Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-EC2BBA8DH10.3                        13 END     4          12       36                Jak1-prov protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012075956 Xt7.1-CABJ8708.3.5 - 33 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABJ8708.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTCCAGAGTATTAAGTGTTGCTGCTGACAAGTGGAGCTTTGGAACCACTTTATGGGAAATCTGTTTCAATGGAGAAGTGCCTCTTAAAGACCGGACGCTAGCAGAGAAAGAAAGATTTTATGGAGGCTGCTTTATGTTAGTCGCCCCTTCATGCAAAGAGTTAGCAGATCTAATTAATCAATGCATGAATTATGACCCCCTCAGAAGACCATTTTTTAGGGCAATTATGAGAGAAATCAACAAGCTGGAAGAGCAAAATCCAGACATTGTCTCTGAAAAGACCCCATCTGCAGAAGTGGACCCTACTTTATTTGAGAAAAGATTCTTGAAGAGAGTAAGAGATCTAGGAGAGGGCCACTTTGGAAAAGTTGAGTTGTGTAGGTATGACCCAGAAGGCGACAACACCGGGGAACTGGTTGCTGTGAAATCACTAAAGCCTGGCACAGCGGGCAGTCACATTGCTGATCTGAAAAAGGAGATTGAAATCCTGAGAAATCTGTATCATGAGAACATTGTAAAATACAAAGGAATTTGTGAAGATGGAGGCAGTGGAATAAAATTGATCATGGAATATCTCCCATCAGGGAGTCTAAAGGAGTACCTTCCAAGAAATGTGAACAAAATCAATCTGAAACAGCAGTTGAAATATGCTACACAAATATGCAAGGGAATGGACTATTTGGGTTCACGTCAGTATGTCCATCGAGACTTGGCTGCAAGGAATGTTCTTGTTGAAAATGAACAAATAATAAAGATTGGAGATTTTGGATTGACCAAGGCTATTGAAACTGATAAGGAATATTATACTGTCAAAGATGACCTGGATAGTCCTGTTTTCTGGTATGCTCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTCTGGTCATTTGGAGTAACCTTGTATGAACTGCTCACATACTGCAATTCAGAATACAGTCCTATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAAATGACGGTTACGAGACTTGTACGCGTGTTGGAAGAGGACAAGCGTTTGCCAATACCAGCAAACTGCCCAAAGCAGGTGTACCAGCTCATGCTCAAATGCTGGGAACAAAATCCAAGCCACCGCACCACTTTTCAGGACCTAATTAAAGGCTTTGAAGCTATTATAAATACTTTGTAGCCATATTGCTACACACTGGCGAAAGGACGATATTTAGACTTTCTAACTCTCGATGCTGCTCCTGTGGATGCATATTTTTGTTTTTATTCGCACTTCTATTTGTGATACCTGTCTTCTACATTTCTACTACTAGATAGGACAAAACTTTCTCCTATGCATTATTCCTTTTGGGGCTTCACAAAGAAAAGGTGGAAACATGTCAAGGAACTTACTGGCTCCTCCAGAAATGAACTCAATGTAGCAGAACTGTAAAACACCCCAGGCTTGCACAGCGTGCCAGATGCACACAGAAAGGCTTTGTCTTTCCTAAAACATATTCTATAACAGTTTCAGTTCTAACGTATCAAGTAAATATAAGTGTATATACATGTATATAAAAATCTAAAACACAAATCATGGGAACCATTCTTGCCCATTGCAGGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCACAACAACCTTTGAAAATATACTCAGAGAGAATTTTGTGCAGGATATATCTAACATTTTCACAATAATACAGAACCACATTTTAAATCAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCGCCCAATGCTGTATAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATACGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAATTATAT
                                                  Xt7.1-CHK-1008227748                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGTATTAAGTGTTGCTGCTGACAAGTGGAGCTTTGGAACCACTTTATGGGAAATCTGTTTCAATGGAGAAGTGCCTCTTAAAGACCGGACGCTAGCAGAGAAAGAAAGATTTTATGGAGGCTGCTTTATGTTAGTCGCCCCTTCATGCAAAGAGTTAGCAGATCTAATTAATCAATGCATGAATTATGACCCCCTCAGAAGACCATTTTTTAGGGCAATTATGAGAGAAATCAACAAGCTGGAAGAGCAAAATCCAGACATTGTCTCTGAAAAGACCCCATCTGCAGAAGTGGACCCTACTTTATTTGAGAAAAGATTCTTGAAGAGAGTAAGAGATCTAGGAGAGGGCCACTTTGGAAAAGTTGAGTTGTGTAGGTATGACCCAGAAGGCGACAACACCGGGGAACTGGTTGCTGTGAAATCACTAAAGCCTGGCACAGCGGGCAGTCACATTGCTGATCTGAAAAAGGAGATTGAAATCCTGAGAAATCTGTATCATGAGAACATTGTAAAATACAAAGGAATTTGTGAAGATGGAGGCAGTGGAATAAAATTGATCATGGAATATCTCCCATCAGGGAGTCTAAAGGAGTACCTTCCAAGAAATGTGAACAAAATCAATCTGAAACAGCAGTTGAAATATGCTACACAAATATGCAAGGGAATGGACTATTTGGGTTCACGTCAGTATGTCCATCGAGACTTGGCTGCAAGGAATGTTCTTGTTGAAAATGAACAAATAATAAAGATTGGAGATTTTGGATTGACCAAGGCTATTGAAACTGATAAGGAATATTATACTGTCAAAGATGACCTGGATAGTCCTGxTTxCxGGTATGCTCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTCTGGTCATTTGGAGTAACCTTGTATGAACTGCTCACATACTGCAATTCAGAATACAGTCCTATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAAATGACGGTTACGAGACTTGTACGCGTGTTGGAAGAGGACAAGCGTTTGCCAATACCAGCAAACTGCCCAAAGCAGGTGTACCAGCTCATGCTCAAATGCTGGGAACAAAATCCAAGCCACCGCACCACTTTTCAGGACCTAATTAAAGGCTTTGAAGCTATTATAAATACTTTGTAGCCATATTGCTACACACTGGCGAAAGGACGATATTTAGACTTTCTAACTCTCGATGCTGCTCCTGTGGATGCATATTTTTGTTTTTATTCGCACTTCTATTTGTGATACCTGTCTTCTACATTTCTACTACTAGATAGGACAAAACTTTCTCCTATGCATTATTCCTTTTGGGGCTTCACAAAGAAAAGGTGGAAACATGTCAAGGAACTTACTGGCTCCTCCAGAAATGAACTCAATGTAGCAGAACTGTAAAACACCCCAGGCTTGCACAGCGTGCCAGATGCACACAGAAAGGCTTTGTCTTTCCTAAAACATATTCTATAACAGTTTCAGTTCTAACGTATCAAGTAAATATAAGTGTATATACATGTATATAAAAATCTAAAACACAAATCATGGGAACCATTCTTGCCCATTGCAGGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCACAACAACCTTTGAAAATATACTCAGAGAGAATTTTGTGCAGGATATATCTAACATTTTCACAATAATACAGAACCACATTTTAAATCAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCGCCCAATGCTGTATAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATACGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     5     4     5     4     5     4     5     4     6     4     6     4     6     4     6     4     7     4     8     4     8     4     8     4     8     3     8     3     7     3     7     3     7     3     7     3     7     3     7     3     7     3     7     3     7     3     7     3     6     3     6     3     6     5     6     5     6     5     6     5     6     5     7     7     8     7     8     7     8     7     8     7     8     8     9     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     8     8     8     8     7     8     8     8     8     8     6     7     6     7     6     7     6     7     6     7     7     8     7     8     7     7     7     7     7     7     7     7     7     7    10    10    10    10    10    10    11    11    11    11    13    15    16    16    17    18    18    19    19    19    19    19    18    18    18    18    20    20    20    20    20    20    22    22    21    22    21    22    21    22    21    23    21    23    20    21    20    21    20    21    20    21    20    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    20    21    21    21    21    21    20    20    20    20    19    19    15    19    15    19    15    19    15    19    15    19    15    19    15    19    15    19    15    19    16    20    15    19    15    19    15    19    15    19    15    19    13    19    15    19    15    19    15    19    15    19    15    19    15    19    15    19    15    18    15    16    15    15    15    15    15    15     8     9
  5   1   2  SIG                                      Xt7.1-CABJ8708.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTTAGTCGCCCCTTCATGCAAAGAGTTAGCAGATCTAATTAATCAATGCATGAATTATGACCCCCTCAGAAGACCATTTTTTAGGGCAATTATGAGAGAAATCAACAAGCTGGAAGAGCAAAATCCAGACATTGTCTCTGAAAAGACCCCATCTGCAGAAGTGGACCCTACTTTATTTGAGAAAAGATTCTTGAAGAGAGTAAGAGATCTAGGAGAGGGCCACTTTGGAAAAGTTGAGTTGTGTAGGTATGACCCAGAAGGCGACAACACCGGGGAACTGGTTGCTGTGAAATCACTAAAGCCTGGCACAGCGGGCAGTCACATTGCTGATCTGAAAAAGGAGATTGAAATCCTGAGAAATCTGTATCATGAGAACATTGTAAAATACAAAGGAATTTGTGAAGATGGAGGCAGTGGAATAAAATTGATCATGGAATATCTCCCATCAGGGAGTCTAAAGGAGTACCTTCCAAGAAATGTGAACAAAATCAATCTGAAACAGCAGTTGAAATATGCTACACAAATATGCAAGGGAATGGACTATTTGGGTTCACGTCAGTATGTCCATCGAGACTTGGCTGCAAGGAATGTTCTTGTTGAAAATGAACAAATAATAAAGATTGGAGATTTTGGATTGACCAAGGCTATTGAAACTGATAAGGAATATTATACTGTCAAAGATGACCTGGATAGTCCTGTTTTCTGGTATGCTCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTCTGGTCATTTGGAGTAACCTTGTATGAACTGCTCACATACTGCAATTCAGAATACAGTCCTATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAAATGACGGTTACGAGACTTGTACGCGTGTTGGAAGAGGACAAGCGTTTGCCAATACCAGCAAACTGCCCAAAGCAGGTGTACCAGCTCATGCTCAAATGCTGGGAACAAAATCCAAGCCACCGCACCACTTTTCAGGACCTAATTAAAGGCTTTGAAGCTATTATAAATACTTTGTAGCCATATTGCTACACACTGGCGAAAGGACGATATTTAGACTTTCTAACTCTCGATGCTGCTCCTGTGGATGCATATTTTTGTTTTTATTCGCACTTCTATTTGTGATACCTGTCTTCTACATTTCTACTACTAGATAGGACAAAACTTTCTCCTATGCATTATTCCTTTTGGGGCTTCACAAAGAAAAGGTGGAAACATGTCAAGGAACTTACTGGCTCCTCCAGAAATGAACTCAATGTAGCAGAACTGTAAAACACCCCAGGCTTGCACAGCGTGCCAGATGCACACAGAAAGGCTTTGTCTTTCCTAAAACATATTCTATAACAGTTTCAGTTCTAACGTATCAAGTAAATATAAGTGTATATACATGTATATAAAAATCTAAAACACAAATCATGGGAACCATTCTTGCCCATTGCAGGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCACAACAACCTTTGAAAATATACTCAGAGAGAATTTTGTGCAGGATATATCTAACATTTTCACAATAATACAGAACCACATTTTAAATCAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCGCCCAATGCTGTATAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATACGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAATTATATTGT
  5   1   2  SIG                                    Xt7.1-TGas139g23.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGATAAGGGATCTCTCTGTAATTGTATCACTATACTTATTAAGTCTACTAAAAAATCATTTAAACCTTAATTAAACCCAAAAGGATTGCTTTTTATCCAGTAAGGATTAATTATAGTTGGGATAAAGCACAAGGTACTGTTTTATAATTACAGAGAAAAGGGAAATGTAATATTTATTTTACCGTTACTGGGTAAAGCAAATAGAAAATAATCACATTTTCATATGTCGGCCTTATCTTTCTTTAGAATTGCTATAATTTATTATAGTGCATGCCATATACAAAATTTAAATGCCTTCTATTTGTGCAACTGTGTTAATTCATTTCTTGCAGGTATGCTCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTCTGGTCATTTGGAGTAACCTTGTATGAACTGCTCACATACTGCAATTCAGAATACAGTCCTATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAAATGACGGTTACGAGACTTGTACGCGTGTTGGAAGAGGACAAGCGTTTGCCAATACCAGCAAACTGCCCAAAGCAGGTGTACCAGCTCATGCTCAAATGCTGGGAACAAAATCCAAGCCACCGCACCACTTTTCAGGACCTAATTAAAGGCTTTGAAGCTATTATAAATACTTTGTAGCCATATTGCTACACACTGGCGAAAGGACGATATTTAGACTTTCTAACTCTCGATGCTGCTCCTGTGGATGCATATTTTTGTTTTTATTCGCACTTCTATTTGTGATACCTGTCTTCTACATTTCTACTACTAGATAGGACAAAACTTTCTCCTATGCATTATTCCTTTTGGGGCTTCACAAAGAAAAGGTGGAAACATGTCAAGGAACTTACTGGCTCCTCCAGAAATGAACTCAATGTAGCAGAACTGTAAAACACCCCAGGCTTGCACAGCGTGCCAGATGCACACAGAGAGGCTTTGTCTTTCCTAAAACATATTCTATAACAGTTTCAGTTCTAACGTATCAAGTAAATATAAGTGTATATACATGTATATAAAAATCTAAAACACAAATCATGGGAACCATTCTTGCCCATTGCAGGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATGAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCAGAACAACCTTCGAAAATATACTCAAATCAAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCGCCCAATGCTGTAGAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATAAGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTAATAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAATCAAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCGCCCAATGCTGTAGAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATAAGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------T---
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Sc ---- 8e-024     NP_009411.1 Promotes the exit from mitosis by directly switching on the kinase activity ofDbf2. Required for mitosis and sporulation, cell division cycle blocked at 36C.; Cdc15p [Saccharomyces cerevisiae] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Br ---- 8e-030     AAB50848.1 insulin-like peptide receptor; ILP-R [Branchiostoma lanceolatum] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Cs ---- 5e-037     BAB68344.1 EPH receptor tyrosine kinase [Ciona savignyi] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bb ---- 2e-038     ABD24302.1 fibroblast growth factor receptor [Branchiostoma belcheri] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Sp ---- 9e-040     XP_788233.2 PREDICTED: similar to tyrosine kinase, partial [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 7e-040     NP_509105.1 tyrosine kinase (116.8 kD) (XH177) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN --- Dm ---- 7e-041     NP_732286.1 heartless CG7223-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bf ---- 5e-046     AAX94285.1 neurotrophic tyrosine kinase receptor precursor [Branchiostoma floridae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 4e-056     BAE06524.1 Janus kinase [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 4e-106     AAI25683.1 Unknown (protein for MGC:145403) [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 8e-159     NP_571148.1 Janus kinase 1 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_002218.2 janus kinase 1 [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 0          NP_990201.1 tyrosine kinase JAK1 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_666257.2 Janus kinase 1 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          AAH77570.1 Jak1-prov protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 0          NP_001086862.1 Janus kinase 1 (a protein tyrosine kinase) [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABJ8708.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG------------------------------------------------ATG---------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------ATG---------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------TGA------------------------------------------------ATG---------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------TAA------------TAA---------TAA---TAA---------------------------------------------------------------------------TGA------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------ATG------------------ATG---------------------------------ATG------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------TAA---------------TAA------ATGTAG---------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------TAATAA------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2  SIG                                      Xt7.1-CABJ8708.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTTAGTCGCCCCTTCATGCAAAGAGTTAGCAGATCTAATTAATCAATGCATGAATTATGACCCCCTCAGAAGACCATTTTTTAGGGCAATTATGAGAGAAATCAACAAGCTGGAAGAGCAAAATCCAGACATTGTCTCTGAAAAGACCCCATCTGCAGAAGTGGACCCTACTTTATTTGAGAAAAGATTCTTGAAGAGAGTAAGAGATCTAGGAGAGGGCCACTTTGGAAAAGTTGAGTTGTGTAGGTATGACCCAGAAGGCGACAACACCGGGGAACTGGTTGCTGTGAAATCACTAAAGCCTGGCACAGCGGGCAGTCACATTGCTGATCTGAAAAAGGAGATTGAAATCCTGAGAAATCTGTATCATGAGAACATTGTAAAATACAAAGGAATTTGTGAAGATGGAGGCAGTGGAATAAAATTGATCATGGAATATCTCCCATCAGGGAGTCTAAAGGAGTACCTTCCAAGAAATGTGAACAAAATCAATCTGAAACAGCAGTTGAAATATGCTACACAAATATGCAAGGGAATGGACTATTTGGGTTCACGTCAGTATGTCCATCGAGACTTGGCTGCAAGGAATGTTCTTGTTGAAAATGAACAAATAATAAAGATTGGAGATTTTGGATTGACCAAGGCTATTGAAACTGATAAGGAATATTATACTGTCAAAGATGACCTGGATAGTCCTGTTTTCTGGTATGCTCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTCTGGTCATTTGGAGTAACCTTGTATGAACTGCTCACATACTGCAATTCAGAATACAGTCCTATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAAATGACGGTTACGAGACTTGTACGCGTGTTGGAAGAGGACAAGCGTTTGCCAATACCAGCAAACTGCCCAAAGCAGGTGTACCAGCTCATGCTCAAATGCTGGGAACAAAATCCAAGCCACCGCACCACTTTTCAGGACCTAATTAAAGGCTTTGAAGCTATTATAAATACTTTGTAGCCATATTGCTACACACTGGCGAAAGGACGATATTTAGACTTTCTAACTCTCGATGCTGCTCCTGTGGATGCATATTTTTGTTTTTATTCGCACTTCTATTTGTGATACCTGTCTTCTACATTTCTACTACTAGATAGGACAAAACTTTCTCCTATGCATTATTCCTTTTGGGGCTTCACAAAGAAAAGGTGGAAACATGTCAAGGAACTTACTGGCTCCTCCAGAAATGAACTCAATGTAGCAGAACTGTAAAACACCCCAGGCTTGCACAGCGTGCCAGATGCACACAGAAAGGCTTTGTCTTTCCTAAAACATATTCTATAACAGTTTCAGTTCTAACGTATCAAGTAAATATAAGTGTATATACATGTATATAAAAATCTAAAACACAAATCATGGGAACCATTCTTGCCCATTGCAGGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCACAACAACCTTTGAAAATATACTCAGAGAGAATTTTGTGCAGGATATATCTAACATTTTCACAATAATACAGAACCACATTTTAAATCAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCGCCCAATGCTGTATAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATACGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAATTATATTGT
                                                  Xt7.1-CHK-1008292828                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCGCCCCTTCATGCAAAGAGTTAGCAGATCTAATTAATCAATGCATGAATTATGACCCCCTCAGAAGACCATTTTTTAGGGCAATTATGAGAGAAATCAACAAGCTGGAAGAGCAAAATCCAGACATTGTCTCTGAAAAGACCCCATCTGCAGAAGTGGACCCTACTTTATTTGAGAAAAGATTCTTGAAGAGAGTAAGAGATCTAGGAGAGGGCCACTTTGGAAAAGTTGAGTTGTGTAGGTATGACCCAGAAGGCGACAACACCGGGGAACTGGTTGCTGTGAAATCACTAAAGCCTGGCACAGCGGGCAGTCACATTGCTGATCTGAAAAAGGAGATTGAAATCCTGAGAAATCTGTATCATGAGAACATTGTAAAATACAAAGGAATTTGTGAAGATGGAGGCAGTGGAATAAAATTGATCATGGAATATCTCCCATCAGGGAGTCTAAAGGAGTACCTTCCAAGAAATGTGAACAAAATCAATCTGAAACAGCAGTTGAAATATGCTACACAAATATGCAAGGGAATGGACTATTTGGGTTCACGTCAGTATGTCCATCGAGACTTGGCTGCAAGGAATGTTCTTGTTGAAAATGAACAAATAATAAAGATTGGAGATTTTGGATTGACCAAGGCTATTGAAACTGATAAGGAATATTATACTGTCAAAGATGACCTGGATAGTCCTGTTTTCTGGTATGCTCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTCTGGTCATTTGGAGTAACCTTGTATGAACTGCTCACATACTGCAATTCAGAATACAGTCCTATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAAATGACGGTTACGAGACTTGTACGCGTGTTGGAAGAGGACAAGCGTTTGCCAATACCAGCAAACTGCCCAAAGCAGGTGTACCAGCTCATGCTCAAATGCTGGGAACAAAATCCAAGCCACCGCACCACTTTTCAGGACCTAATTAAAGGCTTTGAAGCTATTATAAATACTTTGTAGCCATATTGCTACACACTGGCGAAAGGACGATATTTAGACTTTCTAACTCTCGATGCTGCTCCTGTGGATGCATATTTTTGTTTTTATTCGCACTTCTATTTGTGATACCTGTCTTCTACATTTCTACTACTAGATAGGACAAAACTTTCTCCTATGCATTATTCCTTTTGGGGCTTCACAAAGAAAAGGTGGAAACATGTCAAGGAACTTACTGGCTCCTCCAGAAATGAACTCAATGTAGCAGAACTGTAAAACACCCCAGGCTTGCACAGCGTGCCAGATGCACACAGAAAGGCTTTGTCTTTCCTAAAACATATTCTATAACAGTTTCAGTTCTAACGTATCAAGTAAATATAAGTGTATATACATGTATATAAAAATCTAAAACACAAATCATGGGAACCATTCTTGCCCATTGCAGGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCACAACAACCTTTGAAAATATACTCAGAGAGAATTTTGTGCAGGATATATCTAACATTTTCACAATAATACAGAACCACATTTTAAATCAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCGCCCAATGCTGTATAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATACGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAATTA
  5   1   2       add Neu0                               IMAGE:6995444                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCCATTCATAAAGCTTAGTGATCCTGGAATCCCGATTACTGTGTTAACAAGGCAAGAGCGTGTAGAGCGGATTCCATGGATTGCTCCTGAATGTGTTGAGGATTCCAGAGTATTAAGTGTTGCTGCTGACAAGTGGAGCTTTGGAACCACTTTATGGGAAATCTGTTTCAATGGAGAAGTGCCTCTTAAAGACCGGACGCTAGCAGAGAAAGAAAGATTTTATGGAGGCTGCTTTATGTTAGTCGCCCCTTCATGCAAAGAGTTAGCAGATCTAATTAATCAATGCATGAATTATGACCCCCTCAGAAGACCATTTTTTAGGGCAATTATGAGAGAAATCAACAAGCTGGAAGAGCAAAATCCAGACATTGTCTCTGAAAAGACCCCATCTGCAGAAGTGGACCCTACTTTATTTGAGAAAAGATTCTTGAAGAGAGTAAGAGATCTAGGAGAGGGCCACTTTGGAAAAGTTGAGTTGTGTAGGTATGACCCAGAAGGCGACAACACCGGGGAACTGGTTGCTGTGAAATCACTAAAGCCTGGCACAGCGGGCAGTCACATTGCTGATCTGAAAAAGGAGATTGAAATCCTGAGAAATCTGTATCATGAGAACATTGTAAAATACAAAGGAATTTGTGAAGATGGAGGCAGTGGAATAAAATTGATCATGGAATATCTCCCATCAGGGAGTCTAAAGGAGTACCTTTCCAGAAATGTGAACAAAATCAATCTGAAACAGCAGTTGAAATATGCAACACAAATATGCAAGGGGAATGGGACTATTTGGGGTTCACGTCAGTATGGTCCATCGAGACTTGNGCTGCCAAGAAATGTTCTCTGTTTNAAAATGGACCCAATTAATAAAGGATTGGGAGATTTTTGGGATTTGACCACAGGCCTATTGGAA
  5   1   2       ext Eye       in                         CCAX4414.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTCCAGAGTATTAAGTGTTGCTGCTGACAAGTGGAGCTTTGGAACCACTTTATGGGAAATCTGTTTCAATGGAGAAGTGCCTCTTAAAGACCGGACGCTAGCAGAGAAAGAAAGATTTTATGGAGGCTGCTTTATGTTAGTCGCCCCTTCATGCAAAGAGTTAGCAGATCTAATTAATCAATGCATGAATTATGACCCCCTCAGAAGACCATTTTTTAGGGCAATTATGAGAGAAATCAACAAGCTGGAAGAGCAAAATCCAGACATTGTCTCTGAAAAGACCCCATCTGCAGAAGTGGACCCTACTTTATTTGAGAAAAGATTCTTGAAGAGAGTAAGAGATCTAGGAGAGGGCCACTTTGGAAAAGTTGAGTTGTGTAGGTATGACCCAGAAGGCGACAACACCGGGGAACTGGTTGCTGTGAAATCACTAAAGCCTGGCACAGCGGGCAGTCACATTGCTGATCTGAAAAAGGAGATTGAAATCCTGAGAAATCTGTATCATGAGAACATTGTAAAATACAAAGGAATTTGTGAAGATGGAGGCAGTGGAATAAAATTGATCATGGAATATCTCCCATCAGGGAGTCTAAAGGAGTACCTTCCAAGAAATGTGAACAAAATCAATCTGAAACAGCAGTTGAAATATGCTACACAAATATGCAAGGGAATGGACTATTTGGGGTTCA
  5   1   4      seed Ski1      in                         CABJ8708.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTTAGTCGCCCCTTCATGCAAAGAGTTAGCAGATCTAATTAATCAATGCATGAATTATGACCCCCTCAGAAGACCATTTTTTAGGGCAATTATGAGAGAAATCAACAAGCTGGAAGAGCAAAATCCAGACATTGTCTCTGAAAAGACCCCATCTGCAGAAGTGGACCCTACTTTATTTGAGAAAAGATTCTTGAAGAGAGTAAGAGATCTAGGAGAGGGCCACTTTGGAAAAGTTGAGTTGTGTAGGTATGACCCAGAAGGCGACAACACCGGGGAACTGGTTGCTGTGAAATCACTAAAGCCTGGCACAGCGGGCAGTCACATTGCTGATCTGAAAAAGGAGATTGAAATCCTGAGAAATCTGTATCATGAGAACATTGTAAAATACAAAGGAATTTGTGAAGATGGAGGCAGTGGAATAAAATTGATCATGGAATATCTCCCATCAGGGAGTCTAAAGGAGTACCTTCCAAGAAATGTGAACAAAATCAATCTGAAACAGCAGTTGAAATATGCTACACAAATATGCAAGGGAATGGACTATTTGGGTTCACGTCAGTATGTCCATCGAGACTTGGCTGCAAGGAATGTTCTTGTTGAAAATGAACAAATAATAAAGATTGGAGATTTTGGATTGACCAAGGCTATTGAAACTGATAAGGAATATTATACTGTCAAAGATGACCTGGATAGTCCTGTTTTCTGGTATGCTCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTCTGGTCATTTGGAGTAACCTTGTATGAACTGCTCACATACTGCAATTCAGAATACAGTCCTATGACGATGTTTTTGAAAATGATTGGC
  5   1   3        nb Spl2      in                       CBSS10493.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAGATTGAAATCCTGAGAAATCTGTATCATGAGAACATTGTAAAATACAAAGGAATTTGTGAAGATGGAGGCAGTGGAATAAAATTGATCATGGAATATCTCCCATCAGGGAGTCTAAAGGAGTACCTTCCAAGAAATGTGAACAAAATCAATCTGAAACAGCAGTTGAAATATGCAACACAAATATGCAAGGGAATGGACTATTTGGGTTCACGTCAGTATGTCCATCGAGACTTGGCTGCAAGGAATGTTCTTGTTGAAAATGAACAAATAATAAAGATTGGAGATTTTGGATTGACCAAGGCTATTGAAACTGATAAGGAATATTATACTGTCAAAGATGACCTGGATAGTCCTGTTTTCTGGTATGCTCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTCTGGTCATTTGGAGTAACCTTGTATGAACTGCTCACATACTGCAATTCAGAATACAGTCCTATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAAATGACGGTTACGAGACTTGTACGCGTGTTGGAAGAGGACAAGCGTTTGCCAATACCAGCAAACTGCCCAAAGCAGGTGTACCAGCTCATGCTCAAATGCTGGGAACAAAATCCAAGCCACCGCACCACTTTTCAGGACCTAATTAAAGGCTTTGAAGCTATTATAAATACTTTGTAGCCATATTGCTACACACTGGCGAAAGGACGAT
  5   1   2       add Te5       in                        CAAO10679.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTAAGAAAATAGAGGTATTGCTGAACGCAGCATGTTCATGGAATCCTGTACAGAAAATACgggttatgtgatataaggtgcaaagtttgctacagttcttatcgcctatagcaacgaatcagcaagtagaattTAATTGTCATTGGTTGCTATGGGTTACTGCACCTAGGAAAATTTGTGCCTTTTATTACATGTAGGGCATCTAAAGCTGCCTCCTCACCATTATAACATAACACTGAACTGTACAGCATAATGCAGACAGAAGAGTGCCCAGTAGCAGAATTGTATATATATAGTTATGGACATTATGTCAGTCCGCGCATCTTAACAAACTAGTTAGATTCCTCATAACCAGGCCGCTACAGTATGACTACCAGGCATAATCTCCCTGTCCCATGTTAGTGCTGCTTATTCTGGTACTTCTCATTCATGTTCTCTGACTGTGTTTTGTCTGTGTGACAGGTGTACCAGCTTATGCTCAAATGCTGGGAACAAAATCCAAGCCACCGCACCACTTTTCAGGACCTAATTAAAGGCTTTGAAGCTATTATAAATACTTTGTAGCCATATTGCTACACACTGGCGAAAGGACGATATTTAGACTTTCTAACTCTCGATGCTGCTCCTGTGGATGCATATTTTTGTTTTTATTCGCACTTCTATTTGTGATACCTGTCTTCTACATTTCTACTACTAGATAGGACAAAACTTTCTCCTATGCATTATTCCTTTTGGGGCTT
  5   1   2       add Tad0                               IMAGE:6985998                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGGGGGTACCGGTCCCGGAATTCCGCGGGATCAACACAGATATGCGAGGGAGTGGACTATTTAGGGTTCACGTCAGTATGTCCATCGAGACTTGGCTGCAAGGAATGTTCTTGTTGAAAATGAACAAATAATAAAGATTGGAGATTTTGGATTGACCAAGGCTATTGAAACTGATAAGGAATATTATACTGTCAAAGATGACCTGGATAGTCCTGTTTTCGGGTATGCTCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTCTGGTCATTTGGAGTAACCTTGTATGAACTGCTCACATACTGCAATTCAAAATACAGTCCTATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAAATGACGGTTACGAGACTTGTACGCGTGTTGGAAGAGGACAAGCGTTTGCCAATACCAGCTAACTGCCCAAAGCAGGTGTACCAGCTCATGCTCAAATGCTGGGAACAAAATCCAAGCCACCGCACCACTTTTCAGGACCTGATTAAAGGCTTTGAAGCTATTATAAATACTTTGTAGCCATATTGCTACACACTGGCGAAAGGACGATATTTAGACTTTCTAACTCTCGATGCTGCTCCTGTGGATGCATATTTTTGTTTTTATTCGCACTTCTATTTGTGATACCTGTCTTCTACATTTCTACTACTAGATAAGACAAAATTTTCTCCTATGCATTATTCCTTTTGGGGCTTCACAAAGAAAAGGTGGAAACATGTCAAGGAACTTACTGGGCTCCTCCCGAAATTGACCTTCATGTAGCAAGAACTGTAAAATACCCCAGGCTTGGACAGCGTGGCCGATCCCCCCAA
  5   1   2       ext Bone      in                        CBTC2967.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTCATTTGGAGTAACCTTGTATGAACTGCTCACATACTGCAATTCAGAATACAGTCCTATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAAATGACGGTTACGAGACTTGTACGCGTGTTGGAAGAGGACAAGCGTTTGCCAATACCAGCAAACTGCCCAAAGCAGGTGTACCAGCTCATGCTCAAATGCTGGGAACAAAATCCAAGCCACCGCACCACTTTTCAGGACCTAATTAAAGGCTTTGAAGCTATTATAAATACTTTGTAGCCATATTGCTACACACTGGCGAAAGGACGATATTTAGACTTTCTAACTCTCGATGCTGCTCCTGTGGATGCATATTTTTGTTTTTATTCGCACTTCTATTTGTGATACCTGTCTTCTACATTTCTACTACTAGATAGGACAAAACTTTCTCCTATGCATTATTCCTTTTGGGGCTTCACAAAGAAAAGGTGGAAACATGTCAAGGAACTTACTGGCTCCTCCAGAAATGAACTCAATGTAGCAGAACTGTAAAACACCCCAGGCTTGCACAGCGTGCCAGATGCACACAGAAAGGCTTTGTCTTTCCTAAAACATATTCTATAACAGTTTCAGTTCTAACGTATCAAGTAAATATAAGTGTATATACATGTATATAANAATCTAAAACACAAATCATGGGAACCATTCTTGCCCATTGCAGGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTG
  5   1   2       ext Sto1      in                        CABG11917.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAAATGACGGTTACGAGACTTGTACGCGTGTTGGAAGAGGACAAGCGTTTGCCAATACCAGCAAACTGCCCAAAGCAGGTGTACCAGCTCATGCTCAAATGCTGGGAACAAAATCCAAGCCACCGCACCACTTTTCAGGACCTAATTAAAGGCTTTGAAGCTATTATAAATACTTTGTAGCCATATTGCTACACACTGGCGAAAGGACGATATTTAGACTTTCTAACTCTCGATGCTGCTCCTGTGGATGCATATTTTTGTTTTTATTCGCACTTCTATTTGTGATACCTGTCTTCTACATTTCTACTACTAGATAGGACAAAACTTTCTCCTATGCATTATTCCTTTTGGGGCTTCACAAAGAAAAGGTGGAAACATGTCAAGGAACTTACTGGCTCCTCCAGAAATGAACTCAATGTAGCAGAACTGTAAAACACCCCAGGCTTGCACAGCGTGCCAGATGCACACAGAAAGGCTTTGTCTTTCCTAAAACATATTCTATAACAGTTTCAGTTCTAACGTATCAAGTAAATATAAGTGTATATACATGTATATAAAAATCTAAAACACAAATCATGGGAACCATTCTTGCCCATTGCAGGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATA
  5   1   2       ext Tad5      in                         XZT36834.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTTCTAACTCTCGATGCTGCTCCTGTGGATGCATATTTTTGTTTTTATTCGCACTTCTATTTGTGATACCTGTCTTCTACATTTCTACTACTAGATAGGACAAAACTTTCTCCTATGCATTATTCCTTTTGGGGCTTCACAAAGAAAAGGTGGAAACATGTCAAGGAACTTACTGGCTCCTCCAGAAATGAACTCAATGTAGCAGAACTGTAAAACACCCCAGGCTTGCACAGCGTGCCAGATGCACACAGAAAGGCTTTGTCTTTCCTAAAACATATTCTATAACAGTTTCAGTTCTAACGTATCAAGTAAATATAAGTGTATATACATGTATATAAAAATCTAAAACACAAATCATGGGAACCATTCTTGCCCATTGCAGGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAANAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCACAACAACCTT
  3  -1   3        nb Eye       in                          CCAX745.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCACTTCTATTTGTGATACCTGTCTTCTACATTTCTACTACTAGATAGGACAAAACTTTCTCCTATGCATTATTCCTTTTGGGGCTTCACAAAGAAAAGGTGGAAACATGTCAAGGAACTTACTGGCTCCTCCAGAAATGAACTCAATGTAGCAGAACTGTAAAACACCCCAGGCTTGCACAGCGTGCCAGATGCACACAGAAAGGCTTTGTCTTTCCTAAAACATATTCTATAACAGTTTCAGTTCTAACGTATCAAGTAAATATAAGTGTATATACATGTATATAAAAATCTAAAACACAAATCATGGGAACCATTCTTGCCCATTGCAGGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATT
  3  -1   2       ext Hrt1      in                        CAAQ11769.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTGGGGCTTCCAAAGAAAAGGTGGAAACATGTCAAGGAACTTACTGGCTCCTCCAGAAATGAACTCAATGTAGCAGAACTGTAAAACACCCCAGGCTTGCACAGCGTGCCAGATGCACACAGAAAGGCTTTGTCTTTCCTAAAACATATTCTATAACAGTTTCAGTTCTAACGTATCAAGTAAATATAAGTGTATATACATGTATATAAAAATCTAAAACACAAATCATGGGAACCATTCTTGCCCATTGCAGGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCACAACAACCTTTGAAAATATACTCAGAGAGAATTTTGTGCAGGATATATCTAACATTTTCACAATAATACAGAACCACATTTTAAATCAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCC
  3   1   4      seed Ski1      in                         CABJ8708.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAGTAAATATAAGTGTATATACATGTATATAAAAATCTAAAACACAAATCATGGGAACCATTCTTGCNCATTGCAGGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCACAACAACCTTTGAAAATATACTCAGAGAGAATTTTGTGCAGGATATATCTAACATTTTCACAATAATACAGAACCACATTTTAAATCAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCGCCCAATGCTGTATAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATACGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAATTATATTGTT
  3   1   2       ext Spl1 PIPE out                        CABK1890.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTAAATATAAGTGTATATACATGTATATAAAAATCTAAAACACAAATCATGGGAACCATTCTTGCNCATTGCAGGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCACAACAACCTTTGAAAATATACTCAGAGAGAATTTTGTGCAGGATATATCTAACATTTTCACAATAATACAGAACCACATTTTAAATCAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCGCCCAATGCTGTATAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATACGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAATTATANAAAAAAAAACCTCTCGCCCTATA
  5  -1   2       ext Hrt1      in                        CAAQ11769.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACACAAATCATGGGAACCATTCTTGCCCATTGCAGGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCACAACAACCTTTGAAAATATACTCAGAGAGAATTTTGTGCAGGATATATCTAACATTTTCACAATAATACAGAACCACATTTTAAATCAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCGCCCAATGCTGTATAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATACGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTG
  3   1   3        nb Brn2      out                       CAAJ19843.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCNCATGCAGGGGACAGGATGCTGAACACTTCAGGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTGNACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCACAACAACCTTTGAAAATATACTCAGAGAGAATTTTGTGCAGGATATATCTAACATTTTCACAATAATACAGAACCACATTTTAAATCAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCACCCAATGCTGTATAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATACGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAAT
  3   1   2       add Te5       in                        CAAO10679.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCNCATGCAGGGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCAGAACAACCTTCGAAAATATACTCAAATCAAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCGCCCAATGCTGTAGAACTGCACCCGTATTAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATAAGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAATT
  3   1   2       ext Sto1      in                        CABG11917.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCCCATTGCAGGGACAGGATGCTGAACACTTNCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCACAACAACCTTTGAAAATATACTCAGAGAGAATTTTGTGCAGGATATATCTAACATTTTCACAATAATACAGAACCACATTTTAAATCAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCGCCCAATGCTGTATAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATACGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAATTATATGTT
  5  -1   3        nb Eye       in                          CCAX745.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCACAACAACCTTTGAAAATATACTCAGAGAGAATTTTGTGCAGGATATATCTAACATTTTCACAATAATACAGAACCACATTTTAAATCAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCGCCCAATGCTGTATAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATACGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAATTAA
  5   1   3        nb Thy1      in                        CBST1102.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCACAACAACCTTTGAAAATATACTCAGAGAGAATTTTGTGCAGGATATATCTAACATTTTCACAATAATACAGAACCACATTTTAAATCAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCGCCCAATGCTGTATAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATACGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAATTAT
  3   1   3        nb Thy1      in                        CBST1102.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCACAACAACCTTTGAAAATATACTCAGAGAGAATTTTGTGCAGGATATATCTAACATTTTCACAATAATACAGAACCACATTTTAAATCAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCGCCCAATGCTGTATAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATACGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAATTAT
  3   1   3        nb Limb      out                       CBSU4965.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCAGGACATATACTGTATTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCACAACAACCTTTGAAAATATACTCAGAGAGAATTTTGTGCAGGATATATCTAACATTTTCACAATAATACAGAACCACATTTTAAATCAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCACCCAATGCTGTATAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATACGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAATTATATTGT
  3   1   3        nb Spl2      in                       CBSS10493.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCACAACAACCTTTGAAAATATACTCAGAGAGAATTTTGTGCAGGATATATCTAACATTTTCACAATAATACAGAACCACATTTTAAATCAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTTTGACACACCTCCCGCCCAATGCTGTATAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATACGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAATT
  5   1   3        nb Bone      ?                          CBTC692.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCACAACAACCTTTGAAAATATACTCAGAGAGAATTTTGTGCAGGATATATCTAACATTTTCACAATAATACAGAACCACATTTTAAATCAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCACCCAATGCTGTATAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATACGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAATTATATTGTTA
  3   1   2       ext Bone      in                        CBTC2967.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATTTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCACAACAACCTTTGAAAATATACTCAGAGAGAATTTTGTGCAGGATATATTTAACATTTTCCCAATAATACAGAACCCCATTTTAAATCAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCATTTTGACACACCTCCCGCCCAATGCTGTATAACTGCACCCGTATCAGACAAAATCTATTTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATAAGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAATTTTTTTGTT
  3   1   2       ext Tad5      in                         XZT36834.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTTTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCACAACAACCTTTGAAAATATACTCAGAGAGAATTTTGTGCAGGATATATTTAACATTTTCCCAATAATACAGAACCCCATTTTAAATCAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCATTTTGACACACCTCCCACCCAATGCTGTATAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATACGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAATTATATTGTT
  3   1   2       ext Eye       in                         CCAX4414.g3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATATCAGCAAAGTTGGATTCATAGAAAGGGAATTCAAACTGGAAACCATTCATTCTGAACCAACGCCCAGTGCTAGATTGGGGCCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCACAACAACCTTTGAAAATATACTCAGAGAGAATTTTGTGCAGGATATATCTAACATTTTCACAATAATACAGAACCACATTTTAAATCAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTTTGACACACCTCCCGCCCAATGCTGTATAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATACGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAATTATATTGTTA
  3   1   2       ext Limb                                CBSU6462.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTAATAGCACTGCTCAATTCCTGTTTCTTTTTCTTTGTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTTTGACACACCTCCCGCCCAATGCGGTATAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATAAGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAATTATATTGTTAACAAAAAAAAAAAAAAAGGGCGA
  5   1   2  SIG                                    Xt7.1-TGas139g23.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGATAAGGGATCTCTCTGTAATTGTATCACTATACTTATTAAGTCTACTAAAAAATCATTTAAACCTTAATTAAACCCAAAAGGATTGCTTTTTATCCAGTAAGGATTAATTATAGTTGGGATAAAGCACAAGGTACTGTTTTATAATTACAGAGAAAAGGGAAATGTAATATTTATTTTACCGTTACTGGGTAAAGCAAATAGAAAATAATCACATTTTCATATGTCGGCCTTATCTTTCTTTAGAATTGCTATAATTTATTATAGTGCATGCCATATACAAAATTTAAATGCCTTCTATTTGTGCAACTGTGTTAATTCATTTCTTGCAGGTATGCTCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTCTGGTCATTTGGAGTAACCTTGTATGAACTGCTCACATACTGCAATTCAGAATACAGTCCTATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAAATGACGGTTACGAGACTTGTACGCGTGTTGGAAGAGGACAAGCGTTTGCCAATACCAGCAAACTGCCCAAAGCAGGTGTACCAGCTCATGCTCAAATGCTGGGAACAAAATCCAAGCCACCGCACCACTTTTCAGGACCTAATTAAAGGCTTTGAAGCTATTATAAATACTTTGTAGCCATATTGCTACACACTGGCGAAAGGACGATATTTAGACTTTCTAACTCTCGATGCTGCTCCTGTGGATGCATATTTTTGTTTTTATTCGCACTTCTATTTGTGATACCTGTCTTCTACATTTCTACTACTAGATAGGACAAAACTTTCTCCTATGCATTATTCCTTTTGGGGCTTCACAAAGAAAAGGTGGAAACATGTCAAGGAACTTACTGGCTCCTCCAGAAATGAACTCAATGTAGCAGAACTGTAAAACACCCCAGGCTTGCACAGCGTGCCAGATGCACACAGAGAGGCTTTGTCTTTCCTAAAACATATTCTATAACAGTTTCAGTTCTAACGTATCAAGTAAATATAAGTGTATATACATGTATATAAAAATCTAAAACACAAATCATGGGAACCATTCTTGCCCATTGCAGGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATGAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCAGAACAACCTTCGAAAATATACTCAAATCAAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCGCCCAATGCTGTAGAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATAAGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTAATAAAAAAAAA
                                                  Xt7.1-CHK-1008292826                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGATCTCTCTGTAATTGTATCACTATACTTATTAAGTCTACTAAAAAATCATTTAAACCTTAATTAAACCCAAAAGGATTGCTTTTTATCCAGTAAGGATTAATTATAGTTGGGATAAAGCACAAGGTACTGTTTTATAATTACAGAGAAAAGGGAAATGTAATATTTATTTTACCGTTACTGGGTAAAGCAAATAGAAAATAATCACATTTTCATATGTCGGCCTTATCTTTCTTTAGAATTGCTATAATTTATTATAGTGCATGCCATATACAAAATTTAAATGCCTTCTATTTGTGCAACTGTGTTAATTCATTTCTTGCAGGTATGCTCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTCTGGTCATTTGGAGTAACCTTGTATGAACTGCTCACATACTGCAATTCAGAATACAGTCCTATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAAATGACGGTTACGAGACTTGTACGCGTGTTGGAAGAGGACAAGCGTTTGCCAATACCAGCAAACTGCCCAAAGCAGGTGTACCAGCTCATGCTCAAATGCTGGGAACAAAATCCAAGCCACCGCACCACTTTTCAGGACCTAATTAAAGGCTTTGAAGCTATTATAAATACTTTGTAGCCATATTGCTACACACTGGCGAAAGGACGATATTTAGACTTTCTAACTCTCGATGCTGCTCCTGTGGATGCATATTTTTGTTTTTATTCGCACTTCTATTTGTGATACCTGTCTTCTACATTTCTACTACTAGATAGGACAAAACTTTCTCCTATGCATTATTCCTTTTGGGGCTTCACAAAGAAAAGGTGGAAACATGTCAAGGAACTTACTGGCTCCTCCAGAAATGAACTCAATGTAGCAGAACTGTAAAACACCCCAGGCTTGCACAGCGTGCCAGATGCACACAGAGAGGCTTTGTCTTTCCTAAAACATATTCTATAACAGTTTCAGTTCTAACGTATCAAGTAAATATAAGTGTATATACATGTATATAAAAATCTAAAACACAAATCATGGGAACCATTCTTGCCCATTGCAGGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATGAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCAGAACAACCTTCGAAAATATACTCAAATCAAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCGCCCAATGCTGTAGAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATAAGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTxAxxxAAAAAAAAAAAAA
  5   1   2   30  ext Spl2 5x3  out                       CBSS3473.fwd .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGATAAGGGATCTCTCTGTAATTGTATCACTATACTTATTAAGTCTACTAAAAAATCATTTAAACCTTAATTAAACCCAAAAGGATTGCTTTTTATCCAGTAAGGATTAATTATAGTTGGGATAAAGCACAAGGTACTGTTTTATAATTACAGAGAAAAGGGAAATGTAATATTTATTTTACCGTTACTGGGTAAAGCAAATAGAAAATAATCACATTTTCATATGTCGGCCTTATCTTTCTTTAGAATTGCTATAATTTATTATAGTGCATGCCATATACAAAATTTAAATGCCTTCTATTTGTGCAACTGTGTTAATTCATTTCTTGCAGGTATGCTCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTCTGGTCATTTGGAGTAACCTTGTATGAACTGCTCACATACTGCAATTCAGAATACAGTCCTATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAAATGACGGTTACGAGACTTGTACGCGTGTTGGAAGAGGACAAGCGTTTGCCAATACCAGCAAACTGCCCAAAGCAGGTGTACCAGCTCATGCTCAAATGCTGGGAACAAAATCCAAGCCACCGCACCACTTTTCAGGACCTAATTAAAGGCTTTGAAGCTATTATAAATACTTTGTAGCCATATTGCTACACACTGGCGAAAGGACGATATTTAGACTTTCTAACTCTCGATGCTGCTCCTGTGGATGCATATTTTTGTTTTTATTCGCACTTCTATTTGTGATACCTGTCTTCTACATTTCTACTACTAGATAGGACAAAACTTTCTCC
  5   1   2   10  ext Ski1 5g3  in                         CABJ6683.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................aaatcatttaaaccttaattaaacccaaaaggattgctttttatccagtaaggattaattatagttgggataaagcacaaggtactgttttataattacagagaaaagggaaatGTAATATTTATTTTACCGTTACTGGGTAAAGCAAATAGAAAATAATCACATTTTCATATGTCGGCCTTATCTTTCTTTAGAATTGCTATAATTTATTATAGTGCATGCCATATACAAAATTTAAATGCCTTCTATTTGTGCAACTGTGTTAATTCATTTCTTGCAGGTATGCTCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTCTGGTCATTTGGAGTAACCTTGTATGAACTGCTCACATACTGCAATTCAGAATACAGTCCTATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAAATGACGGTTACGAGACTTGTACGCGTGTTGGAAGAGGACAAGCGTTTGCCAATACCAGCAAACTGCCCAAAGCAGGTGTACCAGCTCATGCTCAAATGCTGGGAACAAAATCCAAGCCACCGCACCACTTTTCAGGACCTAATTAAAGGCTTTGAAGCTATTATAAATACTTTGTAGCCATATTGCTACACACTGGCGAAAGGACGATATTTAGACTTTCTAACTCTCGATGCTGCTCCTGTGGATGCATATTTTTGTTTTTATTCGCACTTCTATTTGTGATACCTGTCTTCTACATTTCTACTACTAGATAGGACAAAACTTTCTCCTATGCATTATTCCTTTTGGGGCTTCACAAAGAAAAGGTGGAAACATGTCAAGGAACTTACTGGCTCC
  5   1   4   10 seed Hrt1 5g3  in                         CAAQ3625.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCCATCGATTCGATTTGGAGTAACCTTGTATGAACTGCTCACATACTGCAATTCAGAATACAGTCCTATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAAATGACGGTTACGAGACTTGTACGCGTGTTGGAAGAGGACAAGCGTTTGCCAATACCAGCAAACTGCCCAAAGCAGGTGTACCAGCTCATGCTCAAATGCTGGGAACAAAATCCAAGCCACCGCACCACTTTTCAGGACCTAATTAAAGGCTTTGAAGCTATTATAAATACTTTGTAGCCATATTGCTACACACTGGCGAAAGGACGATATTTAGACTTTCTAACTCTCGATGCTGCTCCTGTGGATGCATATTTTTGTTTTTATTCGCACTTCTATTTGTGATACCTGTCTTCTACATTTCTACTACTAGATAGGACAAAACTTTCTCCTATGCATTATTCCTTTTGGGGCTTCACAAAGAAAAGGTGGAAACATGTCAAGGAACTTACTGGCTCCTCCAGAAATGAACTCAATGTAGCAGAACTGTAAAACACCCCAGGCTTGCACAGCGTGCCAGATGCACACAGAGAGGCTTTGTCTTTCCTAAAACATATTCTATAACAGTTTCAGTTCTAACGTATCAAGTAAATATAAGTGTATATACATGTATATAAAAATCTAAAACACAAATCATGGGAACCATTCTTGCCCATTGCAGGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCATTCCAGGCAAATATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAG
  3   1   2       ext Gas       ?                     TGas139g23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCACAGCGTGCCAGATGCACACAGAAAGGCTTTGTCTTTCCTAAAACATATTCTATAACAGTTTCAGTTCTAACGTATCAAGTAAATATAAGTGTATATACATGTATATAAAAATCTAAAACACAAATCATGGGAACCATTCTTGCCCATTGCAGGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATAAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCAGAACAACCTTCGAAAATATACTCAAATCAAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCGCCCAATGCTGTAGAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATAAGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTGAATAAAAAAAAAAAAAAAAAAA
  3   1   4      seed Hrt1 5g3  in                         CAAQ3625.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAGTAATATAAAGTGTATATACATGTATATAAAAATCTAAAACACAAATCATGGGAACCATTCTTGCCCATTGCAGGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATGAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCAGAACAACCTTCGAAAATATACTCAAATCAAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCGCCCAATGCTGTAGAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATAAGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAATTAT
  3   1   2       ext Ski1 5g3  in                         CABJ6683.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCNCATTGCAGGGACAGGATGCTGAACACTTTCAGGACATATACTGTATTTTGCAGGCAAATTGGCTTAACCAGTAGTTTTTGACAAAGGAATACATTGGCTTATTGTGCATAATACTTGGTTGTTCTTACATAGCAACAGTTTTTCTGCAATTCCAGGCAATAATAATTGTCATTATGTTAAGCATATCAGCAAGTTGGATTCATAGAAAGGAATTCAAACTGGAACCATTCATTCTGAACCACGCCCAGTGCTAGATTGGGGCCTACATTACCAGATGTTGCAGATAGTTGCACCTATGTACCATTTTATCACACAGGGCTGTGATTGTTTTATGGAAACGGCACAGTCCCTAAAAGTATGTTATATCAGTGTAACACAGAGATCTCCGTATGAATAAGGATCAGTAACACATAAGATACATTTGCATCACCCAGAACAACCTTCGAAAATATACTCAAATCAAAAATGTAGTTTTTTTTAAAAGTGAAATGTGCTTTCGGCCCTAATAGCACCGCTCAATTCCTGTTTCTTTCTCTTTTTATACCAAATGTTGGAGCCCAACAAAATGCAATAATTACAAGCACTCTGACACACCTCCCGCCCAATGCTGTAGAACTGCACCCGTATCAGACAAAATCTATCTTTTGTTTTCCTCAGGCTCCTGTTAGTTACATATAAGTTTCCCTTCATGAAGAGGTCTGTACTGTGCCATGGTTCATATTTTAATAAAGAGTTTGAATTATATTGTTAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)