Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 93%

 1012076007 Xt7.1-TNeu065m05.3 - 34 ESTs
                                                                       ........-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TNeu065m05.3                             AAGTGCCTAGCTGAATCCGGAAGTGCCGGAGCCGCCATGTCACCTTCAGGGATGCTGGTGCGGCGGGTACACAGGGCCCTGGCACGGAATCTGGTTGGAGCCCATGTATTTCCCAGCAGGCTTTGGAGCAGCGCTCTCTCTCCTGCCCAGGACGCCCCCAGGGAAGTGTTCCGTACCAGCGAGACCGACCCGGGGGCGCACACGGAGCAACACGAGGGGCAATTCTACTCGCTGTCGGCACAGGACGTGAGAGCCGCATTCCCCCAGGGCCTTCCCTGGCGCTTCCAGCAGCAGAGCAAGACCTTCAATGAGACGTGCGTGATGGTGCGCCGGCCCGCCATAGAACTGCTCCGGTACCTGAGGAACTCTGACCCGACCCAGCCGGCTGTGCGCTACGTCCTCTATGGCAAGAGAGGAACGGGCAAGAGTCTGACCCTGTGCCACATTGTGCATTACTGTCACACCCAAGGCTGGCTGCTCCTACAGGTGCCCGATGCTCACGTCCTGGTGAAGAACTGTAAGGAGCTCATGCCCTCCTCCTTCCATAGCAACAGGTTCGACCAACCCTTGGAAGCCTCCAATTGGCTGAAGAACTTTAAAGCCACCAATGAGCACTTCCTCAAGCAGATCCGTACCAACCAGCGATACGTGTGGAGCAAGCGGGAAGCCACAGACGAGGGCAGACCCCTGGGGGAGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGGGCGTGGTTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTATCAGGAAGGAGGACAAGAGTTTGGTGCCTCCGGAGGAGCTGACCCTGGTGCACAATCTGAGGAAGATGGTGCAGAATGACTGGACAGGGGGCGCTATAGTCCTGACTGTGACCCAGGCTGGATCCCTGTACACCCCTGCCTGCGCCTATCTGCCCCATCATCTGCTGGGAAAGGAGGGGTTCGATGCCCTGGACCCGTTTGTGCCCATCCAGGTGCCCAATTACAATGAGAAGGAGTTTGAGAGCTGCTATCAGTACTACCTGGAGCGCAAGTGGCTGCAGCACCACAAAGCCCATACGCCGGAAGGGAAGGCCGAGTTGCGGTTCCTGAGTGATTCCAACCCAAAGCAGCTGGATAAGATCTGCGCCTTCCTCTGACCCCTCCCACTGGGCGGGGCTTATCGGAATTACCCCATTGTGGGGCAGTGACTGTGGGGGTTGCCCAGTGAAGCCATAGTGGGACTATTAATGAGATTGTATGGGCCTGACCCAGGCACGGGCGGTTCTGCCCCTCACGTACTTCCCTATGTATAATAGCCCCCGACTGGGGCAGGAACGGAGCCCCCTACTGACAAGGAGCCTATAAAGCATGTTTTG
                                                  Xt7.1-CHK-1008227536                                   CTAGCTGAATCCGGAAGTGCCGGAGCCGCCATGTCACCTTCAGGGATGCTGGTGCGGCGGGTACACAGGGCCCTGGCACGGAATCTGGTTGGAGCCCATGTATTTCCCAGCAGGCTTTGGAGCAGCGCTCTCTCTCCTGCCCAGGACGCCCCCAGGGAAGTGTTCCGTACCAGCGAGACCGACCCGGGGGCGCACACGGAGCAACACGAGGGGCAATTCTACTCGCTGTCGGCACAGGACGTGAGAGCCGCATTCCCCCAGGGCCTTCCCTGGCGCTTCCAGCAGCAGAGCAAGACCTTCAATGAGACGTGCGTGATGGTGCGCCGGCCCGCCATAGAACTGCTCCGGTACCTGAGGAACTCTGACCCGACCCAGCCGGCTGTGCGCTACGTCCTCTATGGCAAGAGAGGAACGGGCAAGAGTCTGACCCTGTGCCACATTGTGCATTACTGTCACACCCAAGGCTGGCTGCTCCTACAGGTGCCCGATGCTCACGTCCTGGTGAAGAACTGTAAGGAGCTCATGCCCTCCTCCTTCCATAGCAACAGGTTCGACCAACCCTTGGAAGCCTCCAATTGGCTGAAGAACTTTAAAGCCACCAATGAGCACTTCCTCAAGCAGATCCGTACCAACCAGCGATACGTGTGGAGCAAGCGGGAAGCCACAGACGAGGGCAGACCCCTGGGGGAGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGGGCGTGGTTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTATCAGGAAGGAGGACAAGAGTTTGGTGCCTCCGGAGGAGCTGACCCTGGTGCACAATCTGAGGAAGATGGTGCAGAATGACTGGACAGGGGGCGCTATAGTCCTGACTGTGACCCAGGCTGGATCCCTGTACACCCCTGCCTGCGCCTATCTGCCCCATCATCTGCTGGGAAAGGAGGGGTTCGATGCCCTGGACCCGTTTGTGCCCATCCAGGTGCCCAATTACAATGAGAAGGAGTTTGAGAGCTGCTATCAGTACTACCTGGAGCGCAAGTGGCTGCAGCACCACAAAGCCCATACGCCGGAAGGGAAGGCCGAGTTGCGGTTCCTGAGTGATTCCAACCCAAAGCAGCTGGATAAGATCTGCGCCTTCCTCTGACCCCTCCCACTGGGCGGGGCTTATCGGAATTACCCCATTGTGGGGCAGTGACTGTGGGGGTTGCCCAGTGAAGCCATAGTGGGACTATTAATGAGATTGTATGGGCCTGACCCAGGCACGGGCGGTTCTGCCCCTCACGTACTTCCCTATGTATAATAGCCCCCGACTGGGGCAGGAACGGAGCCCCCTACTGACAAGGAGCCTATAAAGCATGTTTTGTACAAG
                                                      consensus depths                                  2     3     2     4     3     5     7     8    10    11    11    12    11    12    11    12    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    15    15    15    15    15    15    15    15    16    15    16    15    16    15    16    15    16    15    16    15    16    14    15    14    15    14    16    14    16    14    16    14    16    14    16    14    16    14    16    14    16    14    16    14    17    16    19    16    19    16    19    16    20    16    21    15    20    17    21    17    21    18    23    18    23    18    23    18    23    18    23    21    25    20    24    20    24    21    25    21    24    20    24    20    24    19    23    17    21    15    19    15    18    15    18    14    17    14    17    15    17    15    17    17    18    17    18    17    18    17    18    17    18    17    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    17    18    18    18    18    18    18    18    17    17    16    17    16    17    16    17    16    16    16    16    16    16    16    16    16    16    17    18    17    18    17    18    18    18    18    18    18    18    17    17    17    17    17    17    16    17    16    17    15    17    15    16    14    15    13    15
                                                                   SNP                                                                                                                                                                                                                                                                             -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------T--
                                               BLH ATG      36     166                             
                                               BLH MIN      36     108                             
                                               BLH MPR       0     108                             
                                               BLH OVR      36     129                             
                                               EST CLI      25       8                             
                                               ORF LNG      36      18                             
                                                                                                                                                                                                                     PREDICTED - Ce ---- 1e-061     NP_496280.1 Cell death associated protein, similar to mammalian death associated protein 3(42.8 kD) (dap-3) [Caenorhabditis elegans] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Dr ---- 4e-062     XP_687393.1 PREDICTED: similar to death-associated protein 3 [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                PROTEIN --- Dm ---- 9e-078     NP_523811.1 CG3633-PA [Drosophila melanogaster] --===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                   PREDICTED - Sp ---- 1e-094     XP_786479.2 PREDICTED: similar to death associated protein 3 [Strongylocentrotus purpuratus] -----------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                           PROTEIN --- Hs ---- 2e-141     NP_004623.1 death associated protein 3; mitochondrial 28S ribosomal protein S29 [Homosapiens] -============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                PROTEIN --- Mm ---- 4e-142     NP_075370.1 death associated protein 3 [Mus musculus] --------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                 PREDICTED = Gg ==== 2e-143     XP_422859.2 PREDICTED: hypothetical protein [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                       PROTEIN === Xt ==== 0          NP_001016002.1 death associated protein 3 [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TNeu065m05.3                                                                 ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------TGA---------------------------------------ATG------------------------------------------------------------TAATAG
                                                                   ORF                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  0   1   1           Neu  FL                     TNeu065m05.FL-Sanger CGGCGCACCCACTACTGCGCAGGGACGGAAGTGCCTAGCTGAATCCGGAAGTGCCGGAGCCGCCATGTCACCTTCAGGGATGCTGGTGCGGCGGGTACACAGGGCCCTGGCACGGAATCTGGTTGGAGCCCATGTATTTCCCAGCAGGCTTTGGAGCAGCGCTCTCTCTCCTGCCCAGGACGCCCCCAGGGAAGTGTTCCGTACCAGCGAGACCGACCCGGGGGCGCACACGGAGCAACACGAGGGGCAATTCTACTCGCTGTCGGCACAGGACGTGAGAGCCGCATTCCCCCAGGGCCTTCCCTGGCGCTTCCAGCAGCAGAGCAAGACCTTCAATGAGACGTGCGTGATGGTGCGCCGGCCCGCCATAGAACTGCTCCGGTACCTGAGGAACTCTGACCCGACCCAGCCGGCTGTGCGCTACGTCCTCTATGGCAAGAGAGGAACGGGCAAGAGTCTGACCCTGTGCCACATTGTGCATTACTGTCACACCCAAGGCTGGCTGCTCCTACAGGTGCCCGATGCTCACGTCCTGGTGAAGAACTGTAAGGAGCTCATGCCCTCCTCCTTCCATAGCAACAGGTTCGACCAACCCTTGGAAGCCTCCAATTGGCTGAAGAACTTTAAAGCCACCAATGAGCACTTCCTCAAGCAGATCCGTACCAACCAGCGATACGTGTGGAGCAAGCGGGAAGCCACAGACGAGGGCAGACCCCTGGGGGAGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGGGCGTGGTTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTATCAGGAAGGAGGACAAGAGTTTGGTGCCTCCGGAGGAGCTGACCCTGGTGCACAATCTGAGGAAGATGGTGCAGAATGACTGGACAGGGGGCGCTATAGTCCTGACTGTGACCCAGGCTGGATCCCTGTACACCCCTGCCTGCGCCTATCTGCCCCATCATCTGCTGGGAAAGGAGGGGTTCGATGCCCTGGACCCGTTTGTGCCCATCCAGGTGCCCAATTACAATGAGAAGGAGTTTGAGAGCTGCTATCAGTACTACCTGGAGCGCAAGTGGCTGCAGCACCACAAAGCCCATACGCCGGAAGGGAAGGCCGAGTTGCGGTTCCTGAGTGATTCCAACCCAAAGCAGCTGGATAAGATCTGCGCCTTCCTCTGACCCCTCCCACTGGGCGGGGCTTATCGGAATTACCCCATTGTGGGGCAGTGACTGTGGGGGTTGCCCAGTGAAGCCATAGTGGGACTATTAATGAGATTGTATGGGCCTGACCCAGGCACGGGCGGTTCTGCCCCTCACGTACTTCCCTATGTATAATAGCCCCCGACTGGGGCAGGAACGGAGCCCCCTACTGACAAGGAGCCTATAAAGCATGTTTTGTACAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu  FL   in                   TNeu065m05.p1cSP6 CGGCGCACCCACTACTGCGCAGGGACGGAAGTGCCTAGCTGAATCCGGAAGTGCCGGAGCCGCCATGTCACCTTCAGGGATGCTGGTGCGGCGGGTACACAGGGCCCTGGCACGGAATCTGGTTGGAGCCCATGTATTTCCCAGCAGGCTTTGGAGCAGCGCTCTCTCTCCTGCCCAGGACGCCCCCAGGGAAGTGGGCCGTACCAGCGAGACCGACCCGGGGGCGCACACGGAGCAACACGAGGGGCAATTCTACTCGCTGTCGGCACAGGACGTGAGAGCCGCATTCCCCCAGGGCCTTCCCTGGCGCTTCCAGCAGCAGAGCAAGACCTTCAATGAGACGTGCGTGATGGTGCGCCGGCCCGCCATAGAACTGCTCCGGTACCTGAGGAACTCTGACCCGACCCAGCCGGCTGTGCGCTACGTCCTCTATGGCAAGAGAGGAACGGGCAAGAGTCTGACCCTGTGCCACATTGTGCATTACTGTCACACCC
  5   1   2       chi Te5       in                         CAAO8346.5p                 CCTAGCTGAATCCGGAAGTGCCGGAGCCGCCATGTCACCTTCAGGGATGCTGGTGCGGCGGGTACACAGGGCCCTGGCACGGAATATTTTGCTGCCTTCCAGCTGGTTGGAGCCCATGTATTTCCCAGCAGGCTTTGGAGCAGCGCTCTCTCTCCTGCCCAGGACGCCCCCAGGGAAGTGTTCCGTACCAGCGAGACCGACCCGGGGGCGCACACGGAGCAACACGAGGGGCAATTCTACTCGCTGTCGGCACAGGACGTGAGAGCCGCATTCCCCCAGGGCCTTCCCTGGCGCTTCCAGCAGCAGAGCAAGACCTTCAATGAGACGTGCGTGATGGTGCGCCGGCCCGCCATAGAACTGCTCCGGTACCTGAGGAACTCTGACCCGACCCAGCCGGCTGTGCGCTACGTCCTCTATGGCAAGAGAGGAACGGGCAAGAGTCTGACCCTGTGCCACATTGTGCATTACTGTCACACCCAAGGCTGGCTGCTCCTACAGGTGCCCGATGCTCACGTCCTGGTGAAGAACTGTAAGGAGCTCATGCCCTCCTCCTTCCATAGCAACAGGTTCGACCAACCCTTGGAAGCCTCCAATTGGCTGAAGAACTTTAAAGCCACCAATGAGCACTTCCTCAAGCAGATCCGTACCAACCAGCGATACGTGTGGAGCAAGCGGGAAGCCACAGACGAGGGCAGACCCCTGGGGGAGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGNGCGTGGTTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTATCA
  5   1   2   14  bld Te5  5g3  in                         CAAO5924.5p ...........................GAAGTGCCTAGCTGAATCCGGAAGTGCCGGAGCCGCCATGTCACCTTCAGGGATGCTGGTGCAGCGGGTACACAGGGCCCTGGCACGGAATCTGGTTGGAGCCCATGTATTTCCCAGCAGGCTTTGGAGCAGCGCTCTCTCTCCTGCCCAGGACGCCCCCAGGGAAGTGTTCCGTACCAGCGAGACCGACCCGGGGGCGCACACGGAGCAACACGAGGGGCAATTCTACTCGCTGTCGGCACAGGACGTGAGAGCCGCATTCCCCCAGGGCCTTCCCTGGCGCTTCCAGCAGCAGAGCAAGACCTTCAATGAGACGTGCGTGATGGTGCGCCGGCCCGCCATAGAACTGCTCCGGTACCTGAGGAACTCTGACCCGACCCAGCCGGCTGTGCGCTACGTCCTCTATGGCAAGAGAGGAACGGGCAAGAGTCTGACCCTGTGCCACATTGTGCATTACTGTCACACCCAAGGCTGGCTGCTCCTACAGGTGCCCGATGCTCACGTCCTGGTGAAGAACTGTAAGGAGCTCATGCCCTCCTCCTTCCATAGCAACAGGTTCGACCAACCCTTGGAAGCCTCCAATTGGCTGAAGAACTTTAAAGCCACCAATGAGCACTTCCTCAAGCAGATCCGTACCAACCAGCGATACGTGTGGAGCAAGCGGGAAGCCACAGACGAGGGCAGACCCCTGGGGGAGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGNGCGTGGTTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTATCAGGAAGGGAGGACAGAG
  5   1   2       bld Gas  5g                        TGas142n01.p1kSP6                                      CTGAATCCGGAAGTGCCGGAGCCGCCATTGTCACCTTCAGGGATGCTGGTGCGGCGGGTACACAGGGCCCTGGCACGGAATCTGGTTGGAGCCCATGTATTTCCCAGCAGGCTTTGGAGCAGCGCTCTCTCTCCTGCCCAGGACGCCCCCAGGGAAGTGTTCCGTACCAGCGAGACCGACCCGGGGGCGCACACGGAGCAACACGAGGGGCAATTCTACTCGCTGTCGGCACAGGACGTGAGAGCCGCATTCCCCCAGGGCCTTCCCTGGCGCTTCCAGCAGCAGAGCAAGACCTTCAATGAGACGTGCGTGATGGTGCGCCGGCCCGCCATAGAACTGCTCCGGTACCTGAGGAACTCTGACCCGACCCAGCCGGCTGTGCGCTACGTCCTCTATGGCAAGAGAGGAACGGGCAAGAGTCTGACCCTGTGCCACATTGTGCATTACTGTCACACCCAAGGCTGGCTGCTCCTACAGGTGCCCGACGCTCACGTCCTGGTGAAGAACTGTAAGGAGCTCATGCCCTCCTCCTTCCATAGCAACAGGTTCGACCAACCCTTGGAAGCCTCCAATTGGCTGAAGAACTTTAAAGCCACCAATGAGCACTTCCTCAAGCAGATCCGTACCAACCAGCGATACGTGTGGAGCAAGCGGGA
  5   1   2       chi Tad5 5x                              XZT39537.5p                                               GGAAGTGCCGGAGCCGCCATGTCACCTTCAGGGATGCTGGTGCGGCGGGTACACAGGGCCCTGGCACGGAATCTGGTTGGAGCCCATGTATTTCCCAGCAGGCTTTGGAGCAGCGCTCTCTCTCCTTCCCAGGACGCCCCCAGGGAAGTGTTCCGTACCAGCGAGACCGACCCGGGGGCGCACACGGAGCAACACGAGGGGCAATTCTACTCGCTGTCGGCACAGGACGTGAGGGCCACATTCCCCCAGGGCCTTCCCTGGCGCTTCCAGCAGCAGAGCAAGACCTTCAATGAGACGTGCGTGATGGTGCGCCGGCCCGCCATAGAACTGCTCCGGTACCTGAGGAACTCTGACCCGACCCAGCCGGCTGTGCGCTACGTCCTCTGTATCCTTACGCCCTGCTATATACATATATATATATGTATGTGTGTATCCTTACGCCGTGCTATATACACGTATGTGCGTGCTACATACCCAGCAATCTCTATGGTCTTCCTCCGCGGGGGCGGGGTCACTTGGGATCCTCTAGGGTGTTTGCTTAACCAATGGCACCTCAGATGGCAAGAGAGGAACGGGCAAGAGTCTGACCCTGTGCCACATTGTGCATTACTGTCACACCCAAGGCTGGCTGCTCCTACAGGTGCCCGATGCTCACGTCCTGGTGAAGAACTGTAAGGAGCTCATGCCCTCCTCCTTCCATAGCAACAGGTTCGACCAACCCTTGGAAGCCTCCAATTGGCTGAAGAACTTTAAAGCCACCAATGAGCACTTCCTCAAGCAGGTGGGT
  5   1   2       bld Te5       in                         CAAO5672.5p                                                      CCGGAGCCGCCATGTCACCTTCAGGGATGCTGGTGCAGCGGGTACACAGGGCCCTGGCACGGAATCTGGTTGGAGCCCATGTATTTCCCAGCAGGCTTTGGAGCAGCGCTCTCTCTCCTGCCCAGGACGCCCCCAGGGAAGTGTTCCGTACCAGCGAGACCGACCCGGGGGCGCACACGGAGCAACACGAGGGGCAATTCTACTCGCTGTCGGCACAGGACGTGAGAGCCGCATTCCCCCAGGGCCTTCCCTGGCGCTTCCAGCAGCAGAGCAAGACCTTCAATGAGACGTGCGTGATGGTGCGCCGGCCCGCCATAGAACTGCTCCGGTACCTGAGGAACTCTGACCCGACCCAGCCGGCTGTGCGCTACGTCCTCTATGGCAAGAGAGGAACGGGCAAGAGTCTGACCCTGTGCCACATTGTGCATTACTGTCACACCCAAGGCTGGCTGCTCCTACAGGTGCCCGATGCTCACGTCCTGGTGAAGAACTGTAAGGAGCTCATGCCCTCCTCCTTCCATAGCAACAGGTTCGACCAACCCTTGGAAGCCTCCAATTGGCTGAAGAACTTTAAAGCCACCAATGAGCACTTCCTCAAGCAGATCCGTACCAACCAGCGATACGTGTGGAGCAAGCGGGAAGCCACAGACGAGGGCAGACCCCTGGGGGAGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGGGCGTGGTTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTATCAGGAAGGAGGACAAGAGTTTGGTGC
  5   1   2   10  bld Te1  5g3  in                        CBWN11256.b1 .......................................................GGAGCCGCCATGTCACCTTCAGGGATGCTGGTGCGGCGGGTACACAGGGCCCTGGCACGGAATCTGGTTGGAGCCCATGTATTTCCCAGCAGGCTTTGGAGCAGCGCTCTCTCTCCTGCCCAGGACGCCCCCAGGGAAGTGTTCCGTACCAGCGAGACCGACCCGGGGGCGCACACGGAGCAACATGAGGGGCAATTCTACTCGCTGTCGGCGCAGGACGTGAGGGCCGCATTCCCCCAGGGCCTTCCCTGGCGCTTCCAGCAGCAGAGCAAGACCTTCAATGAGACGTGCGTGATGGTGCGCCGGCCCGCCATAGAACTGCTCCGGTACCTGAGGAACTCTGACCCGACCCAGCCGGCTGTGCGCTACGTCCTCTATGGCAAGAGAGGAACGGGCAAGAGTCTGACCCTGTGCCACATTGTGCATTACTGTCACACCCAAGGCTGGCTGCTCCTACAGGTGCCCGACGCTCACGTCCTGGTGAAGAACTGTAAGGAGCTCATGCCCTCCTCCTTCCATAGCAACAGGTTTGACCAACCCTTGGAAGCCTCCAATTGGCTGAAGAACTTTAAAGCCACCAATGAGCACTTCCTCAAGCAGATCCGTACCAACCAGCGATACGTGTGGAGCAAGCGGGAAGCCACCGACGAGGGCAGACCCCTGGGGGAGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGGGCGTGG
  5   1   2       bld Tbd0 5g3  in                       IMAGE:6976218                                                           GCCGCCATGTCACCTTCAGGGATGCTGGTGCGGCGGGTACACAGGGCCCTGGCACGGAATCTGGTTGGAGCCCATGTATTTCCCAGCAGGCTTTGGAGCAGCGCTCTCTCTCCTGCCCAGGACGCCCCCAGGGAAGTGTTCCGTACCAGCGAGACCGACCCGGGGGCGCACACGGAGCAACACGAGGGGCAATTCTACTCGCTGTCGGCACAGGACGTGAGAGCCGCATTCCCCCAGGGCCTTCCCTGGCGCTTCCAGCAGCAGAGCAAGACCTTCAATGAGACGTGCGTGATGGTGCGCCGGCCCGCCATAGAACTGCTCCGGTACCTGAGGAACTCTGACCCGACCCAGCCGGCTGTGCGCTACGTCCTCTATGGCAAGAGAGGAACGGGCAAGAGTCTGACCCTGTGCCACATTGTGCATTACTGTCACACCCAAGGCTGGCTGCTCCTACAGGTGCCCGATGCTCACGTCCTGGTGAAGAACTGTAAGGAGCTCATGCCCTCCTCCTTCCATAGCAACAGGTTCGACCAACCCTTGGAAGCCTCCAATTGGCTGAAGAACTTTAAAGCCACCAATGAGCACTTCCTCAAGCAGATCCGTACCAACCAGCGATACGTGTGGAGCAAGCGGGAAGCCACAGACGAGGGCAGACCCCTGGGGGGAGGTTAGTGGGATCAGGGNNACTGACGAGGGTGAAAGAGTGNCCAGTGACGCANNTGGGCGTGGGTTCTGAAAAGAGTTAAAGAGACAGTTCCGGGGGGAGGGAGCATATCCAGATGGTTGGGTCTCAGTTCGATGGGAGTTTAACCGCTCTGTGGGGGCAGGGAGCACTATTCAGGGAAGGANGGACAAAGAGTTTTGGGTGCCCTCCGGGAGGGAGCTGACCCCTGGGTGCACAATTCTTGAGGGAAGA
  5   1   2       bld TpA       in                   TTpA061i20.p1kSP6                                                                    TCACCTTCAGGGATGCTGGTGCGGCGGGTACACAGGGCCCTGGCACGGAATCTGGTTGGAGCCCATGTATTTCCCAGCAGGCTTTGGAGCAGCGCTCTCTCTCCTTCCCAGGACGCCCCCAGGGAAGTGTTCCGTACCAGCGAGACCGACCCGGGGGCGCACACGGAGCAACACGAGGGGCAATTCTACTCGCTGTCGGCACAGGACGTGAGGGCCACATTCCCCCAGGGCCTTCCCTGGCGCTTCCAGCAGCAGAGCAAGACCTTCAATGAGACGTGCGTGATGGTGCGCCGGCCCGCCATAGAACTGCTCCGGTACCTGAGGAACTCTGACCCGACCCAGCCGGCTGTGCGCTACGTCCTCTATGGCAAGAGAGGAACGGGCAAGAGTCTGACCCTGTGCCACATTGTGCATTACTGTCACACCCAAGGCTGGCTGCTCCTACAGGTGCCCGATGCTCACGTCCTGGTGAAGAACTGTAAGGAGCTCATGCCCTCCTCCTTCCATAGCAACAGGTTCGACCAACCCTTGGAAGCCTCCAATTGGCTGAAGAACTTTAAAGCCACCAATGAGCACTTCCTCAAGCAGATCCGTACCAACCAGCGATACGTGTGGAGCAAGCGGGAAGCCACAGACGAGGGCAGACCCCTGGGGGAGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGGGCGTGGTTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTCTCAGGAAGGAGGTACAGAGTTTGGTGCCTCCGGAGGAGCTGACCCTGGTGCACATCTG
  5   1   2       bld Te5       in                        CAAO10299.5p                                                                    TCACCTTCAGGGATGCTGGTGCGGCGGGTACACAGGGCCCTGGCACGGAATCTGGTTGGAGCCCATGTATTTCCCAGCAGGCTTTGGAGCAGCGCTCTCTCTCCTGCCCAGGACGCCCCCAGGGAAGTGTTCCGTACCAGCGAGACCGACCCGGGGGCGCACACGGAGCAACACGAGGGGCAATTCTACTCGCTGTCGGCACAGGACGTGAGAGCCGCATTCCCCCAGGGCCTTCCCTGGCGCTTCCAGCAGCAGAGCAAGACCTTCAATGAGACGTGCGTGATGGTGCGCCGGCCCGCCATAGAACTGCTCCGGTACCTGAGGAACTCTGACCCGACCCAGCCGGCTGTGCGCTACGTCCTCTATGGCAAGAGAGGAACGGGCAAGAGTCTGACCCTGTGCCACATTGTGCATTACTGTCACACCCAAGGCTGGCTGCTCCTACAGGTGCCCGATGCTCACGTCCTGGTGAAGAACTGTAAGGAGCTCATGCCCTCCTCCTTCCATAGCAACAGGTTCGACCAACCCTTGGAAGCCTCCAATTGGCTGAAGAACTTTAAAGCCACCAATGAGCACTTCCTCAAGCAGATCCGTACCAACCAGCGATACGTGTGGAGCAAGCGGGAAGCCACAGACGAGGGCAGACCCCTGGGGGAGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGGGCGTGGTTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTATCAGGAAGGAG
  5   1   2       bld Tail      in                         CBSW3671.b1                                                                             GGGATGCTGGTGCGGCGGGTACACAGGGCCCTGGCACGGAATCTGGTTGGAGCCCATGTATTTCCCAGCAGGCTTTGGAGCAGCGCTCTCTCTCCTGCCCAGGACGCCCCCAGGGAAGTGTTCCGTACCAGCGAGACCGACCCGGGGGCGCACACGGAGCAACATGAGGGGCAATTCTACTCGCTGTCGGCGCAGGACGTGAGGGCCGCATTCCCCCAGGGCCTTCCCTGGCGCTTCCAGCAGCAGAGCAAGACCTTCAATGAGACGTGCGTGATGGTGCGCCGGCCCGCCATAGAACTGCTCCGGTACCTGAGGAACTCTGACCCGACCCAGCCGGCTGTGCGCTACGTCCTCTATGGCAAGAGAGGAACGGGCAAGAGTCTGACCCTGTGCCACATTGTGCATTACTGTCACACCCAAGGCTGGCTGCTCCTACAGGTGCCCGACGCTCACGTCCTGGTGAAGAACTGTAAGGAGCTCATGCCCTCCTCCTTCCATAGCAACAGGTTCGACCAACCCTTGGAAGCCTCCAATTGGCTGAAGAACTTTAAAGCCACCAATGAGCACTTCCTCAAGCAGATCCGTACCAACCAGCGATACGTGTGGAGCAAGCGGGAAGCCACCGACGAGGGCAGACCCCTGGGGGAGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGGGCGTGGTTCTGAAGGAGTTAAAGAGACAGT
  5   1   2       bld Gas7      in                         XZG54865.5p                                                                                        GCGGCGGGTACACAGGGCCCTGGCACGGAATCTGGTTGGAGCCCATGTATTTCCCAGCAGGCTTTGGAGCAGCGCTCTCTCTCCTGCCCAGGACGCCCCCAGGGAAGTGTTCCGTACCAGCGAGACCGACCCGGGGGCGCACACGGAGCAACACGAGGGGCAATTCTACTCGCTGTCGGCACAGGACGTGAGAGCCGCATTCCCCCAGGGCCTTCCCTGGCGCTTCCAGCAGCAGAGCAAGACCTTCAATGAGACGTGCGTGATGGTGCGCCGGCCCGCCATAGAACTGCTCCGGTACCTGAGGAACTCTGACCCGACCCAGCCGGCTGTGCGCTACGTCCTCTATGGCAAGAGAGGAACGGGCAAGAGTCTGACCCTGTGCCACATTGTGCATTACTGTCACACCCAAGGCTGGCTGCTCCTACAGGTGCCCGACGCTCACGTCCTGGTGAAGAACTGTAAGGAGCTCATGCCCTCCTCCTTCCATAGCAACAGGTTCGACCAACCCTTGGAAGCCTCCAATTGGCTGAAGAACTTTAAAGCCACCAATGAGCACTTCCTCAAGCAGATCCGTACCAACCAGCGATACGTGTGGAGCAAGCGGGAAGCCACAGACGAGGGCAGACCCCTGGGGGAGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGGGCGTGGTTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTATCAGGAAGGAGGACAAGAGTTTGGTG
  5   1   2       bld Tail      in                         CBSW9090.b1                                                                                                                          GTTGGAGCCCATGTATTTCCCAGCAGGCTTTGGAGCAGCGCTCTCTCTCCTGCCCAGGACGCCCCCAGGGAAGTGTTCCGTACCAGCGAGACCGACCCGGGGGCGCACACGGAGCAACACGAGGGGCAATTCTACTCGCTGTCGGCACAGGACGTGAGAGCCGCATTCCCCCAGGGCCTTCCCTGGCGCTTCCAGCAGCAGAGCAAGACCTTCAATGAGACGTGCGTGATGGTGCGCCGGCCCGCCATAGAACTGCTCCGGTACCTGAGGAACTCTGACCCGACCCAGCCGGCTGTGCGCTACGTCCTCTATGGCAAGAGAGGAACGGGCAAGAGTCTGACCCTGTGCCACATTGTGCATTACTGTCACACCCAAGGCTGGCTGCTCCTACAGGTGCCCGACGCTCACGTCCTGGTGAAGAACTGTAAGGAGCTCATGCCCTCCTCCTTCCATAGCAACAGGTTCGACCAACCCTTGGAAGCCTCCAATTGGCTGAAGAACTTTAAAGCCACCAATGAGCACTTCCTCAAGCAGATCCGTACCAACCAGCGATACGTGTGGAGCAAGCGGGAAGCCACAGACGAGGGCAGACCCCTGGGGGAGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGGGCGTGGTTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTATCAGGAAGGAGGACAAGA
  5   1   2       bld Tad0                               IMAGE:6983997                                                                                                                                               AGCAGGCTTTGGAGCAGCGCTCTCTCTCCTGCCCAGGACGCCCCCAGGGAAGTGTTCCGTACCAGCGAGACCGACCCGGGGGCGCACACGGAGCAACACGAGGGGCAATTCTACTCGCTGTCGGCACAGGACGTGAGAGCCGCATTCCCCCAGGGCCTTCCCTGGCGCTTCCAGCAGCAGAGCAAGACCTTCAATGAGACGTGCGTGATGGTGCGCCGGCCCGCCATAGAACTGCTCCGGTACCTGAGGAACTCTGACCCGACCCAGCCGGCTGTGCGCTACGTCCTCTATGGCAAGAGAGGAACGGGCAAGAGTCTGACCCTGTGCCACATTGTGCATTACTGTCACACCCAAGGCTGGCTGCTCCTACAGGTGCCCGACGCTCACGTCCTGGTGAAGAACTGTAAGGAGCTCATGCCCTCCTCCTTCCATAGCAACAGGTTCGACCAACCCTTGGAAGCCTCCAATTGGCTGAAGAACTTTAAAGCCACCAATGAGCACTTCCTCAAGCAGATCCGTACCAACCAGCGATACGTGTGGAGCAAGCGGGAAGCCACAGACGAGGGCAGACCCCTGGGGGAGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGGGCGTGGTTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTACGCTCTGTGGGGCAGGAGCACTATCAGGAAGGAGGACAAAGAGTTGGTGCCTCCCGGAGAGCTGAC
  5   1   2       bld Te4       in                        CAAN10699.5p                                                                                                                                                                                                                                                                                                                                                          CGTGATGGTGCGCCGGCCCGCCATAGAACTGCTCCGGTACCTGAGGAACTCTGACCCGACCCAGCCGGCTGTGCGCTACGTCCTCTATGGCAAGAGAGGAACGGGCAAGAGTCTGACCCTGTGCCACATTGTGCATTACTGTCACACCCAAGGCTGGCTGCTCCTACAGGTGCCCGATGCTCACGTCCTGGTGAAGAACTGTAAGGAGCTCATGCCCTCCTCCTTCCATAGCAACAGGTTCGACCAACCCTTGGAAGCCTCCAATTGGCTGAAGAACTTTAAAGCCACCAATGAGCACTTCCTCAAGCAGATCCGTACCAACCAGCGATACGTGTGGAGCAAGCGGGAAGCCACAGACGAGGGCAGACCCCTGGGGGAGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGGGCGTGGTTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTATCAGGAAGGAGGACAAGAGTTTGGTGCCTCCGGAGGAGCTGACCCTGGTGCACAATCTGAGGAAGATGGTGCAGAATGACTGGACAGGGGGCGCTATAGTCCTGACTGTGACCCAGGCTGGATCCCTGTACACCCCTGCCTGCGCCTATCTGCCCCATCATCTGCTGGGAAAGGAGGGGTTCGATGCCCTGGACCCGTTTGTGCCCATCCAGGTGCCCCATTACAATGAGAAGGAGTTTGAGAGCTGCTATCAGTACTACCTGGGAGCGCAGTGGCTGCAGCACCCACAAGCCCATACGCCGGAAGGGAAGGC
  5   1   2       bld Tad0                               IMAGE:6985136                                                                                                                                                                                                                                                                                                                                                                                                          AAGGCAGGGCTGGGTACCGGGTCCTGGAATTCCCGGGGATGGCAAGAGAGGAACGGGCAAGAGTCTGACCCTGTGCCACATTGTGCATTACTGTCACACCCAAGGCTGGCTGCTCCTACAGGTGCCCGATGCTCACGTCCTGGTGAAGAACTGTAAGGAGCTCATGCCCTCCTCCTTCCATAGCAACAGGTTCGACCAACCCTTGGAAGCCTCCAATTGGCTGAAGAACTTTAAAGCCACCAATGAGCACTTCCTCAAGCAGATCCGTACCAACCAGCGATACGTGTGGAGCAAGCGGGAAGCCACAGACGAGGGCAGACCCCTGGGGGAGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGGGCGTGGTTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTATCAGGAAGGAGGACAAGAGTTTGGTGCCTCCGGAGGAGCTGACCCTGGTGCACAATCTGAGGAAGATGGTGCAGAATGACTGGACAGGGGGCGCTATAGTCCTGACTGTGACCCAGGCTGGATCCCTGTACACCCCTGCCTGCGCCTATCTGCCCCATCATCTGCTGGGAAAGGAGGGGTTCGATGCCCTGGACCCGTTTGTGCCCATCCAGGTGCCCAATTACAATGAGAAGGAGTTTGAGAGCTGCTATCAGTACTACCTGGAGCGCAAGTGGCTGCAGCACCACAAAGCCCATACGCCGGAAAGGAAGGCCGAGTGCGGTTCCTGAGTGATTCNNAACCAAGCAGCTGGATAAGATCTGCGCCT
  5  -1   2       bld Tad0                               IMAGE:6982753                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGGGCAGGATTTGACACCTGTGCCCACATTGTGCATTACTTCAACCCCCAAAGCGGGGGTGTCTCTACAGGTGCCCGACGGCTCAAGTTCTGGGGAAGAACCGTAACGAGGTTCATGCCTTCTCCCTTCATAGGCAACCGGTTTGGACCAACCCTTGGAAAGCCTCCAATTGGCTGAAGAACTTTAAAGCCACCAATGAGCACTTCCCCAAGGCAGATCCGTACCAACCAGCGATACGTGTGAGCAAGCGGGAAGCCACAGACGAGGGCAGACCCCTGGGGGAGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGGCGCGTGGTTCTGAAGGAGTTAAAGAGACAGCCGGGGGGAGCAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACCCTCTGTGGGGCAGGAGCACTATCAGGAAGGAGGACAAGAGTTTGACAGGGGGCGCTATAGTCCTGACTGTGACCCAGGCTGGATCCCTGTACACCCCTGCCTGCGCCTATCTGCCCCATCATCTGCTGGGAAAGGAGGGGTTCGATGCCCTGGACCCGTTTGTGCCCATCCAGGTGCCCAATTACAATGAGAAGGAGTTTGAGAGCTGCTATCAGTACTACCTGGAGCGCAAGTGGCTGCAGCACCACAAAGCCCATACGCCGGAAGGGAAGGCCGAGTTGCGGTTCCTGAGTGATTCCAACCCAAAGCAGCTGGATAAGATCTGCGCCTTCCTCTGACCCCTCCCACTGGGCGGGGCTTATCGGAATTACCCCATTGTGGGGCAGTGACTGTGGGGGTTGCCCAGTGAAGCCATAGTGGGACTATTAATGAGATTGTATGGGCCTGACCCAGGCACGGGCGGTTCTGCCCCTCACGTACTTCCCTATGTATAATAGCCCCCGACTGGGGCAGGAACGGAGCCCCCTACTGACAAGGAGC
  3   1   2       bld Tbd0 5g3  in                       IMAGE:6976218                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 NAGGTTGACCACCTGGAGCTTCAATGGGAAGAATTAAAGCCCCAAGACATTTTTCAGATAATCTTCCAACAAGGAAATGGTGGGCAAGGGGAAACCACAAAGAGGGCGACCCCTGGGGGGTAATAGATCCGGGATGACGAGGTGAAGAATGCCAGTGACGCAGTGGGGGGGTTTTGAAGGAGTTAAAGAGACAGTGGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTATCAGGAAGGAGGACAAGAGTTTGGTGCCTCCGGAGGAGCTGACCCTGGTGCACAATCTGAGGAAGATGGTGCAGAATGACTGGACAGGGGGCGCTATAGTCCTGACTGTGACCCAGGCTGGATCCCTGTACACCCCTGCCTGCGCCTATCTGCCCCATCATCTGCTGGGAAAGGAGGGGTTCGATGCCCTGGACCCGTTTGTGCCCATCCAGGTGCCCAATTACAATGAGAAGGAGTTTGAGAGCTGCTATCAGTACTACCTGGAGCGCAAGTGGCTGCAGCACCACAAAGCCCATACGCCGGAAGGGAAGGCCGAGTTGCGGTTCCTGAGTGATTCCAACCCAAAGCAGCTGGATAAGATCTGCGCCTTCCTCTGACCCCTCCCACTGGGCGGGGCTTATCGGAATTACCCCATTGTGGGGCAGTGACTGTGGGGGTTGCCCAGTGAAGCCATAGTGGGACTATTAATGAGATTGTATGGGCCTGAC
  3   1   2       bld Neu  FL   in                    TNeu065m05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAACTTTAAAGCCACCAATGAGCACTTCCTCAAGCAGATCCGTACCAACCAGCGATACGTGTGGAGCAAGCGGGAAGCCACAGACGAGGGCAGACCCCTGGGGGAGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGGGCGTGGTTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTATCAGGAAGGAGGACAAGAGTTTGGTGCCTCCGGAGGAGCTGACCCTGGTGCACAATCTGAGGAAGATGGTGCAGAATGACTGGACAGGGGGCGCTATAGTCCTGACTGTGACCCAGGCTGGATCCCTGTACACCCCTGCCTGCGCCTATCTGCCCCATCATCTGCTGGGAAAGGAGGGGTTCGATGCCCTGGACCCGTTTGTGCCCATCCAGGTGCCCAATTACAATGAGAAGGAGTTTGAGAGCTGCTATCAGTACTACCTGGAGCGCAAGTGGCTGCAGCACCACAAAGCCCATACGCCGGAAGGGAAGGCCGAGTTGCGGTTCCTGAGTGATTCCAACCCAAAGCAGCTGGATAAGATCTGCGCCTTCCTCTGACCCCTCCCACTGGGCGGGGCTTATCGGAATTACCCCATTGTGGGGCAGTGACTGTGGGGGTTGCCCAGTGAAGCCATAGTGGGACTATTAATGAGATTGTATGGGCCTGACCCAGGCACGGGCGGTTCTGCCCCTCACGTACTTCCCTATGTATAATAGCCCCCGACTGGGGCAGGAACGGAGCCCCCTACTGACAAGGAGCCTATAAAGCATTTTGTCAAAAAAA
  3   1   2      seed Te5  5g3  in                         CAAO5924.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGCCACCAATGAGCACTTCCTCAAGCAGATCCGTACCAACCAGCGATACGTGTGGAGCAAGCGGGAAGCCACAGACGAGGGCAGACCCCTGGGGGAGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGGGCGTGGTTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTATCAGGAAGGAGGACAAGAGTTTGGTGCCTCCGGAGGAGCTGACCCTGGTGCACAATCTGAGGAAGATGGTGCAGAATGACTGGACAGGGGGCGCTATAGTCCTGACTGTGACCCAGGCTGGATCCCTGTACACCCCTGCCTGCGCCTATCTGCCCCATCATCTGCTGGGAAAGGAGGGGTTCGATGCCCTGGACCCGTTTGTGCCCATCCAGGTGCCCAATTACAATGAGAAGGAGTTTGAGAGCTGCTATCAGTACTACCTGGAGCGCAAGTGGCTGCAGCACCACAAAGCCCATACGCCGGAAGGGAAGGCCGAGTTGCGGTTCCTGAGTGATTCCAACCCAAAGCAGCTGGATAAGATCTGCGCCTTCCTCTGACCCCTCCCACTGGGCGGGGCTTATCGGAATTACCCCATTGTGGGGCAGTGACTGTGGGGGTTGCCCAGTGAAGCCATAGTGGGACTATTAATGAGATTGTATGGGCCTGACCCAGGCACGGGCGGTTCTGCCCCTCACGTACTTCCCTATGTATAATAGCCCCCGACTGGGGCAGGAACGGAGCCCCCTACTGACAAGGAGCCTATAAAGCATGTTTTGTAC
  3   1   2       bld Te5       in                         CAAO8346.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TACAGGTGCCCGATGCTCACGTCCTGGTGAAGAACTGTAAGGAGCTCATGCCCTCCTCCTTCCATAGCAACAGGTTCGACCAACCCTTGGAAGCCTCCAATTGGCTGAAGAACTTTAAAGCCACCAATGAGCACTTCCTCAAGCAGATCCGTACCAACCAGCGATACGTGTGGAGCAAGCGGGAAGCCACAGACGAGGGCAGACCCCTGGGGGAGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGGGCGTGGTTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTATCAGGAAGGAGGACAAGAGTTTGGAGGGGTTCGATGCCCTGGACCCGTTTGTGCCCATCCAGGTGCCCAATTACAATGAGAAGGAGTTTGAGAGCTGCTATCAGTACTACCTGGAGCGCAAGTGGCTGCAGCACCACAAAGCCCATACGCCGGAAGGGAAGGCCGAGTTGCGGTTCCTGAGTGATTCCAACCCAAAGCAGCTGGATAAGATCTGCGCCTTCCTCTGACCCCTCCCACTGGGCGGGGCTTATCGGAATTACCCCATTGTGGGGCAGTGACTGTGGGGGTTGCCCAGTGAAGCCATAGTGGGACTATTAATGAGATTGTATGGGCCTGACCCAGGCACGGGCGGTTCTGCCCCTCACGTACTTCCCTATNGTATAATAGCCNCCCGACTGGGGCAGGAACGGA
  3   1   2       bld Te4       in                        CAAN10699.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACCCAGCGATACGTGTGGGCAAGCGGAAGCCACAGACGAGGGCAGACCCCTGGGGGAGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGGGCGTGGTTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTATCAGGAAGGAGGACAAGAGTTTGGTGCCTCCGGAGGAGCTGACCCTGGTGCACAATCTGAGGAAGATGGTGCAGAATGACTGGACAGGGGGCGCTATAGTCCTGACTGTGACCCAGGCTGGATCCCTGTACACCCCTGCCTGCGCCTATCTGCCCCATCATCTGCTGGGAAAGGAGGGGTTCGATGCCCTGGACCCGTTTGTGCCCATCCAGGTGCCCAATTACAATGAGAAGGAGTTTGAGAGCTGCTATCAGTACTACCTGGAGCGCAAGTGGCTGCAGCACCACAAAGCCCATACGCCGGAAGGGAAGGCCGAGTTGCGGTTCCTGAGTGATTCCAACCCAAAGCAGCTGGATAAGATCTGCGCCTTCCTCTGACCCCTCCCACTGGGCGGGGCTTATCGGAATTACCCCATTGTGGGGCAGTGACTGTGGGGGTTGCCCAGTGAAGCCATAGTGGGACTATTAATGAGATTGTATGGGCCTGACCCAGGCACGGGCGGTTCTGCCCCTCACGTACTTCCCTATGTATAATAGCCCCCGACTGGGGCAGGAACGGAGCCCCCTACTGACAAGGAGCCTATAAAGCATGTTTTGTAC
  3   1   2       bld Te5       in                         CAAO5672.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGACGAGGGCAGACCCCTGGGGGAGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGGGCGTGGTTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTATCAGGAAGGAGGACAAGAGTTTGGTGCCTCCGGAGGAGCTGACCCTGGTGCACAATCTGAGGAAGATGGTGCAGAATGACTGGACAGGGGGCGCTATAGTCCTGACTGTGACCCAGGCTGGATCCCTGTACACCCCTGCCTGCGCCTATCTGCCCCATCATCTGCTGGGAAAGGAGGGGTTCGATGCCCTGGACCCGTTTGTGCCCATCCAGGTGCCCAATTACAATGAGAAGGAGTTTGAGAGCTGCTATCAGTACTACCTGGAGCGCAAGTGGCTGCAGCACCACAAAGCCCATACGCCGGAAGGGAAGGCCGAGTTGCGGTTCCTGAGTGATTCCAACCCAAAGCAGCTGGATAAGATCTGCGCCTTCCTCTGACCCCTCCCACTGGGCGGGGCTTATCGGAATTACCCCATTGTGGGGCAGTGACTGTGGGGGTTGCCCAGTGAAGCCATAGTGGGACTATTAATGAGATTGTATGGGCCTGACCCAGGCACGGGCGGTTCTGCCCCTCACGTACTTCCCTATGTATAATAGCCCCCGACTGGGGCAGGAAGCGGAGCCCCCTACGTGACAAGGAGGCCTATAAAGCCATGTTTTGTAC
  3   1   2       bld Te5       in                        CAAO10299.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGGGCGTGGTTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTATCAGGAAGGAGGACAAGAGTTTGGTGCCTCCGGAGGAGCTGACCCTGGTGCACAATCTGAGGAAGATGGTGCAGAATGACTGGACAGGGGGCGCTATAGTCCTGACTGTGACCCAGGCTGGATCCCTGTACACCCCTGCCTGCGCCTATCTGCCCCATCATCTGCTGGGAAAGGAGGGGTTCGATGCCCTGGACCCGTTTGTGCCCATCCAGGTGCCCAATTACAATGAGAAGGAGTTTGAGAGCTGCTATCAGTACTACCTGGAGCGCAAGTGGCTGCAGCACCACAAAGCCCATACGCCGGAAGGGAAGGCCGAGTTGCGGTTCCTGAGTGATTCCAACCCAAAGCAGCTGGATAAGATCTGCGCCTTCCTCTGACCCCTCCCACTGGGCGGGGCTTATCGGAATTACCCCATTGTGGGGCAGTGACTGTGGGGGTTGCCCAGTGAAGCCATAGTGGGACTATTAATGAGATTGTATGGGCCTGACCCAGGCACGGGCGGTTCTGCCCCTCACGTACTTCCCTATGTATAATAGCCCCCGACTGGGGCAGGAACGGAGCCCCCTACTGACAAGGAGCCTATAAAGCATGTTTTGTAC
  3   1   2       bld Tail      in                         CBSW9090.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGTAGTGGATCAGGGACTGACGAGGGTGAAGAGTGCCAGTGACGCAGTGGGCGTGGTTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTATCAGGAAGGAGGACAAGAGTTTGGTGCCTCCGGAGGAGCTGACCCTGGTGCACAATCTGAGGAAGATGGTGCAGAATGACTGGACAGGGGGCGCTATAGTCCTGACTGTGACCCAGGCTGGATCCCTGTACACCCCTGCCTGCGCCTATCTGCCCCATCATCTGCTGGGAAAGGAGGGGTTCGATGCCCTGGACCCGTTTGTGCCCATCCAGGTGCCCAATTACAATGAGAAGGAGTTTGAGAGCTGCTATCAGTACTACCTGGAGCGCAAGTGGCTGCAGCACCACAAAGCCCATACGCCGGAAGGGAAGGCCGAGTTGCGGTTCCTGAGTGATTCCAACCCAAAGCAGCTGGATAAGATCTGCGCCTTCCTCTGACCCCTCCCACTGGGCGGGGCTTATTGGAATTACCCCATTGTGGGGCAGTGACTGTGGGGGTTGCCCAGTGAAGCCATAGTGGGACTATTAATGAGATTGTATGGGCCTGACCCAGGCACGGGCGGTTCTGCCCCTCACGTACTTCCCTATGTATAATAGCCCCCGACTGGGGCAGGAACGGAGCCCCCTACTGACAAGGAGCCTATAAAGCATGTTTTGTACAAAAAAAAAAAAAAA
  3   1   2       bld Tail      in                         CBSW3671.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGTGGGCGTGGTTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTATCAGGAAGGAGGACAAGAGTTTGGTGCCTCCGGAGGAGCTGACCCTGGTGCACAATCTGAGGAAGATGGTGCAGAATGACTGGACAGGGGGCGCTATAGTCCTGACTGTGACCCAGGCTGGATCCCTGTACACCCCTGCCTGCGCCTATCTGCCCCATCATCTGCTGGGAAAGGAGGGGTTCGATGCCCTGGACCCGTTTGTGCCCATCCAGGTGCCCAATTACAATGAGAAGGAGTTTGAGAGCTGCTATCAGTACTACCTGGAGCGCAAGTGGCTGCAGCACCACAAAGCCCATACGCCGGAAGGGAAGGCCGAGTTGCGGTTCCTGAGTGATTCCAACCCAAAGCAGCTGGACAAGATCTGCGCCTTCCTCTGACCCCTCCCACTGGGCGGGGCTTATTGGAATTACCCCATTGTGGGGCAGTGACTGTGGGGGTTGCCCAGTGAAGCCATAGTGGGACTATTAATGAGATTGTATGGGCCTGACCCAGGCACGGGCGGTTCTGCCCCTCACGTACTTCCCTATGTATAATAGCCCCCGACTGGGGCAGGAACGGAGCCCCCTACTGACAAGGAGCCTATAAAGCATGTTTTGTACAAAAAAAAAAAAAAA
  3   1   2       bld Te1  5g3  in                        CBWN11256.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTCTGAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTATCAGGAAGGAGGACAAGAGTTTGGTGCCTCCGGAGGAGCTGACCCTGGTGCACAATCTGAGGAAGATGGTGCAGAATGACTGGACAGGGGGCGCTATAGTCCTGACTGTGACCCAGGCTGGATCCCTGTACACCCCTGCCTGCGCCTATCTGCCCCATCATCTGCTGGGAAAGGAGGGGTTCGATGCCCTGGACCCGTTTGTGCCCATCCAGGTGCCCAATTACAATGAGAAGGAGTTTGAGAGCTGCTATCAGTACTACCTGGAGCGCAAGTGGCTGCAGCACCACAAAGCCCATACGCCGGAAGGGAAGGCCGAGTTGCGGTTCCTGAGTGATTCCAACCCAAAGCAGCTGGACAAGATCTGCGCCTTCCTCTGACCCCTCCCACTGGGCGGGGCTTATTGGAATTACCCCATTGTGGGGCAGTGACTGTGGGGGTTGCCCAGTGAAGCCATAGTGGGACTATTAATGAGATTGTATGGGCCTGACCCAGGCACGGGCGGTTCTGCCCCTCACGTACTTCCCTATGTATAATAGCCCCCGACTGGGGCAGGAACGGAGCCCCCTACTGACAAGGAGCCTATAAAGCATGTTTTGTACAAGTCTCAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA061i20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGGAGTTAAAGAGACAGTCGGGGGGAGGAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTCTCAGGAAGGAGGACAAGAGTTTGGTGCCTCCGGAGGAGCTGACCCTGGTGCACAATCTGAGGAAGATGGTGCAGAATGACTGGACAGGGGGCGCTATAGTCCTGACTGTGACCCAGGCTGGATCCCTGTACACCCCTGCCTGCGCCTATCTGCCCCATCATCTGCTGGGAAAGGAGGGGTTCGATGCCCTGGACCCGTTTGTGCCCATCCAGGTGCCCAATTACAATGAGAAGGAGTTTGAGAGCTGCTATCAGTACTACCTGGAGCGCAAGTGGCTGCAGCACCACAAAGCCCATACGCCGGAAGGGAAGGCCGAGTTGCGGTTCCTGAGTGATTCCAACCCAAAGCAGCTGGATAAGATTTGCGCCTTCCTCTGACCCCTCCCACTGGGCGGGGCTTATCGGAATTACCCCATTGTGGGGCAGTGACTGTGGGGGTTGCCCAGTGAAGCCATAGTGGGACTATTAATGAGATTGTATGGGCCTGACCCAGGCACGGGCGGTTCTGCCCCTCACGTACTTCCCTATGTATAATAGCCCCCGACTGGGGCAGGAACGGAGCCCCCTACTGACAAGGAGCCTATAAAGCATGTTTTTACAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tbd1                                CBXT18536.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGCATATCAGATGTTGGTCTCAGTCGATGGAGTTAACGCTCTGTGGGGCAGGAGCACTCTCAGGAAGGAGGACAAGAGTTTGGTGCCTCCGGAGGAGCTGACCCTGGTGCACAATCTGAGGAAGATGGTGCAGAATGACTGGACAGGGGGCGCTATAGTCCTGACTGTGACCCAGGCTGGATCCCTGTACACCCCTGCCTGCGCCTATCTGCCCCATCATCTGCTGGGAAAGGAGGGGTTCGATGCCCTGGACCCGTTTGTGCCCATCCAGGTGCCCAATTACAATGAGAAGGAGTTTGAGAGCTGCTATCAGTACTACCTGGAGCGCAAGTGGCTGCAGCACCACAAAGCCCATACGCCGGAAGGGAAGGCCGAGTTGCGGTTCCTGAGTGATTCCAACCCAAAGCAGCTGGATAAGATCTGCGCCTTCCTCTGACCCCTCCCACTGGGCGGGGCTTATCGGAATTACCCCATTGTGGGGCAGTGACTGTGGGGGTTGCCCAGTGAAGCCATAGTGGGACTATTAATGAGATTGTATGGGCCTGACCCAGGCACGGGCGGTTCTGCCCCTCACGTACTTCCCTATGTATAATAGCCCCCGACTGGGGCAGGAACGGAGCCCCCTACTGACAAGGAGCCTATAAAGCATGTTTTGTACAAGTAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG54865.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGGAAGGAGGACAAGAGTTTGGTGCCTCCGGAGGAGCTGACCCTGGTGCACAATCTGAGGAAGATGGTGCAGAATGACTGGACAGGGGGCGCTATAGTCCTGACTGTGACCCAGGCTGGATCCCTGTACACCCCTGCCTGCGCCTATCTGCCCCATCATCTGCTGGGAAAGGAGGGGTTCGATGCCCTGGACCCGTTTGTGCCCATCCAGGTGCCCAATTACAATGAGAAGGAGTTTGAGAGCTGCTATCAGTACTACCTGGAGCGCAAGTGGCTGCAGCACCACAAAGCCCATACGCCGGAAGGGAAGGCCGAGTTGCGGTTCCTGAGTGATTCCAACCCAAAGCAGCTGGATAAGATTTGCGCCTTCCTCTGACCCCTCCCACTGGGCGGGGCTTATCGGAATTACCCCATTGTGGGGCAGTGACTGTGGGGGTTGCCCAGTGAAGCCATAGTGGGACTATTAATGAGATTGTATGGGCCTGACCCAGGCACGGGCGGTTCTGCCCCTCACGTACTTCCCTATGTATAATAGCCCCCGACTGGGGCAGGAACGGAGCCCCCTACTGACAAGGAGCCTATAAAGCATGTTTTGTCC
  3   1   2       bld Tad5      in                         XZT58920.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCACGCGTCCGCCTGACTGTGACCCAGGCTGGATCCCTGTACACCCCTGCCTGCGCCTATCTGCCCCATCATCTGCTGGGAAAGGAGGGGTTCGATGCCCTGGACCCGTTTGTGCCCATCCAGGTGCCCAATTACAATGAGAAGGAGTTTGAGAGCTGCTATCAGTACTACCTGGAGCGCAAGTGGCTGCAGCACCACAAAGCCCATACGCCGGAAGGGAAGGCCGAGTTGCGGTTCCTGAGTGATTCCAACCCAAAGCAGCTGGATAAGATCTGCGCCTTCCTCTGACCCCTCCCACTGGGCGGGGCTTATCGGAATTACCCCATTGTGGGGCAGTGACTGTGGGGGTTGCCCAGTGAAGCCATAGTGGGACTATTAATGAGATTGTATGGGCCTGACCCAGGCACGGGCGGTTCTGCCCCTCACGTACTTCCCTATGTATAATAGCCCCCGACTGGGGCAGGAACGGAGCCCCCTACTGACAAGGAGCCTATAAAGCATGTTTTGT
  5   1   2       bld Tad5      in                         XZT58920.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGACTGTGACCCAGGCTGGATCCCTGTACACCCCTGCCTGCGCCTATCTGCCCCATCATCTGCTGGGAAAGGAGGGGTTCGATGCCCTGGACCCGTTTGTGCCCATCCAGGTGCCCAATTACAATGAGAAGGAGTTTGAGAGCTGCTATCAGTACTACCTGGAGCGCAAGTGGCTGCAGCACCACAAAGCCCATACGCCGGAAGGGAAGGCCGAGTTGCGGTTCCTGAGTGATTCCAACCCAAAGCAGCTGGATAAGATCTGCGCCTTCCTCTGACCCCTCCCACTGGGCGGGGCTTATCGGAATTACCCCATTGTGGGGCAGTGACTGTGGGGGTTGCCCAGTGAAGCCATAGTGGGACTATTAATGAGATTGTATGGGCCTGACCCAGGCACGGGCGGTTCTGCCCCTCACGTACTTCCCTATGTATAATAGCCCCCGACTGGGGCAGGAACGGAGCCCCCTACTGACAAGGAGCCTATAAAGCATGTTTTGTACAAAAAAAAAAAAAAAAGG
  5   1   2       bld Neu                            TNeu131k03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGGGGATTGTGGGGCAGTGACTGTGGGGGTTGCCCAGTGAAGCCATAGTGGGACTATTAATGAGATTGTATGGGCCTGACCCAGGCACGGGCGGTTCTGCCCCTCACGTACTTCCCTATGTATAATAGCCCCCGACTGGGGCAGGAACGGAGCCCCCTACTGACAAGGAGCCTATAAAGCATGTTTTGTACAG
  5   1   2       add In63                            IMAGE:8960470.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGGGGGGCAATGTCTGACTTGGGGGGGTTGCCCAGTGGAAGCCATAGTGGGACTATTAATGAGATTGTATGGGCCTGACCCAGGCACGGGCGGTTCTGCCCCTCACGTACTTCCCTATGTATAATAGCCCCCGACTGGGGCAGGAACGGAGCCCCCTACTGACAAGGAGCCTATAAAGCATGTTTTGTACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)