGGCACCCCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAGAAGAGTGTGTGGATCTCTGCAGCTCTGTGGCTGATGGTGATAAAGTTATTCAGACTCTGAGGCTGGCCTTGACTGATTTCCATCAACTGACTGTAGCCTTTAATCAAGTTTATGTGAATGAGTTCCAGGAGCACTGTGGCCATCCTACCCCTCAGATGAGCCCTGCGGGACCTTTTTTCCAATCTGTCCACCAGTCACTTAGCACCTGCTGCAAGGAGCTTGAATCCATTGCCCAGTTTACAGAAACTTCTGAGAAAATTGTAAATGTGGTGAATGAGAGGTATCAGTCTAAGGAGAAATGGTCAGGAAGCTCTATTTCCACACTGTATGAGAAAATGAAGGAACTGAGACAGAGCTATGAGGCATTTCAACAAAGTTCATTGCAGGACTGAAGAACTATGAGCCATTGGAACTTCCATGCTACCACAAAAACCATGTATTTTAAAAATGACGGTTGGAATAAAAGCATGCTACCTACTACCCCTTTTCATATTGCATTAGAGGGTGGAAAAGGCATCTACCAAAAACTTTGTTCATCCAGGATAATCCTATATGAAGAAAACACATCCATTTTACATTGATACCGTTTTGTCTGCTGGATTAATAGACATTTCGACTGTAGGATAACAAACATAACCATTTTAAGGATGCTACTTTTAAAACACCAAGTAATAAACAAGACCCATTGCTGTTAAATACTGGCGGCTACTTTTGTACAGGTGAACAGTAACTGTTTTATAAAGCATTTCTGATCTTAGATGCTAGCTATGCTGTTATTAAGAAGATATGAGATTGCTCTTGGCAAAATATTTAGTGCCTACTTATCTATTTCATGCTAACTGATTCAGACAGGTGTGTGCTTGCCTGTGGCAATAAACAGGCCAGCAATACAATTTCAAAAATAAGAACAAACAGCCAAAAGTATAAATTTATTGCAATTCACACGTTTACGGCCTCACAGGCCCTTTTTCACGTTTGTATCGAACAGTGTATTCGTTAAGCTTTAAGTAACCACCCGTGGTGGTGTCTCCATGTATTTCCAGCAATTGGGTAAGAATTGATAATGTTCTTAGTGTAATTGTACTTTACAATTGGGCAGCATATTATATACAGTCTGTCATTTGTAACTTTTATCAGGTAGGCCCCAGTGAATTGTAATGATCTAATGTTTTAAAAGTGAAAAATATGAAAATGGACTGTTTTTAATTATGAACGCTCACTCTGTGGATACTTAGGGTGAAGACACACACAGCTGCTTGTCACAGCTACAAAATGTCAGAAAATACCCTGCCATAGACAGTACCGAGAATTGCCTCTGCTAAAACACACATAGAGACAATTATCAGTAAATGATCAGCATTGTCTATTTTTGTATCTGTGACAAGTAGCTGATACTAGTAGCTCTGTGTGTCTTTACCATTAGTGGACTATATGTTTAGACCAATTGGTCAATACAGCACTTCTGTTCTGTTTATTTAATTGGTGTGTGGAGGTAAGGAGACACACCCCGGATAGTCACTTAAAGCTTAACTCACGCACTGTTCGGTACACACTTGAAAAAGAGCTAGCTCAAAACATGTTGTGTGGATACCACTACATTTGCACTTTTGAAAGTAAACCTGCATTTGAAAA
                                                      consensus depths                                                                                                                                                          2     3     2     3     3     6     4     6     6     7     7     7     7     7     8     8     8     9     8    10     9    12     9    12     9    12    11    14    12    14    13    15    13    15    13    15    12    15    14    16    15    17    15    17    15    17    15    17    15    17    16    17    16    17    16    17    16    17    16    17    16    17    17    17    18    18    18    18    18    18    18    18    18    18    18    18    18    18    16    19    16    19    16    19    16    19    17    20    17    19    18    20    17    21    18    21    19    22    18    22    17    20    16    20    20    23    20    24    19    25    19    24    18    24    17    24    18    24    17    23    17    23    17    23    17    22    18    22    18    21    18    21    19    22    20    22    19    22    19    20    19    20    19    20    20    21    19    21    20    21    20    21    19    20    18    19    18    19    17    18    16    17    16    16    16    16    17    17    17    17    17    17    16    17    16    17    15    17    15    17    14    16    14    16    14    16    14    16    15    17    15    17    15    17    15    17    15    17    15    17    15    17    15    17    15    17    15    17    14    17    13    16    13    16    13    16    13    16    13    16    13    14    13    14    13    14    12    14     8    12     8    11     7    11     4     9     4     6     4     6     4     6     4     6     4     6     5     8     6     8     6     8     6     8     7     9     8     9     9    10    10    11    10    11    10    11    10    11    12    14    12    14    13    13    13    13    13    13    13    14    11    14    12    14     9    13     8    12    11    12    12    13    12    13    12    13    12    13    12    13    12    13    12    13    11    13    11    13    11    13    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    12    14    11    14    13    14    10    14     9    14    11    14    10    14    10    14     7    14    11    14    12    13    12    13    10    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13     9    13     8    13    12    13    12    13    11    12    11    12    10    12    10    11    10    11    10    11
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTGTCAGTGGG
                                                                   SNP                                                                                                                                                                                                                                                     -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----A---G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---G---G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     G--------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----GG-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---G-G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---A---A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---G-------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --A---------
                                               BLH MIN      71      23                                                                                                                                                     
                                                                                                                                                                                                                                                                                                                                            PREDICTED = Sp ==== 8e-022     XP_786419.2 PREDICTED: similar to nuclear matrix protein 1, partial [Strongylocentrotus purpuratus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Dr ---- 2e-053     XP_686762.1 PREDICTED: hypothetical protein XP_681670 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                   PROTEIN --- Mm ---- 1e-060     NP_082909.1 UCH37-interacting protein 1 [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                  PROTEIN --- Hs ---- 1e-061     NP_059988.3 UCH interacting protein 1 isoform a [Homo sapiens] --------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAP12410.3                                                                                                                                                                                                                ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------TGA------ATG---------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------ATG------------------------------------------TAA------------------------------------------------------TGA---TAGATG------ATG------------------------------------------------------------------TAA---------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------TAA------------------------ATG------------------------TGATAA------TAG---------------------------------------------------TAA---------------------TGA------ATG---TAA------------------------------------------ATG---------------------TAG------------------------------------------------------------------------------------TAA------------------------TAAATG---------------------------------TAG------------------------------------------------TAG------------------------------------------------------TAA---------------ATG------TAA------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2       bld In60 PIPE                       IMAGE:8952257.5p                                                                             ATCGCAAGTTATTTTTTCAAGATTACAACAATTAAAAACGCCCGACCTCCCACAAGGACAGACGAATTGTGGCGGGTCGCATTACCAGCCATTGGCTTTCTGTGTTAGCTGCTTTTTTTCTAGGCGCCACCATGACGGGAGGAAAGGAGCTAGGGGCGGCTGTGGCGTTGTATGAACGGCTGCAGAAGCTCTCCTGTCCATGTTTAGAGGGTGTGTATCTCACAGATCCTCAGAGTATACATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGATGTCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCTGTTCAAGAACAGTTATCATCTTTAAAGGAATCTCAAACAGACATTAAAGTAAAAGAAATTGCCAAGCTTTGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAAAGGACATGCCAGCCCTCTCAAACAGATCTCCTTTATAGAGCAGCTATTGGATGTCATCCAGTTTCCTGACATAATTTCAAATAATGTCACACTTGAATCGTTGTCTCACAGCACAGAAAAAAATATTGTAACCTGCATTCGAGAAAACGAAGAGTTTTTGAAAGAATTATTTTCCAGTCCTCATTTTTATGCCACCCTTAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTATTCTAACGGCTGAGGAATCTCTTCAGAAAAGGGCACCCCAGACTAGCATGGGAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAGAGAGTGTGTGATCTCTGCAGCTCTGTGGCTGATGGTGATAAAGTAATCAGACTCTGAGCTGCTGACTGATTTCATCACTGACTGTAGCCTTAATCAGTTTATGGTGAATGGAGTTC
  5   1   2       bld AbdN      in                       IMAGE:6998258                                                                                                                 CCCGGGGATCTCCCACAAGGACAGACGAATTGTGGCGGGTCGCATTACCAGCCATTGGCTTTCTGTGTTAGCTGCTTTTTTTTCTAGGCGCCACCATGACGGGAGGAAAGGAGCTAGGGGCGGCTGTGGCGTTGTATGAGCGGCTGCAGAAGCTCTCCTGTCCATGTTTAGAGGGTGTGTATCTCACAGATCCTCAGAGTATACATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGATGTCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCTGTTCAAGAACAGTTATCATCTTTAAAGGAATCTCAAACAGACATTAAAGTAAAAGAAATTGCCAAGCTTTGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAAAGGACATGCCAGCCCTCTCAAACAGATCTCCTTTATAGAGCAGCTATTGGATGTCATCCAGTTTCCTGACATAATTTCAAATAATGTCACACTTGAATCGTTGTCTCACAGCACAGAAAAAAAATATTGTAACCTGCATTCGAGAAAACGAAGAGTTTTTGAAAGAATTATTTTCCAGTCCTCATTTTTATGCCACCCTTAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCANACCTATTCTAACGGCTGAGGAATCTCTTCAGAAAAGGGCACCCCAGACTAGCATGGGAAAAATATGAGCATTCTGTAGAGCTTACAGGAATTTCTTATCCTAGAGCATTAAGAGAGTGGTGATCTCGCACTTGTGCTATGTGATAGTATCAACTCGAGCTGC
  5   1   2       bld Egg                            TEgg128n23.p1kSP6                                                                                                                                                    GCGGGTCGCATTACCAGCCATTGGCTTTCTGTGTTAGCTGCTTTTTTTCTAGGCGCCACCATGACGGGAGGAAAGGAGCTAGGGGCGGCTGTGGCGTTGTATGAACGGCTGCAGAAGCTCTCCTGTCCATGTTTAGAGGGTGTGTATCTCACAGATCCTCAGAGTATACATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGATGTCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCTGTTCAAGAACAGTTATCATCTTTAAAGGAATCTCAAACAGACATTAAAGTAAAAGAAATTGCCAAGCTTTGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAAAGGACATGCCAGCCCTCTCAAACAGATCTCCTTTATAGAGCAGCTATTGGATGTCATCCAGTTTCCTGACATAATTTCAAATAATGTCACACTTGAATCGTTGTCTCACAGCACAGAAAAAAATATTGTAACCTGCATTCGAGAAAACGAAGAGTTTTTGAAAGAATTATTTTCCAGTCCTCATTTTTATGCCACCCTTAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTATTCTAAC
  5   1   2       bld Ovi1      in                         CABI7111.5p                                                                                                                                                                  CAGCCATTGGCTTTCTGTGTTAGCTGCTTTTTTTCTAGGCGCCACCATGACGGGAGGAAAGGAGCTAGGGGCGGCTGTGGCGTTGTATGAGCGGCTGCAGAAGCTCTCCTGTCCATGTTTAGAGGGTGTGTATCTCACAGATCCTCAGAGTATACATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGATGTCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCTGTTCAAGAACAGTTATCATCTTTAAAGGAATCTCAAACAGACATTAAAGTAAAAGAAATTGCCAAGCTTTGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAAAGGACATGCCAGCCCTCTCAAACAGATCTCCTTTATAGAGCAGCTATTGGATGTCATCCAGTTTCCTGACATAATTTCAAATAATGTCACACTTGAATCGTTGTCTCACAGCACAGAAAAAAATATTGTAACCTGCATTCGAGAAAACGAAGAGTTTTTGAAAGAATTATTTTCCAGTCCTCATTTTTATGCCACCCTTAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTATTCTAACGGCTGAGGAATCTCTTCAGAAAAGGGCACCCCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAGAAGAGTGTGTGGATCTCTGCAGCTCTGTGGCTGATGGTGATAAAGTTATTCAGACTCTGAGGCTGGCCTTGACTGATTTCCATCAACTGACTGTAGCCTTTAACAAGTTTATGTGAATGAGTTC
  5   1   2       bld Ovi1      in                        CABI13212.5p                                                                                                                                                                      CTCGATTCAATTCGGCACGAGGCTTTTTTTCTAGGCGCCACCATGACGGGAGGAAAGGAGCTAGGGGCGGCTGTGGCGTTGTATGAGCGGCTGCAGAAGCTCTCCTGTCCATGTTTAGAGGGTGTGTATCTCACAGATCCTCAGAGTATACATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGATGTCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCTGTTCAAGAACAGTTATCATCTTTAAAGGAATCTCAAACAGACATTAAAGTAAAAGAAATTGCCAAGCTTTGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAAAGGACATGCCAGCCCTCTCAAACAGATCTCCTTTATAGAGCAGCTATTGGATGTCATCCAGTTTCCTGACATAATTTCAAATAATGTCACACTTGAATCGTTGTCTCACAGCACAGAAAAAAATATTGTAACCTGCATTCGAGAAAACGAAGAGTTTTTGAAAGAATTATTTTCCAGTCCTCATTTTTATGCCACCCTTAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTATTCTAACGGCTGAGGAATCTCTTCAGAAAAGGGCACCCCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAGAAGAGTGTGTGGATCTCTGCAGCTCTGTGGCTGATGGTGATAAAGTTATTCAGACTCTGAGGCTGGCCTTGACTGATTTCCATCAACTGACTGTAGCCTTTAATCAAGTTTATGTGAATGAGTTCCAGGAGCACTGTGGCCATCCTACCCCTCAGATGAGCCCTGCGGGACCTTTTTTCCNATCTGTCCACCAGTCACTTAGCACCTGCTGCAAGGAGCTTGAATCCATTGCCCA
  5   1   2       bld In63                            IMAGE:8961550.5p                                                                                                                                                                       CCTATTTATTAATTAAAAGAACCAAATCCTCCTTTTAATTCGTCCCGGGAGGAAAGGAGCTAGGGGCGGCTGTGGCGTTGTATGAACGGCTGCAGAAGCTCTCCTGTCCATGTTTAGAGGGTGTGTATCTCACAGATCCTCAGAGTATACATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGATGTCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCTGTTCAAGAACAGTTATCATCTTTAAAGGAATCTCAAACAGACATTAAAGTAAAAGAAATTGCCAAGCTTTGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAAAGGACATGCCAGCCCTCTCAAACAGATCTCCTTTATAGAGCAGCTATTGGATGTCATCCAGTTTCCTGACATAATTTCAAATAATGTCACACTTGAATCGTTGTCTCACAGCACAGAAAAAAATATTGTAACCTGCATTCGAGAAAACGAAGAGTTTTTGAAAGAATTATTTTCCAGTCCTCATTTTTATGCCACCCTTAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTATTCTAACGGCTGAGGAATCTCTTCAGAAAAGGGCACCCCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAGAGAGTGTGTGGATCTCTGCAGCTCTGTGGCTGATGGTGATAAAGTTATTTCAGACTCTGAGCTGGGCCTTGACTGATTTCCATCAACTGACTGTAGCCTTTAATCAAGTTTATGTGATGAATCCAGAGCACTGTGGCCATCCTACCCTCGATGAGCCTGCGGGACCTTTTTTTCAATCTGTCTCAGTCACTAGCACTGCTGCAAGGAGCTTGATCCATGCCAGTACGAACTTTCTGAAAGATGTGTAATGTGTGGTGAATGGAAAGTGT
  5   1   2       bld Gas8      in                          st23i11.5p                                                                                                                                                                                          TGCTTTTTTTCTAGGCGCCACCATGACGGGAGGAAAGGAGCTAGGGGCGGCTGTGGCGTTGTATGAACGGCTGCAGAAGCTCTCCTGTCCATGTTTAGAGGGTGTGTATCTCACAGATCCTCAGAGTATACATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGATGTCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCTGTTCAAGAACAGTTATCATCTTTAAAGGAATCTCAAACAGACATTAAAGTAAAAGAAATTGCCAAGCTTTGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAAAGGACATGCCAGCCCTCTCAAACAGATCTCCTTTATAGAGCAGCTATTGGATGTCATCCAGTTTCCTGACATAATTTCAAATAATGTCACACTTGAATCGTTGTCTCACAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTATTCTAACGGCTGAGGAATCTCTTCAGAAAAGGGCACCCCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAGAAGAGGAGCTTGAATCCATTGCCCAGTTTACAGAAACTTCTGAGAAAATTGTAAATGTGGTGAATGAGAGGTATCAGTCTAAGGAGAAATGGTCAGGAAGCTCTATTTCCACACTGTATGAGAAAATGAAGGAACTGAGAC
  5   1   2       bld Gas7      in                         XZG54391.5p                                                                                                                                                                                                                              GGAGCTAGGGGCGGCTGTGGCGTTGTATGAGCGGCTGCAGAAGCTCTCCTGTCCATGTTTAGAGGGTGTGTATCTCACAGATCCTCAGAGTATACATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGATGTCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCTGTTCAAGAACAGTTATCATCTTTAAAGGAATCTCAAACAGACATTAAAGTAAAAGAAATTGCCAAGCTTTGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAAAGGACATGCCAGCCCTCTCAAACAGATCTCCTTTATAGAGCAGCTATTGGATGTCATCCAGTTTCCTGACATAATTTCAAATAATGTCACACTTGAATCGTTGTCTCACAGCACAGAAAAAAATATTGTAACCTGCATTCGAGAAAACGAAGAGTTTTTGAAAGAATTATTTTCCAGTCCTCATTTTTATGCCACCCTTAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTATTCTAACGGCTGAGGAATCTCTTCAGAAAAGGGCACCCCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAGAAGAGTGTGTGGATCTCTGCAGCTCTGTGGCTGATGGTGATAAAGTTATTCAGACTCTGAGGCTGGCCTTGACTGATTTCCATCAACTGACTGTAGCCTTTAAATCAGTTTATGTGAATGAGTTCCAGGAGCACTGTGGCCATCCTACCCCTCAGATGAGCCCTGCG
  5   1   2       bld Gas                            TGas062o20.p1cSP6                                                                                                                                                                                                                                                TGGCGTTGTATGAACGGCTGCAGAAGCTCTCCTGTCCATGTTTAGAGGGTGTGTATCTCACAGATCCTCAGAGTTACATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGATGTCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCTGTTCAAGAACAGTTATCATCTTTAAAGGAATCTCAAACAGACATTAAAGTAAAAGAAATTGCCAAGCTTTGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAAAGGACATGCCAGCCCTCTCAAACAGATCTCCTTTATAGAGCAGCTATTGGATGTCATCCAGTTTCCTGACATAATTTCAAATAATGTCACACTTGAATCGTTGTCTCACAGCACAGAAAAAAATATTGTAACCTGCATTCGAGAAAACGAAGAGTTTTTGAAAGAATTATTTTCCAGTCCTCATTTTTATGCCACCCTTAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTATTCTAACGGCTGAGGAATCTCTTCAGAAAAGGGCACCCCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAG
  5   1   2       bld TbA                            TTbA021i11.p1kSP6                                                                                                                                                                                                                                                                CAGAAGCTCTCCCGTCCACGTTTAGAGGGTGTGTATCTCACAGATCCTCAGAGTATACATGAGCCGCTCTGTACCCCATCAAGTCATCGTTTGGATGTCCTACAGTGGCTGTGCTCAAGAAATTTACCCTCCTGTTCAAGAAACAGTTATCATCTTTAAAGGAATCTCAAACAGACATTAAAGTAAAAGAAAATTGCCAAGCTTTGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAAAGGACATGCCAGCCCTCTCAAACAGATCTCCTTTATAGAGCAGCTATTGGAAGTCATCCAGTTTCCTGACATAATTTCAAATAATGTCACACTTGAATCGTTGTCTCACAGCACAGAAAAAAATATTGTAACCTGCATTCGAGAAAACGAAGAGTTTTTGAAAGAATTATTTTCCAGTCCTCATTTTTATGCCACCCTTAGCCCTGAGTGCAACCCCTGGCCTGGCAGACTTCAAACCTATTCTAACGGCTGAGGAATCTCTTCAGAAAAGGGCACCCCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAGAAGAGTGTGTGGATCTCTGCAGCTCTGTGGCTGATGGTGATAAAGTTATTCAGACTCTGAGGCTTGGCTTGACTGATTTCCATCAACTGACTGTAGCCTTTAATCAAGTTTATGTGAATG
  5   1   2       chi Egg       in                   TEgg014f17.p1kSP6                                                                                                                                                                                                                                                                      TGGCGGGTCGCATTACCAGCCATTGGCTTTCTGTGTTAGCTGCTTTTTTTCTAGGCGCCACCATGACGGGAGGAAAGGAGCTAGGGGCGGCTGTGGCGTTGTATGAACGGCTGCAGAATTTACCCTCCTGTTCAAGAACAGTTATCATCTTTAAAGGAATCTCAAACAGACATTAAAGTAAAAGAAATTGCCAAGCTTTGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAAAGGACATGCCAGCCCTCTCAAACAGATCTCCTTTATAGAGCAGCTATTGGATGTCATCCAGTTTCCTGACATAATTTCAAATAATGTCACACTTGAATCGTTGTCTCACAGCACAGAAAAAAATATTGTAACCTGCATTCGAGAAAACGAAGAGTTTTTGAAAGAATTATTTTCCAGTCCTCATTTTTATGCCACCCTTAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTATTCTAACGGCTGAGGAATCTCTTCAGAAAAGGGCACCCCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAGAAGAGTGTGTGGATCTCTGCAGCTCTGTGGCTGATGGTGATAAAGTTATTCAGACTCTGAG
  5   1   2       bld Mus1      in                         CABH4307.5p                                                                                                                                                                                                                                                                      AAGCTCTCCTGTCCATGTTTAGAGGGTGTGTATCTCACAGATCCTCAGAGTATACATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGATGTCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCTGTTCAAGAACAGTTATCATCTTTAAAGGAATCTCAAACAGACATTAAAGTAAAAGAAATTGCCAAGCTTTGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAAAGGACATGCCAGCCCTCTCAAACAGATCTCCTTTATAGAGCAGCTATTGGATGTCATCCAGTTTCCTGACATAATTTCAAATAATGTCACACTTGAATCGTTGTCTCACAGCACAGAAAAAAATATTGTAACCTGCATTCGAGAAAACGAAGAGTTTTTGAAAGAATTATTTTCCAGTCCTCATTTTTATGCCACCCTTAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTATTCTAACGGCTGAGGAATCTCTTCAGAAAAGGGCACCCCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAGAAGAGTGTGTGGATCTCTGCAGCTCTGTGGCTGATGGTGATAAAGTTATTCAGACTCTGAGGCTGGCCTTGACTGATTTCCATCAACTGACTGTAGCCTTTAATCAAGTTTATGTGAATGAGTTCCAGGAGCACTGTGGCCATCCTACCCCTCAGATGAGCCCTGCGGGACCTTTTTTCCAATCTGTCCACCAGTCACTTAGCACCT
  5   1   2       bld Neu       in                  TNeu067h16.p1caSP6                                                                                                                                                                                                                                                                                                         TCCAGATCCTCAGAGTATACATGAGCTGCTCTGTGCCCCATGAAGTCATCGTTTGGATGTCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCTGTTCAAGAACAGTTATCATCTTTAAAGGAGTCTCAAACAGACATTAAAGTAAAAGAAATTGCCAAGCTTTGCTTTGACCTCATGCTTTGCCATTTTGATGAGCTGGGGCTAATTAAAGGACATGCCAGCCCTCTCAAACAGATCTCCTTTATAGAGCAGCTATTGGATGTCATCCAGTTTCCTGACATAATTTCAAATAATGTGACACTTGAATCGTTGTCTCACAGCACAGAAAAAAATATTGTAACCTGCATTCGAGAAAACGAAGAGTTTTTGAAAGAATTATTTTCCAGTCCTCATTTTTATGCCACCCTTAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTATTCTAACGGCTGAGGAATCTCTTCAAAAAAGGGCACCCCAACTAGCATGGGAAAAAATATGAGCAATTCTG
  5   1   2       bld Ova1      in                        CABE13403.5p                                                                                                                                                                                                                                                                                                              ATCCTCAGAGTATACATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGATGTCCTACAGTGGCTGTGCTCAAGAATTTACCCTCCTGTTCAAGAACAGTTATCATCTTTAAAGGAATCTCAAACAGACATTAAAGTAAAAGAAATTGCCAAGCTTTGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAAAGGACATGCCAGCCCTCTCAAACAGATCTCCTTTATAGAGCAGCTATTGGATGTCATCCAGTTTCCTGACATAATTTCAAATAATGTCACACTTGAATCGTTGTCTCACAGCACAGAAAAAAATATTGTAACCTGCATTCGAGAAAACGAAGAGTTTTTGAAAGAATTATTTTCCAGTCCTCATTTTTATGCCACCCTTAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTATTCTAACGGCTGAGGAATCTCTTCAGAAAAGGGCACCCCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAGAAGAGTGTGTGGATCTCTGCAGCTCTGTGGCTGATGGTGATAAAGTTATTCAGACTCTGAGGCTGGCCTTGACTGATTTCCATCAACTGACTGTAGCCTTTAATCAAGTTTATGTGAATGAGTTCCAGGAGCACTGTGGCCATCCTACCCCTCAGATGAGCCCTGCGGGACCTTTTTTCCAATCTGTCCACCAGTCACTTAGCACCTGCTGCAAGGAGCTTGAATCCATTGCCCAGTTTACAGAAACTTCTG
  3  -1   2       bld Gas0      in                         dad33b07.x1                                                                                                                                                                                                                                                                                                                                       CTGTACCCCATCAAGTCATCGTTTGGATGTCCTACAGTCATGGTGCTCAAGAATTTACCCTCCTGTTCAAGAACAGTTATCATCTTTAAAGGAATCTCAAACAGACATTAAAGTAAAAGAAATTGCCAAGCTTTGTTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAAAGGACATGCCAGCCCTCTCAAACAGATCTCCTTTATAGAGCAGCTATTGGATGTCATCCAGTTTCCTGAAATAAAAACAAATAATGTCACACTTGAATCGTTGTCTCACAGCACACAAAAAAATATTGTAACCTGCATTCGACAAAACGAAGAGTTTTTGAAAGAATTATTTTCCACGCCTCATTTTTATGCCACCCTTAGTCCTGAGTGCAACCCCTGGCCTGCAGACTTTAAACCTATTCTA
  5   1   2       chi Tad5                                  XZT9072.5p                                                                                                                                                                                                                                                                                                                                                                                      GAGCTAGGGGCGGCTGTGGCGTTGTATGAGCGGCTGCAGAAGCTCTCCTGTCCATGTTTAGAGGGTGTGTATCTCACAGATCCTCAGAGTATACATGAGCTGCTCTGTACCCCATCAAGTCATCGTTTGGATGTCCTACAGTGGCTGTGCTCAAACAGATCTCCTTTATAGAGCAGCTATTGGATGTCATCCAGTTTCCTGACATAATTTCAAATAATGTCACACTTGAATCGTTGTCTCACAGCACAGAAAAAAATATTGTAACCTGCATTCGAGAAAACGAAGAGTTTTTGAAAGAATTATTTTCCAGTCCTCATTTTTATTCCACCCTTAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTATTCTAACGGCTGAGGAATCTCTTCAGAAAAGGGCACCCCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAGAAGAGTGTGTGGATCTCTGCAGCTCTGTGGCTGATGGTGATAAAGTTATTCAGACTCTGAGGCTGGCCTTGACTGATTTCCATCAACTGACTGTAGCCTTTAATCAAGTTTATGTGAATGAGTTCCAGGAGCACTGTGGCCATCCTACCCCTCAGATGAGCCCTGCGGGACCTTTTTTCCAATCTGTCCACCAGTCACTTAGCACCTGCTGCAAGGAGCTTGAATCCATTGCCCAGTTTACAGAAACTTCTGAGAAAATTGTAAATGTGGTGAATGAGAGGTATCAGTCTAAGGAGAAATGGTCAGGAAGCTCTATTTTCACACTGTATGAGAAAATGAGGAACTGAGACAGAGCTATGAAGCATTTC
  5   1   2       bld Gas                            TGas037m22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                  CTCCTGTTCAANAACAGTTATCATCTTTAAAGGAATCTCAAACAGACATTAAAGTAAAAGAAATTGCCAAGCTTTGCTTTGACCTCATGCTTTGCCATTTTGATGACCTGGATCTAATTAAAGGACATGCCAGCCCTCTCAAACAGATCTCCTTTATAGAGCAGCTATTGGATGTCATCCAGTTTCCTGACATAATTTCAAATAATGTCACACTTGAATCGTTGTCTCACAGCACAGAAAAAAATATTGTAACCTGCATTCGAGAAAACGAAGAGTTTTTGAAAGAATTATTTTCCAGTCCTCATTTTTATGCCACCCTTAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTATTCTAACGGCTGAGGAATCTCTTCAGAAAAGGGCACCCCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAGAAGAGTGTGTGGATCTCTGCAGCCCTGTGGCTGATGGTGATAAAGTTATTCAGACTCTGAGGCTGGCCTTGACTGATTTCCATCAACTGACTGTAGCCTTTAATCAAGTTTATGTGAATGAGTTCCAGGAGCACTGTGGCCATCCTACCCCTCAGATGAGCCCTGCGGGACCTTTTTTCCAATCTGTCCACCAGTCACTTAGCACCTGCTGC
  5   1   0       add Tad5                                 XZT32928.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACAGATCTCCTTTATAGAGCAGCTATTGGATGTCATCCAGTTTCCTGACATAATTTCAAATAATGTCACACTTGAATCGTTGTCTCACAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTATTCTAACGGCTGAGGAATCTCTTCAGAAAAGACTCAGACTGCGAGGAGGATGGACCATCTTCTGCTACCCCAGAAGTATCTAAAAGATTGCTGAGAGAGATGATGCAGACGTTAGAAATTAAGGATGAGACGGTGGCCCTGTCTAAGGCAGGTAAACTATTGGGAATTCAAAAGAAATATAAATTGTCATTCCCGATCTTTAATTCTCTCACCCAAGGGATTGAAACTGAGTGGACTCACCCGGAGCGTCGTATCGCGCTCACACAGAGATTCTTCAAAACTTATCCTGTACCTGAAGAACACCAGAAGTGGGACAAAGCTCTGAAGGCAGATTTGGCAGATGCCTGACTATCCCGACAAACGGCACTATCGGCCGAAGAGGCTGCATTCAAGGACCTATTAGTTCACCAAATGGAATCCTTGCTCAAACGGTCCTACACAGGAATACTCAGACCCATGGCTGCTTCAGCAGGCCTAGCCTGCACAGCCAGACACTGGGCACAGGAATTGGCCAGCCATCCACCATCAGTTAGGCAACAACTGCAGGCAGAGTTTGCAAAACTGTCTACCACCTTGTCCTTCCTTATAGAGGCTGCAAAGGAAATTGCCAAACTGGCAGCCAGAACAACTGCCAATGCAGCTGTGGTGCGCAGAGCCTTGTGGCTAAGACATTGGATGGGAAGAAACCC
  5   1   2       bld Int1      in                        CAAP12410.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGAGGAAAAAAATATTGTAACCTGCATTCGAGAAAACGAAGAGTTTTTGAAAGAATTATTTTCCAGTCCTCATTTTTATGCCACCCTTAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTATTCTAACGGCTGAGGAATCTCTTCAGAAAAGGGCACCCCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAGAAGAGTGTGTGGATCTCTGCAGCTCTGTGGCTGATGGTGATAAAGTTATTCAGACTCTGAGGCTGGCCTTGACTGATTTCCATCAACTGACTGTAGCCTTTAATCAAGTTTATGTGAATGAGTTCCAGGAGCACTGTGGCCATCCTACCCCTCAGATGAGCCCTGCGGGACCTTTTTTCCAATCTGTCCACCAGTCACTTAGCACCTGCTGCAAGGAGCTTGAATCCATTGCCCAGTTTACAGAAACTTCTGAGAAAATTGTAAATGTGGTGAATGAGAGGTATCAGTCTAAGGAGAAATGGTCAGGAAGCTCTATTTCCACACTGTATGAGAAAATGAAGGAACTGAGACAGAGCTATGAGGCATTTCAACAAAGTTCATTGCAGGACTGAAGAACTATGAGCCATTGGAACTTCCATGCTACCACAAAAACCATGTATTTTAAAAATGACGGTTGGAATAAAAGCATGCTACCTACTACCCCTTTTCATATTGCATTAGAGGGTGGAAAAGGCATCTACCANAAACTTTGTTCATCCAGGATAATCCTATATGAA
  3   1   2      seed Int1      in                        CAAP12410.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGTTTTTGAAAGAATTATTTTCCAGTCCTCATTTTTATGCCACCTTTAGCCCTGAGTGCAACCCCTGGCCTGCAGACTTCAAACCTATTCTAACGGCTGAGGAATCTCTTCAGAAAAGGGCACCCCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAGAAGAGTGTGTGGATCTCTGCAGCTCTGTGGCTGATGGTGATAAAGTTATTCAGACTCTGAGGCTGGCCTTGACTGATTTCCATCAACTGACTGTAGCCTTTAATCAAGTTTATGTGAATGAGTTCCAGGAGCACTGTGGCCATCCTACCCCTCAGATGAGCCCTGCGGGACCTTTTTTCCAATCTGTCCACCAGTCACTTAGCACCTGCTGCAAGGAGCTTGAATCCATTGCCCAGTTTACAGAAACTTCTGAGAAAATTGTAAATGTGGTGAATGAGAGGTATCAGTCTAAGGAGAAATGGTCAGGAAGCTCTATTTCCACACTGTATGAGAAAATGAAGGAACTGAGACAGAGCTATGAGGCATTTCAACAAAGTTCATTGCAGGACTGAAGAACTATGAGCCATTGGAACTTCCATGCTACCACAAAAACCATGTATTTTAAAAATGACGGTTGGAATAAAAGCATGCTACCTACTACCCCTTTTCATATTGCATTAGAGGGTGGAAAAGGCATCTACCAAAAACTTTGTTCATCCAGGATAATCCTATATGAAGAAAACACATCCATTTTACATTGATACCGTTTTGTCTGCTGGATTAATAGACATTTCGACTGTAGGATAACAAACATAACCATTTTAAGGATGCTACTTTAA
  3   1   2       bld Mus1      in                         CABH4307.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCATTTTTATGCCACCCTTAGCCCTGAGTGCAACNCCTGGCCTGCAGACTTCAAACCTATTCTAACGGCTGAGGAATCTCTTCAGAAAAGGGCACCCCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAGAAGAGTGTGTGGATCTCTGCAGCTCTGTGGCTGATGGTGATAAAGTTATTCAGACTCTGAGGCTGGCCTTGACTGATTTCCATCAACTGACTGTAGCCTTTAATCAAGTTTATGTGAATGAGTTCCAGGAGCACTGTGGCCATCCTACCCCTCAGATGAGCCCTGCGGGACCTTTTTTCCAATCTGTCCACCAGTCACTTAGCACCTGCTGCAAGGAGCTTGAATCCATTGCCCAGTTTACAGAAACTTCTGAGAAAATTGTAAATGTGGTGAATGAGAGGTATCAGTCTAAGGAGAAATGGTCAGGAAGCTCTATTTCCACACTGTATGAGAAAATGAAGGAACTGAGACAGAGCTATGAGGCATTTCAACAAAGTTCATTGCAGGACTGAAGAACTATGAGCCATTGGAACTTCCATGCTACCACAAAAACCATGTATTTTAAAAATGACTGTTGGAATAAAAGCATGCTACCTACTACCCCTTTTCATATTGCATTAGAGGGTGGAAAAGGCATCTACCAAAAACTTTGTTCATCCAGGATAATCCTATATGAAGAAAACACATCCATTTTACATTGATACCGTTTTGTCTGCTGGATTAATAGACATTTCGACTGTAGGATAACAAACATAACCATTTTAAGGATGCTACTTTTAA
  3   1   2       bld AbdN      in                       IMAGE:6998258                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCATGTTATGCAACGTNAGCCTGATGCATNCCCTGGCATGCAGACTTCATACNTATTCTACAGGCTGAAGAATATCCTCAGAGAAGGGCACCCCAGACTAGCATGTGAAAAGATATGAGCAATTCTGTAGAAGCTTTACAGGAAATATCTTTATCGCTAGAAGCATTAAAAGAAGAGTGTGTGGATCTCTGCAGCTCTGTGGCTGATGGTGATAAAGTTATTCAGACTCTGAGGCTGGCCTTGACTGATTTCCATCAACTGACTGTAGCCTTTAATCAAGTTTATGTGAATGAGTTCCAGGAGCACTGTGGCCATCCTACCCCTCAGATGAGCCCTGCGGGACCTTTTTTCCAATCTGTCCACCAGTCACTTAGCACTTGCTGCAAGGAGCTTGAATCCATTGCCCAGTTTACAGAAACTTCTGAGAAAATTGTAAATGTGGTGAATGAGAGGTATCAGTCTAAGGAGAAATGGTCAGGAAGCTCTATTTCCACACTGTATGAGAAAATGAAGGAACTGAGACAGAGCTATGAGGCATTTCAACAAAGTTCATTGCAGGACTGAAGAACTATGAGCCATTGGAACTTCCATGCTACCACAAAAACCATGTATTTTAAAAATGACTGTTGGAATAAAAGCATGCTACCTACTACCCCTTTTCATATTGCATTAGAGGGTGGAAAAGGCATCTACCAAAAACTTTGTTCATCCAGAGATAATCCATATATGAAGAGAAACACTATCCCATTTTACATCTGATACCAGTTTTGTCTGCTGGATTAATAGCTA
  3   1   2       bld Ovi1      in                         CABI7111.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCCTGCAGACTTCAAACCTATTCTAACGGCTGAGGAATCTCTTCAGAAAAGGGCACCCCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAGAAGAGTGTGTGGATCTCTGCAGCTCTGTGGCTGATGGTGATAAAGTTATTCAGACTCTGAGGCTGGCCTTGACTGATTTCCATCAACTGACTGTAGCCTTTAATCAAGTTTATGTGAATGAGTTCCAGGAGCACTGTGGCCATCCTACCCCTCAGATGAGCCCTGCGGGACCTTTTTTCCAATCTGTCCACCAGTCACTTAGCACCTGCTGCAAGGAGCTTGAATCCATTGCCCAGTTTACAGAAACTTCTGAGAAAATTGTAAATGTGGTGAATGAGAGGTATCAGTCTAAGGAGAAATGGTCAGGAAGCTCTATTTCCACACTGTATGAGAAAATGAAGGAACTGAGACAGAGCTATGAGGCATTTCAACAAAGTTCATTGCAGGACTGAAGAACTATGAGCCATTGGAACTTCCATGCTACCACAAAAACCATGTATTTTAAAAATGACGGTTGGAATAAAAGCATGCTACCTACTACCCCTTTTCATATTGCATTAGAGGGTGGAAAAGGCATCTACCAAAAACTTTGTTCATCCAGGATAATCCTATATGAAGAAAACACATCCATTTTACATTGATACCGTTTTGTCTGCTGGATTAATAGACATTTCGACTGTAGGATAACAAACATAACCATTTTAAGGATGCTACTTTTAAAACACCAAGTAATAAACAAGACCCATTGCTGTTAAAAAAAAAAAA
  3   1   2       bld Gas                             TGas118p10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAAAAGGGCACCCCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAGAAGAGTGTGTGGATCTCTGCAGCTCTGTGGCTGATGGTGATAAAGTTATTCAGACTCTGAGGCTGGCCTTGACTGATTTCCATCAACTGACTGTAGCCTTTAATCAAGTTTATGTGAATGAGTTCCAGGAGCACTGTGGCCATCCTACCCCTCAGATGAGCCCTGCGGGACCTTTTTTCCAATCTGTCCACCAGTCACTTAGCACCTGCTGCAAGGAGCTTGAATCCATTGCCCAGTTTACAGAAACTTCTGAGAAAATTGTAAATGTGGTGAATGAGAGGTATCAGTCTAAGGAGAAATGGTCAGGAAGCTCTATTTCCACACTGTATGAGAAAATGAAGGAACTGAGACAGAGCTATGAGGCATTTCAACAAAGTTCATTGCAGGACTGAAGAACTATGAGCCATTGGAACTTCCATGCTACCACAAAAACCATGTATTTTAAAAATGACGGTTGGAATAAAAGCATGCTACCTACTACCCCTTTTCATATTGCATTAGAGGGTGGAAAAGGCATCTACCAAAAACTTTGTTCATCCAGGATAATCCTATATGAAGAAAACACATCCATTTTACATTGATACCGTTTTGTCTGCTGGATTAATAGACATTTCGACTGTAGGATAACAAACATAACCATTTTAAGGATGCTACTTTTAAAACACCAAGTAATAAACCAAGACCCCATTGCTGTTAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu067h16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAAAAGGGCACCCCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAGAAGAGTGTGTGGATCTCTGCAGCTCTGTGGCTGATGGTGATAAAGTTATTCAGACTCTGAGGCTGGCCTTGACTGATTTCCATCAACTGACTGTAGCCTTTAATCAAGTTTATGTGAATGAGTTCCAGGAGCACTGTGGCCATCCTACCCCTCAGATGAGCCCTGCGGGACCTTTTTTCCAATCTGTCCACCAGTCACTTAGCACCTGCTGCAAGGAGCTTGAATCCATTGCCCAGTTTACAGAAACTTCTGAGAAAATTGTAAATGTGGTGAATGAGAGGTATCAGTCTAAGGAGAAATGGTCAGGAAGCTCTATTTCCACACTGTATGAGAAAATGAAGGAACTGAGACAGAGCTATGAGGCATTTCAACAAAGTTCATTGCAGGACTGAAGAACTATGAGCCATTGGAACTTCCATGCTACCACAAAAACCATGTATTTTAAAAATGACGGTTGGAATAAAAGCATGCTACCTACTACCCCTTTTCATATTGCATTAGAGGGTGGAAAAGGCATCTACCAAAAACTTTGTTCATCCAGGATAATCCTATATGAAGAAAACACATCCATTTTACATTGATACCGTTTTGTCTGCTGGATTAATAGACATTTCGACTGTAGGATAACAAACATAACCATTTTAAGGATGCTACTTTTAAACACCAAGTAATAAACAAGACCCATTGCTGTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                        CABE13403.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAAAAGGGCACCCCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGAAATTTCTTTATCGCTAGAAGCATTAAAAGAAGAGTGTGTGGATCTCTGCAGCTCTGTGGCTGATGGTGATAAAGTTATTCAGACTCTGAGGCTGGCCTTGACTGATTTCCATCAACTGACTGTAGCCTTTAATCAAGTTTATGTGAATGAGTTCCAGGAGCACTGTGGCCATCCTACCCCTCAGATGAGCCCTGCGGGACCTTTTTTCCAATCTGTCCACCAGTCACTTAGCACCTGCTGCAAGGAGCTTGAATCCATTGCCCAGTTTACAGAAACTTCTGAGAAAATTGTAAATGTGGTGAATGAGAGGTATCAGTCTAAGGAGAAATGGTCAGGAAGCTCTATTTCCACACTGTATGAGAAAATGAAGGAACTGAGACAGAGCTATGAGGCATTTCAACAAAGTTCATTGCAGGACTGAAGAACTATGAGCCATTGGAACTTCCATGCTACCACAAAAACCATGTATTTTAAAAATGACTGTTGGAATAAAAGCATGCTACCTACTACCCCTTTTCATATTGCATTAGAGGGTGGAAAAGGCATCTACCAAAAACTTTGTTCATCCAGGATAATCCTATATGAAGAAAACACATCCATTTTACATTGATACCGTTTTGTCTGCTGGATTAATAGACATTTCGACTGTAGGATAACAAACATAACCATTTTAAGGATGCTACTTTTAAAACACCAAGTAATAAACAAGACCCATTGCTGTT
  3   1   2       bld Gas7      in                         XZG54391.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAGACTAGCATGGGAAAAAATATGAGCAATTCTGTAGAAGCTTTACAGGGAATTTCTTTATCGCTAGAAGCATTAAAAGAAGAGTGTGTGGATCTCTGCAGCTCTGTGGCTGATGGTGATAAAGTTATTCAGACTCTGAGGCTGGCCTTGACTGATTTCCATCAACTGACTGTAGCCTTTAATCAAGTTTATGTGAATGAGTTCCAGGAGCACTGTGGCCATCCTACCCCTCAGATGAGCCCTGCGGGACCTTTTTTCCAATCTGTCCACCAGTCACTTAGCACCTGCTGCAAGGAGCTTGAATCCATTGCCCAGTTTACAGAAACTTCTGAGAAAATTGTAAATGTGGTGAATGAGAGGTATCAGTCTAAGGAGAAATGGTCAGGAAGCTCTATTTCCACACTGTATGAGAAAATGAAGGAACTGAGACAGAGCTATGAGGCATTTCAACAAAGTTCATTGCAGGACTGAAGAACTATGAGCCATTGGAACTTCCATGCTACCACAAAAACCATGTATTTTAAAAATGACTGTTGGAATAAAAGCATGCTACCTACTACCCCTTTTCATATTGCATTAGAGGGTGGAAAAGGCATCTACCAAAAACTTTGTTCATCCAGGATAATCCTATATGAAGAAAACACATCCATTTTACATTGATACCGTTTTGTCTGCTGGATTAATAGACATTTCGACTGTAGGATAACAAACATAACCATTTTAAGGATGCTACTTTTAAAACACCAAGTAATAAACAAGACCCATTGCTGTT
  5   1   2       bld Gas       in                   TGas142f07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAATATGAGCAACTCTGTAGAAGCCTTACAGGAAATTTCTTTATTCGCTTAGAAGCATTAAAAGAAGAGTGTGTGGATCTCTGCAGCCCTGTGGCTGATGGTGATAAAGTTATTCAGACTCTGAGGCTGGCCTTGACTGATTTCCATCAACTTGACTTGTAGCCTTTAATCAAGTTTATGTGAATGAGTTCCAGGAGCACTGTGGCCATCCTACCCCTCAGATGAGCCCTGCGGGACCTTTTTTCCAATCTGTCCACCAGTCACTTAGCACCTGCTGCAAGGAGCTTGAATCCATTGCCCAGTTTACAGAAACTTCTGAGAAAATTGTAAATGTGGTGAATGAGAGGTATCAGTCTAAGGAGAAATGGTCAGGAAGCTCTATTTCCACACTGTATGAGAAAATGAAGGAACTGAGACAGAGCTACGAGGCATTTTCAACAAAGTTCATTGCAGGACTGAAGAACTATGAGCCATTGGAACTTCCATGCTACCACAAAAACCATGTATTTTAAAAATGACTGTTGGAATAAAAGCACGCTACCTACCTACTACCCCTTTTCATATTGCATTAGAGGGTGGAAAAGGCATCTACCAAAAACTTTGTTCATCCAGGATAATCCTATATGAAGAAACACATCCATTTTACATTTGATACCGTTTTTGTCTGCTGGAT
  3   1   2       bld Egg       in                    TEgg014f17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGATGGTGATAAAGTTATTCAGACTCTGAGGCTGGCCTTGACTGATTTCCATCAACTGACTGTAGCCTTTAATCAAGTTTATGTGAATGAGTTCCAGGAGCACTGTGGCCATCCTACCCCTCAGATGAGCCCTGCGGGACCTTTTTTCCAATCTGTCCACCAGTCACTTAGCACCTGCTGCAAGGAGCTTGAATCCATTGCCCAGTTTACAGAAACTTCTGAGAAAATTGTAAATGTGGTGAATGAGAGGTATCAGTCTAAGGAGAAATGGTCAGGAAGCTCTATTTCCACACTGTATGAGAAAATGAAGGAACTGAGACAGAGCTATGAGGCATTTCAACAAAGTTCATTGCAGGACTGAAGAACTATGAGCCATTGGAACTTCCATGCTACCACAAAAACCATGTATTTTAAAAATGACGGTTGGAATAAAAGCATGCTACCTACTACCCCTTTTCATATTGCATTAGAGGGTGGAAAAGGCATCTACCAAAAACTTTGTTCATCCAGGATAATCCTATATGAAGAAAACACATCCATTTTACATTGATACCGTTTTGTCTGCTGGATTAATAGACATTTCGACTGTAGGATAACAAACATAACCATTTTAAGGATGCTACTTTTAAAACACCAAGTAATAAACAAGACCCATTGCTGTTAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Gas0      in                         dad33b07.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACTGATTTCCATCAACTGACTGTAGCCTTTAATCAAGTTTATGTGAATGAGTTCCAGGAGCACTGTGGCCATCCTACCCCTCAGATGAGCCCTGCGGGACCTTTTTTCCAATCTGTCCACCAGTCACTTAGCACCTGCTGCAAGGAGCTTGAATCCATTGCCCAGTTTACAGAAACTTCTGAGAAAATTGTAAATGTGGTGAATGAGAGGTATCAGTCTAAGGAGAAATGGTCAGGAAGCTCTATTTCCACACTGTATGAGAAAATGAAGGAACTGAGACAGAGCTATGAGGCATTTCAACAAAGTTCATTGCAGGACTGAAGAACTATGAGCCATTGGAACTTCCATGCTACCACAAAAACCATGTATTTTAAAAATGACGGTTGGAATAAAAGCATGCTACCTACTACCCCTTTTCATATTGCATTAGAGGGTGGAAAAGGCATCTACCAAAAACTTTGTTCATCCAGGATAATCCTATATGAAGAAAACACATCCATTTTACATTGATACCGTTTTGTCTGCTGGATTAATAGACATTTCGACTGTAGGATAACAAACATAACCATTTTAAGGATGCACTTTTAAAACCCCGGG
  5   1   2       chi Gas                            TGas099d05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAATGAGTTCCAGGAGCACTGTGGCCATCCTACCCCTCAGATGAGCCCTGCGGGACCTTTTTTCCAATCTGTCCACCAGTCACTTAGCACCTGCTGCAAGGAGCTTGAATCCATTGCCCAGTTTACAGAAACTTCTGAGAAAATTGTAAATGTGGTGAATGAGAGGTATCAGTCTAAGGAGAAATGGTCAGGAAGCTCTATTTCCACACTGTGTGAGTAACCTATCCCTGACTAATTTATTCCTCAACATTTTCTTATGAAGTATGCCTTCTGGTTTAATGTGGATGATGTTTACACTTTAATGCACTTTGAGGGGGACTTTTTATTTATCTAGCAAAACAACATATTTTTAATTTGAGGAACAAATAATATAAAATTATTTTATATGCATTAAAATGGAGTAGATTTTGAAAAAATCTTCCAAGCATGCCAGTACCAGATGTGCAGTTTATGGTGATCCCTGACTTGTATAAAGGAACATCCTATGTTAATATGACAGACTGCCAGCAAGCTGCACACCGTTAACAGAGGATGATACCTGGGTGCTCCTGCAAGCCAGCTTTATAAGTGTGTGTATTATGGTGCGGTGTTGGAGTCCCTGATGAAAG
  5   1   2       bld Ova1      in                         CABE4760.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCAGATGAGCCCTGCGGGACCTTTTTTCCAATCTGTCCACCAGTCACTTAGCACCTGCTGCAAGGAGCTTGAATCCATTGCCCAGTTTACAGAAACTTCTGAGAAAATTGTAAATGTGGTGAATGAGAGGTATCAGTCTAAGGAGAAATGGTCAGGAAGCTCTATTTCCACACTGTATGAGAAAATGAAGGAACTGAGACAGAGCTATGAGGCATTTCAACAAAGTTCATTGCAGGACTGAAGAACTATGAGCCATTGGAACTTCCATGCTACCACAAAAACCATGTATTTTAAAAATGACTGTTGGAATAAAAGCATGCTACCTACTACCCCTTTTCATATTGCATTAGAGGGTGGAAAAGGCATCTACCAAAAACTTTGTTCATCCAGGATAATCCTATATGAAGAAAACACATCCATTTTACATTGATACCGTTTTGTCTGCTGGATTAATAGACATTTCGACTGTAGGATAACAAACATAACCATTTTAAGGATGCTACTTTTAAAACACCAAGTAATAAACAAGACCCATTGCTGTTAAATACTGGCGGCTACTTTTGTACAGGTGAACAGTAACTGTTTTATAAAGCATTTCTGATCTTAGATGCTAGCTATGCTGTTATTAAGAAGATATGAGATTGCTCTTGGCAAAATATTTAGTGCCTACTTATCTATTTCATGCTAACTGATTCAGACAGGTGTGTGCTTGCCTGTGGCAATAAACAGGCCAGCAATACAATTTCAAAAATAAGAACAAACAGCCAAAAGTATAAATTTATTGCAATTCACACGTTTACGGCCTCACAGGCCCTTTTTCGTGTTTGTATCGGGCAGTGTAT
  5   1   2       bld Tbd1      in                        CBXT17617.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCCCTGCGGGGACCTTTTTTCCAATCTGTCCACCAGTCACTTAGCACCTGCTGCAAGGAGCTTGAATCCATTGCCCAGTTTACAGAAACTTCTGAGAAAATTGTAAATGTGGTGAATGAGAGGTATCAGTCTAAGGAGAAATGGTCAGGAAGCTCTATTTCCACACTGTATGAGAAAATGAAGGAACTGAGACAGAGCTATGAGGCATTTCAACAAAGTTCATTGCAGGACTGAAGAACTATGAGCCATTGGAACTTCCATGCTACCACAAAAACCATGTATTTTAAAAATGACGGTTGGAATAAAAGCATGCTACCTACTACCCCTTTTCATATTGCATTAGAGGGTGGAAAAGGCATCTACCAAAAACTTTGTTCATCCAGGATAATCCTATATGAAGAAAACACATCCATTTTACATTGATACCGTTTTGTCTGCTGGATTAATAGACATTTCGACTGTAGGATAACAAACATAACCATTTTAAGGGATGCTACTTTTAAAACACCAAGTAATAAACAAGACCCATTGCTGTTAAATACTGGCGGCTACTTTGTGTACAGGTGAACAGTAACTGTTTTATAAAGCATTTCTGATCTTAGATGCTAGCTATGCTGTTATTAAGAAGATATGAGATTGCTCTTGGGCAAAATATTTAGTGGCCTACTTATCTATTTCATGCTAACTGATTCAGACGAGGTGTGTGCTTGCCTGTGGCAATAAACAGGCCAGCAATACAACTTCAAAAATAAGAACAAACA
  5   1   2       bld Gas7      in                         XZG15039.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGAGAGGTATCAGTCTAAGGAGAAATGGTCAGGAAGCTCTATTTCCACACTGTATGAGAAAATGAAGGAACTGAGACAGAGCTATGAGGCATTTCAACAAAGTTCATTGCAGGACTGAAGAACTATGAGCCATTGGAACTTCCATGCTACCACAAAAACCATGTATTTTAAAAATGACGGTTGGAATAAAAGCATGCTACCTACTACCCCTTTTCATATTGCATTAGAGGGTGGAAAAGGCATCTACCAAAAACTTTGTTCATCCAGGATAATCCTATATGAAGAAAACACATCCATTTTACATTGATACCGTTTTGTCTGCTGGATTAATAGACATTTCGACTGTAGGATAACAAACATAACCATTTTAAGGATGCTACTTTTAAAACACCAAGTAATAAACAAGACCCATTGCTGTTAAATACTGGCGGCTACTTTTGTACAGGTGAACAGTAACTGTTTTATAAAGCATTTCTGATCTTAGATGCTAGCTATGCTGTTATTAAGAAGATATGAGATTGCTCTTGGCAAAATATTTAGTGCCTACTTATCTATTTCATGCTAACTGATTCAGACAGGTGTGTGCTTGCCTGTGGCAATAAACAGGCCAGCAATACAATTTCAAAAATAAGAACAAACAGCCAAAAGTATAAATTTATTGCAATTCACACGTTTACGGCCTCACAGGCCCTTTTTCACGTTTGTATCGAACAGTGTATTCGTTGAGCTTTGNGTGAC
  5   1   2       bld Ova1      in                         CABE6128.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAACTTCCATGCTACCACAAAAACCATGTATTTTAAAAATGACGGTTGGAATAAAAGCATGCTACCTACTACCCCTTTTCATATTGCATTAGAGGGTGGAAAAGGCATCTACCAAAAACTTTGTTCATCCAGGATAATCCTATATGAAGAAAACACATCCATTTTACATTGATACCGTTTTGTCTGCTGGATTAATAGACATTTCGACTGTAGGATAACAAACATAACCATTTTAAGGATGCTACTTTTAAAACACCAAGTAATAAACAAGACCCATTGCTGTTAAATACTGGCGGCTACTTTTGTACAGGTGAACAGTAACTGTTTTATAAAGCATTTCTGATCTTAGATGCTAGCTATGCTGTTATTAAGAAGATATGAGATTGCTCTTGGCAAAATATTTAGTGCCTACTTATCTATTTCATGCTAACTGATTCAGACAGGTGTGTGCTTGCCTGTGGCAATAAACAGGCCAGCAATACAATTTCAAAAATAAGAACAAACAGCCAAAAGTATAAATTTATTGCAATTCACACGTTTACGGCCTCACAGGCCCTTTTTCACGTTTGTATCGAACAGTGTATTCGTTAGGCTTTGGGTAACCACCCGTGGTGGTGTCTCCATGTATTTCCAGCAATTGGGTAAGAATTGATAATGTTCTTAGTGTAATTGTACTTTACAATTGGGCAGCATATTATATACCAGTCTGTCATTTGTAACTTTTATCAGGTAGGCCCCAGCGAA
  5   1   2       bld Te1       in                        CBWN10898.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTAAATACTGGCGGCTACTTTTGTACAGGTGAACAGTAACTGTTTTATAAAGCATTTCTGATCTTAGATGCTAGCTATGCTGTTATTAAGAAGATATGAGATTGCTCTTGGCAAAATATTTAGTGCCTACTTATCTATTTCATGCTAACTGATTCAGACAGGTGTGTGCTTGCCTGTGGCAATAAACAGGCCAGCAATACAATTTCAAAAATAAGAACAAACAGCCAAAAGTATAAATTTATTGCAATTCACACGTTTACGGCCTCACAGGCCCTTTTTCACGTTTGTATCGAACAGTGTATTCGTTAAGCTTTAAGTAACCACCCGTGGTGGTGTCTCCATGTATTTCCAGCAATTGGGTAAGAATTGATAATGTTCTTAGTGTAATTGTACTTTACAATTGGGCAGCATATTATATACAGTCTGTCATTTGTAACTTTTATCAGGTAGGCCCCAGTGAATTGTAATGATCTAATGTTTTAAAAGTGAAAAATATGAAAATGGACTGTTTTTAATTATGAACGCTCACTCTGTGGATACTTAGGGTGAAGACACACACAGCTACTTGTCACAGCTACAAAATGTCAGAAAATACCCTGCCATAGACAGTACCGAGAATTGCCTCTGCTAAAACACACATAGAGACAATTATCAGTAAATGATCAGCATTGTCTAT
  3   1   2       bld Ovi1      in                        CABI13212.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTGTACAGGTGAACAGTAACTGTTTTATAAAGCATTTCTGATCTTAGATGCTAGCTATGCTGTTATAAGAAGATATGAGATTGCTCTTGGCAAAATATTTAGTGCCTACTTATCTATTTCATGCTAACTGATTCAGACAGGTGTGTGCTTGCCTGTGGCAATAAACAGGCCAGCAATACAATTTCAAAAATAAGAACAAACAGCCAAAAGTATAAATTTATTGCAATTCACACGTTTACGGCCTCACAGGCCCTTTTTCACGTTTGTATCGAACAGTGTATTCGTTAAGCTTTGGGTGACCACCCGTGGTGGTGTCTCCATGTATTTCCAGCAATTGGGTAAGAATTGATAATGTTCTTAGTGTAATTGTACTTTACAATTGGGCAGCATATTATATACAGTCTGTCATTTGTAACTTTTATCAGGTAGGCCCCAGTGAATTGTAATGATCTAATGTTTTAAAAGTGAAAAATATGAAAATGGACTGTTTTTAATTATGAACGCTCACTCTGTGGATACTTAGGGTGAAGACGCACACAGCTGCTTGTCACAGCTACAAAATGTcagagaatgccctgccgtggacagtgccgaggattgcctctgctgaagcacacatggagacaattgtcagtggatgatcagcgttgtctatttttgtatctgtgacaagtagctgatactggtagctctgtgtgtctTTACCATTAGTGGACTATATGTTTAGACCAATTGGTCAATACAGCACTTCTGTTCTGTTTATTTAATTGGTGTGTGGAGGTAAGGAGACACACCCCGGATGGTCACTTAGAGCTTGGCTCACGCACTGTTCGGTACACACTTGAAAAAGAGCTAGCTCAAAACATGTTGTGTGGATACCACTACATTTGCACTTTTGAAAGTAAACCTGCATTG
  3   1   2       bld Ova1      in                         CABE6128.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATGCTAGCTATGCTGTTATTAAGAAGATATGAGATTGCTCTTGGCAAAATATTTAGTGCCTACTTATCTATTCNATGCTAACTGATTCAGACAGGTGTGTGCTGNCCTGTGGCAATAAACAGGCCAGCAATACAATTTCAAAAATAAGAACAAACAGCCAAAAGTATAAATTTATTGCAATTCACACGTTTACGGCCTCACAGGCCCTTTTTCACGTTTGTATCGAACAGTGTATTCGTTAGGCTTTGGGTAACCACCCGTGGTGGTGTCTCCATGTATTTCCAGCAATTGGGTAAGAATTGATAATGTTCTTAGTGTAATTGTACTTTACAATTGGGCAGCATATTATATACAGTCTGTCATTTGTAACTTTTATCAGGTAGGCCCCAGTGAATTGTAATGATCTAATGTTTTAAAAGTGAAAAATATGAAAATGGACTGTTTTTAATTATGAACGCTCACTCTGTGGATACTTAGGGTGAAGACGCACACAGCTGCTTGTCACGGCTACAAAATGTcagaaaataccctgccatggacggtaccgggaattgcctctgctagagcacacatggggacaattgtcagtaggtgatcggcattgtctatttttgtatctgtgacaagtggctgatactagtagctctgtgtgtctTTACCATTAGTGGACTATATGTTTAGACCAATTGGTCAATACAGCACTTCTGTTCTGTTTATTTAATTGGTGTGTGGAGGTAAGGAGACACACCCCGGATGGTCACTTAGGGCTTGGCTCACGCACTGTTCGGTACACACTTGAAAAAGAGCTAGCTCAAAACATGTTGTGTGGATACCACTACATTTGCACTTTTGAAAGTAAACCTGCATTTGAA
  3   1   2       bld Gas       in                    TGas142f07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATGCTAGCTATGCTGTTATTAAGAAGATATGAGATTGCTCTTGGCAAAATATTTAGTGCTACTTATCTATTTCATGCTAACTGATTCAGACAGGTGTGTGCTTGCCTGTGGCAATAAACAGGCCAGCAATACAATTTCAAAAATAAGAACAAACAGCCAAAAGTATAAATTTATTGCAATTCACACGTTTACGGCCTCACAGGCCCTTTTTCACGTTTGTATCGAGCAGTGTATTCGTTAAGCTTTGGGTGACCACCCGTGGTGGTGTCTCCATGTATTTCCAGCAATTGGGTAAGAATTGATAATGTTCTTAGTGTAATTGTACTTTACAATTGGGCAGCATATTATATACAGTCTGTCATTTGTAACTTTTATCAGGTAGGCCCCAGTGAATTGTAATGATCTAATGTTTTAAAAGTGAAAAATATGAAAATGGACTGTTTTTAATTATGAACGCTCACTCTGTGGATACTTGGGGTGAAGACACACACAGCTGCTTGTCACGGCTACAAAATGTCAGAAGataccctgccatagacagtaccgagaattgcctctgctaaaacacacatagagacaattatcagtgggtgatcagcattgtctatttttgtatctgtgacaagtagctgatactagtagctctgtgtgtctTTACCATTAGTGGACTATATGTTTAGACCAATTGGTCAATACAGCACTTCTGTTCTGTTAATTTAATTGGTGTGTGGAGGTAAGGAGACACACCCCGGATGGTCACTTGGAGCTTGGCTCACGCACTGTTCGGTACACACTTGAAAAAGAGCTAGCTCAAAACATGTTGTGTGGATACCACTACATTTGCACTTTTGAAAGTAAACCTGCATTGAAAACCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                         CABE4760.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATTTAGTGCCTACTTATCTATTTCATGCTAACTGATTCAGACAGGTGTGTGCTTGCCTGTGGCAATAAACAGGCCAGCAATACAATTTCAAAAATAAGAACAAACAGCCAAAAGTATAAATTTATTGCAATTCACACGTTTACGGCCTCACAGGCCCTTTTTCGTGTTTGTATCGGGCAGTGTATTCATTGGGCTTTGGGTGACCGCCCGTGGTGGTGTCTCCATGTATTTCCAGCAATTGGGTAAGAATTGATAATGTTCTTAGTGTAATTGTACTTTACAATTGGGCAGCATATTATATACAGTCTGTCATTTGTAACTTTTATCAGGTAGGCCCCAGTGAATTGTAATGATCTAATGTTTTAAAAGTGAAAAATATGAAAATGGACTGTTTTTAATTATGAACGCTCACTCTGTGGATACTTAGGGTGAAGACACACACAGCTGCTTGTCGCGGCTACAAAATGTcagagaataccctgccatggacggtaccgagaattgcctctgctgaaacacacgtggagacaattatcggtggatgatcggcgttgtctattttTGTGTCTGTGGCAAGTGGCTGATACTGGTGGCTCTGTGTGTCTTTACCATTAGTGGACTATATGTTTAGACCAATTGGTCAATACAGCACTTCTGTTCTGTTTATTTAATTGGTGTGTGGAGGTAAGGAGACACGCCCCGGGTGGTCACTTGAAGCTTAGCTCACGCACTGTTCGGTACACACTTGAAAAAGAGCTAGCTCAAAACATGTTGTGTGGATACCACTACATTTGCACTTTTGAAAGTAAACCTGCATGGAAAACC
  3   1   2       bld Gas8      in                          st23i11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTATTTCATGCTAACTGATTCAGACAGGTGTGTGCTTGCCTGTGGCAATAAACAGGCCAGCAATACAATTTCAAAAATAAGAACAAACAGCCAAAAGTATAAATTTATTGCAATTCACACGTTTACGGCCTCACAGGCCCTTTTTCACGTTTGTATCGAACAGTGTATTCGTTAAGCTTTAAGTAACCACCCGTGGTGGTGTCTCCATGTATTTCCAGCAATTGGGTAAGAATTGATAATGTTCTTAGTGTAATTGTACTTTACAATTGGGCAGCATATTATATACAGTCTGTCATTTGTAACTTTTATCAGGTAGGCCCCAGTGAATTGTAATGATCTAATGTTTTAAAAGTGAAAAATATGAAAATGGACTGTTTTTAATTATGAACGCTCACTCTGTGGATACTTAGGGTGAAGACACACACAGCTACTTGTCACAGCTACAAAATGTCAGAAAATACCCTGCCATAGACAGTACCGAGAATTGCCTCTGCTAAAACACACATAGAGACAATTATCAGTAAATGATCAGCATTGTCTATTTTTGTATCTGTGACAAGTAGCTGATACTAGTAGCTCTGTGTGTCTTTACCATTAGTGGACTATATGTTTAGACCAATTGGTCAATACAGCACTTCTGTTCTGTTTATTTAATTGGTGTGTGGAGGTAAGGAGACACACCCCAGATAGTCACTTAAAGCTTAACTCACGCACTGTTCAGTACACACTTGAAAAAGAGCTAGCTCAAAACCATGTTGTGTGGATACC
  3   1   2       bld Tbd1      in                        CBXT17617.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTAACTGATCAGACAGGTGTGTGCTTGCCTGTGGCAATAAACAGGCCAGCAATACAATTTCAAAAATAAGAACAAACAGCCAAAAGTATAAATTTATTGCAATTCACACGTTTACGGCCTCACAGGCCCTTTTTCACGTTTGTATCGAACAGTGTATTCGTTAAGCTTTAAGTAACCACCCGTGGTGGTGTCTCCATGTATTTCCAGCAATTGGGTAAGAATTGATAATGTTCTTAGTGTAATTGTACTTTACAATTGGGCAGCATATTATATACAGTCTGTCATTTGTAACTTTTATCAGGTAGGCCCCAGTGAATTGTAATGATCTAATGTTTTAAAAGTGAAAAATATGAAAATGGACTGTTTTTGATTATGAACGCTCACTCTGTGGATACTTAGGGTGAAGACACACACAGCTACTTGTCACAGCTACAAAATGTCAGAAAATACCCCTGCCATAGACAGTACCGAGAATTGCCTCTGCTAAAACACACATAGAGACAATTATCAGTAAATGATCAGCATTGTCTATTTTTGTATCTGTGACAAGTAGCTGATACTAGTAGCTCTGTGTGTCTTTACCATTAGTGGACTATATGTTTAGACCAATTGGTCAATACAGCACTTCTGTTCTGTTTATTTAATTGGTGTGTGGAGGTAAGGAGACACACCCCGGATAGTCACTTGGAGCTTAACTCACGCACTGTTCGGTACACACTTGAAAAAGAGCTAGCTCAAAACATGTTGTGTGGATACCACTACATTTGCACTTTTGAAAGTAAACCTGCATTTGAAAACCAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                        CABE13642.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATTTCAAAAATAAGAACAAACAGCCAAAAGTATAAATTTATTGCAATTCACACGTTTACGGCCTCACAGGCCCTTTTTCGCGTTTGTATCGAACAGTGTATTCATTGGGCTTTGGGTGACCACCCGTGGTGGTGTCTCCATGTATTTCCAGCAATTGGGTAAGAATTGATAATGTTCTTAGTGTAATTGTACTTTACAATTGGGCAGCATATTATATACAGTCTGTCATTTGTAACTTTTATCAGGTAGGCCCCAGTGAATTGTAATGATCTAATGTTTTAAGAGTGAAAAATATGAAAATGGACTGTTTTTAATTATGAACGCTCACTCTGTGGATACTTAGGGTGAAGGCGCACACAGCTGCTTGTCACGGCTGCAAAATGTCAGAGGATACCCTGCCGTGGACGGTGCCGAGGGttgcctctgctgaaacacacgtggagacaattgtcagtgggtgatcagcattgtctatttttgtatctgtgacaagtggctgatactagtagctctgtgtgtctTTACCATTAGTGGACTATATGTTTAGACCAATTGGTCAATACAGCACTTCTGTTCTGTTTATTTAATTGGTGTGTGGAGGTAAGGAGACACACCCCGGATGGTCACTTGAAGCTTAGCTCACGCACTGTTCGGTACACACTTGAAAAAGAGCTAGCTCAAAACATGTTGTGTGGATGCCACTACATTTGCACTTTTGAAAGTAAACCTGCATTTGAAAACC
  5   1   2       bld Ova1      in                        CABE13642.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATTTCAAAAATAAGAACAAACAGCCAAAAGTATAAATTTATTGCAATTCACACGTTTACGGCCTCACAGGCCCTTTTTCGCGTTTGTATCGAACAGTGTATTCATTGGGCTTTGGGTGACCACCCGTGGTGGTGTCTCCATGTATTTCCAGCAATTGGGTAAGAATTGATAATGTTCTTAGTGTAATTGTACTTTACAATTGGGCAGCATATTATATACAGTCTGTCATTTGTAACTTTTATCAGGTAGGCCCCAGTGAATTGTAATGATCTAATGTTTTAAGAGTGAAAAATATGAAAATGGACTGTTTTTAATTATGAACGCTCACTCTGTGGATACTTAGGGTGAAGGCGCACACAGCTGCTTGTCACGGCTGCAAAATGTCAGAGGATACCCTGCCGTGGACGGTGCCGAGGGttgcctctgctgaaacacacgtggagacaattgtcagtgggtgatcagcattgtctatttttgtatctgtgacaagtggctgatactagtagctctgtgtgtctTTACCATTAGTGGACTATATGTTTAGACCAATTGGTCAATACAGCACTTCTGTTCTGTTTATTTAATTGGTGTGTGGAGGTAAGGAGACACACCCCGGATGGTCACTTGAAGCTTAGCTCACGCACTGTTCGGTACACACTTGAAAAAGAGCTAGCTCAAAACATGTTGTGTGGATGCCACTACATTTGCACTTTTGAAAGTAAACCTGCATTTGAAAACCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas                            TGas050i23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAATTTCAAAATAAGACAAACAGCCAAAGTATAAATTTATTGCAATTCACACGTTTACGGCCTCACAGGCCCTTTTTCACGTTTGTATCGAACAGTGTATTCGTTAAGCTTTAAGTAACCACCCGTGGTGGTGTCTCCATGTATTTCCAGCAATTGGGTAAGAATTGATAATGTTCTTAGTGTAATTGTACTTTACAATTGGGCAGCATATTATATACAGTCTGTCATTTGTAACTTTTATCAGGTAGGCCCCAGTGAATTGTAATGATCTAATGTTTTAAAAGTGAAAAATATGAAAATGGACTGTTTTTAATTATGAACGCTCACTCTGTGGATACTTAGGGTGAAGACACACACAGCTACTTGTCACAGCTACAAAATGTcagaaaataccctgccatagacagtaccgagaattgcctctgctaaaacacacatagagacaattatcagtaaatgatcagcattgtctatttttgtatctgtgacaagtagctgatactagtagctctgtgtgtctTTACCATTAGTGGACTATATGTTTAGACCAATTGGTCAATACAGCACTTCTGTTCTGTTAATTTAATTGGTGTGTGGAGGTAAGGAGACACACCCCAGATAGTCACTTAAAGCTTAACTCACGCACTGTTCAGTACACACTTGAA
  3   1   2       bld Gas7      in                         XZG15039.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACGTTTCGGGCCTCACAGGCCCTTTTTCACGTTTGTATCGAACAGTGTATTCGTTGAGCTTTGGGTGACCGCCCGTGGTGGTGTCTCCATGTATTTCCAGCAATTGGGTAAGAATTGATAATGTTCTTAGTGTAATTGTACTTTACAATTGGGCAGCATATTATATACAGTCTGTCATTTGTAACTTTTATCAGGTAGGCCCCAGTGAATTGTAATGATCTAATGTTTTAAAAGTGAAAAATATGAAAATGGACTGTTTTTAATTATGAACGCTCACTCTGTGGATACTTAGGTGAAGACACACACAGCTGCTTGTCGCGGCTATAAAATGTcagaaaataccctgccatggacagtaccgagggttgcctctgctgaaacacacatggagacaattgtcagtgggtgatcggcattgtctatttttgtatctgtggcaagtggctgatactagtagctctgtgtgtctTTACCATTAGTGGACTATATGTTTAGACCAATTGGTCAATACAGCACTTCTGTTCTGTTTATTTAATTGGTGTGTGGAGGTAAGGAGACACACCCCGGATGGTCACTTGAAGCTTGACTCACGCACTGTTCGGTACACACTTGAAAAAGAGCTAGCTCAAAACATGTTGTGTGGATACCACTACATTTGCACTTTTGAAAGTAAACCTGCATTTGAAAACCAAAAAAT
  3   1   2       bld Te1       in                        CBWN10898.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGTGGTGGTGTCTCCATGTATTCCCAGCAATTGGGTAAGAATTGATAATGTTCTTAGTGTAATTGTACTTTACAATTGGGCAGCATATTATATACAGTCTGTCATTTGTAACTTTTATCAGGTAGGCCCCAGTGAATTGTAATGATCTAATGTTTTAAAAGTGAAAAATATGAAAATGGACTGTTTTTAATTATGAACGCTCACTCTGTGGATACTTAGGGTGAAGACACACACAGCTACTTGTCACAGCTACAAAATGTCAGAAAATACCCTGCCATAGACAGTACCGAGAATTGCCTCTGCTAAAACACACATAGAGACAATTATCAGTAAATGATCAGCATTGTCTATTTTTGTATCTGTGACAAGTAGCTGATACTAGTAGCTCTGTGTGTCTTTACCATTAGTGGACTATATGTTTAGACCAATTGGTCAATACAGCACTTCTGTTCTGTTTATTTAATTGGTGTGTGGAGGTAAGGAGACACACCCCAGATAGTCACTTAAAGCTTAACTCACGCACTGTTCAGTACACACTTGAAAAAGAGCTAGCTCAAAACATGTTGTGTGGATACCACTACATTTGCACTTTTGAAAGTAAACCTGCATTTGAAAACCAAAAAAAAAAAAAAA
  5   1   2       bld TbA       in                   TTbA040j06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAAGACACACACAGCTACTTGTCACAGCTACAAAATGTcagaaaataccctgccatagacagtaccgagaattgcctctgctaaaacacacatagagacaattatcagtaaatgatcagcattgtctatttttgtatctgtgacaagtagctgatactagtagctctgtgtgtctTTACCATTAGTGGACTATATGTTTAGACCAATTGGTCAATACAGCACTTCTGTTCTGTTTATTTAATTGGTGTGTGGAGGTAAGGAGACACACCCCGGATAGTCACTTAAAGCTTAACTCACGCACTGTTCAGTACACACTTGAAAAAGAGCTAGCTCAAAACATGTTGTGTGGATACCACTACATTTGCACTTTTGAAAGTAAACCTGCATTTGAAAACC
  3   1   2       bld TbA       in                    TTbA040j06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAAGACACACACAGCTACTTGTCACAGCTACAAAATGTcagaaaataccctgccatagacagtaccgagaattgcctctgttaaaacacacatagagacaattatcagtaaatgatcagcattgtctatttttgtatctgtgacaagtagctgatactagtagctctgtgtgtctTTACCATTAGTGGACTATATGTTTAGACCAATTGGTCAATACAGCACTTCTGTTCTGTTTATTTAATTGGTGTGTGGAGGTAAGGAGACACACCCCGGATAGTCACTTAAAGCTTAACTCACGCACTGTTCAGTACACACTTGAAAAAGAGCTAGCTCAAAACATGTTGTGTGGATACCACTACATTTGCACTTTTGAAAGTAAACCTGCATTGAAAACCAAAAAAAAAAAAAAAAAAAAGCG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)