Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA009c14.5                          9 END     6          15       75                polymerase (DNA directed), delta 1, catalytic subunit 125kDa [Xenopus tropicalis]
     2   2.0    0Xt7.1-IMAGE:8958064.5                       2 END     1           2       50                polymerase (DNA directed), delta 1, catalytic subunit 125kDa [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012076051 Xt7.1-XZG63627.3.5 - 40 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-XZG63627.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTGGCAGACAGATGATCGAGAAAACCAAGCAACTGGTTGAGTCCAAATATACTCTGGACAATGGATATAAGGCTGACGCCAAGGTGATCTATGGCGACACGGATTCTGTCATGTGCAAACTTGGGGTGCAGACCGTGGTGGAGGCCATGGAGATAGGAAGAGAGGCAGCAGAATGGGTGTCCAGTCATTTTACTCCTCCAATAAAACTGGAATTTGAAAAGGTTTATTTTCCCTACCTGTTGATCAACAAGAAGCGATACGCCGGGCTGTACTTCTCATCCAGCGCCAATACTCATGATAAGATGGACTGCAAAGGAATAGAGACTGTGCGAAGAGACAACTGCCCACTTGTGGCCAATTTGATAAATACTTGTCTGCAGAAAATTCTGATTGACCGGGATCCTATGGGAGCCGTGGAGCATGCTAAAGACGTGATCTCTGATTTGCTGTGCAATCGGATAGATATCTCGCAGCTTGTGATTACAAAGGAGTTGACGCGGACGGCTGATGAGTACGCAGGGAAACAGGCCCACGTGGAGCTTGCAGAGAGGATGAGAAAGCGTGACCCTGGCAGCGCCCCTAATCTGGGAGACCGAGTTCCATATGTGATCATAGGAGCTGCAAAAGGAGTGGCCGCTTATATGAAGTCTGAGGACCCCATTTACGTGCTTGAGAATAACATCCCTATCGACACCCAATATTATCTGGAACAGCAACTTGCAAAACCTCTTCTTAGGATTTTTGAACCCATTCTGGGTGAATCCAAGGCCGAAAGTATTCTTCTGAAGGGGGAGCACACACGCTGCAAGACCGTGCTGACCGCCAAGGTTGGGGGCCTCATGGCGTTTGCTAAGAAACGCAGCACGTGCATTGGCTGCAAAGCAACACTAAATCATGATGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTTTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGCGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGAAGAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATATCTGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGTGCCAGGCAAAGAGCTGCGCTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCTTTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTGCAGTAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008226723                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGACAGATGATCGAGAAAACCAAGCAACTGGTTGAGTCCAAATATACTCTGGACAATGGATATAAGGCTGACGCCAAGGTGATCTATGGCGACACGGATTCTGTCATGTGCAAACTTGGGGTGCAGACCGTGGTGGAGGCCATGGAGATAGGAAGAGAGGCAGCAGAATGGGTGTCCAGTCATTTTACTCCTCCAATAAAACTGGAATTTGAAAAGGTTTATTTTCCCTACCTGTTGATCAACAAGAAGCGATACGCCGGGCTGTACTTCTCATCCAGCGCCAATACTCATGATAAGATGGACTGCAAAGGAATAGAGACTGTGCGAAGAGACAACTGCCCACTTGTGGCCAATTTGATAAATACTTGTCTGCAGAAAATTCTGATTGACCGGGATCCTATGGGAGCCGTGGAGCATGCTAAAGACGTGATCTCTGATTTGCTGTGCAATCGGATAGATATCTCGCAGCTTGTGATTACAAAGGAGTTGACGCGGACGGCTGATGAGTACGCAGGGAAACAGGCCCACGTGGAGCTTGCAGAGAGGATGAGAAAGCGTGACCCTGGCAGCGCCCCTAATCTGGGAGACCGAGTTCCATATGTGATCATAGGAGCTGCAAAAGGAGTGGCCGCTTATATGAAGTCTGAGGACCCCATTTACGTGCTTGAGAATAACATCCCTATCGACACCCAATATTATCTGGAACAGCAACTTGCAAAACCTCTTCTTAGGATTTTTGAACCCATTCTGGGTGAATCCAAGGCCGAAAGTATTCTTCTGAAGGGGGAGCACACACGCTGCAAGACCGTGCTGACCGCCAAGGTTGGGGGCCTCATGGCGTTTGCTAAGAAACGCAGCACGTGCATTGGCTGCAAAGCAACACTAAATCATGATGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTTTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGCGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGAAGAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATATCTGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGTGCCAGGCAAAGAGCTGCGCTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCTTTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTGCAGTAACAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     8     8     9     9     9     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     9     9     9     9    10    11     9    10     8     9     8     9     9     9    10    12    11    12    12    13    12    13    15    16    17    18    17    18    17    18    19    20    19    19    18    18    20    20    21    21    21    21    23    23    23    23    23    23    24    25    25    26    25    28    27    28    27    28    27    28    26    27    25    26    25    26    24    26    25    26    25    26    26    26    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    26    28    25    28    25    27    25    27    25    27    19    27    19    27    19    27    19    27    10    27    10    27    10    27    10    28    11    28    12    29    12    29    12    26    12    26    12    25    12    23    12    22    12    22    12    22    12    22    12    22    12    22    11    22    11    22    11    20    11    20    11    20     3     9     3     4
  5   1   2  SIG                                      Xt7.1-XZG63627.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTGGCAGACAGATGATCGAGAAAACCAAGCAACTGGTTGAGTCCAAATATACTCTGGACAATGGATATAAGGCTGACGCCAAGGTGATCTATGGCGACACGGATTCTGTCATGTGCAAACTTGGGGTGCAGACCGTGGTGGAGGCCATGGAGATAGGAAGAGAGGCAGCAGAATGGGTGTCCAGTCATTTTACTCCTCCAATAAAACTGGAATTTGAAAAGGTTTATTTTCCCTACCTGTTGATCAACAAGAAGCGATACGCCGGGCTGTACTTCTCATCCAGCGCCAATACTCATGATAAGATGGACTGCAAAGGAATAGAGACTGTGCGAAGAGACAACTGCCCACTTGTGGCCAATTTGATAAATACTTGTCTGCAGAAAATTCTGATTGACCGGGATCCTATGGGAGCCGTGGAGCATGCTAAAGACGTGATCTCTGATTTGCTGTGCAATCGGATAGATATCTCGCAGCTTGTGATTACAAAGGAGTTGACGCGGACGGCTGATGAGTACGCAGGGAAACAGGCCCACGTGGAGCTTGCAGAGAGGATGAGAAAGCGTGACCCTGGCAGCGCCCCTAATCTGGGAGACCGAGTTCCGTATGTGATCATAGGAGCTGCAAAAGGAGTGGCCGCTTATATGAAGTCTGAGGACCCCATTTACGTGCTTGAGAATAACATCCCTATCGACACCCAATATTATCTGGAACAGCAACTTGCAAAACCTCTTCTTAGGATTTTTGAACCCATTCTGGGTGAATCCAAGGCCGAAAGTATTCTTCTGAAGGGGGAGCACACACGCTGCAAGACCGTGCTGACCGCCAAGGTTGGGGGCCTCATGGCGTTTGCTAAGAAACGCAGCACGTGCATTGGCTGCAAAGCAACACTAAATCATGATGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTTTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGTGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGGACAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATAGCGGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGTGCCAGGCAAAGAGCTGCGCTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCTTTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTGCAGTAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TNeu054j18.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGGAAACAGGCCCACGTGGAGCTTGCAGAGAGGATGAGAAAGCGTGACCCCGGCAGCGCCCCTAATCTGGGAGACCGAGTTCCATATGTGATCATAGGAGCTGCAAAAGGAGTGGCCGCTTATATGAAGTCTGAGGACCCCATTTACGTGCTTGAGAATAACATCCCTATCGACACCCAATATTATCTGGAACAGCAACTTGCAAAACCTCTTCTTAGGATTTTTGAACCCATTCTGGGTGAATCCAAGGCCGAAAGTATTCTTCTGAAGGGGGAGCACACACGCTGCAAGACCGTGCTGACCGCCAAGGTTGGGGGCCTCATGGCGTTTGCTAAGAAACGCAGCACGTGCATTGGCTGCAAAGCAACACTAAATCATGATGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTCTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGCGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGAAGAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATATCTGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGGGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGGCTGCTCCTCTGCTTCATTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGGCTGCTCCTCTGCTTCATTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCATTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAAC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----G-G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----G-------
                                                                       ...PREDICTED - Gg ---- 3e-038     XP_426179.2 PREDICTED: similar to DNA polymerase zeta catalytic subunit [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sc ---- 5e-099     NP_010181.1 Catalytic subunit of DNA polymerase delta; required for chromosomal DNA replication during mitosis and meiosis, intragenic recombination, repair of double strand DNA breaks, and DNA replication during nucleotide excision repair (NER) [Saccharomyces cerevis -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ---- 1e-120     XP_001203298.1 PREDICTED: similar to Pold protein, partial [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 3e-132     NP_506017.1 polymerase delta (120.8 kD) (5M525) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 3e-149     NP_524099.2 DNA-polymerase-delta CG5949-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_002682.1 polymerase (DNA directed), delta 1, catalytic subunit 125kDa; Polymerase (DNAdirected), delta 1, catalytic subunit; polymerase (DNA directed), delta 1,catalytic subunit (125kD) [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_035261.2 polymerase (DNA directed), delta 1, catalytic subunit; DNA polymerase delta 1,catalytic domain; polymerase (DNA directed), delta 1, catalytic subunit (125kDa)[Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 0          NP_001034899.1 DNA polymerase delta1 catalytic subunit [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          AAH81093.1 MGC83185 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 0          NP_001087694.1 polymerase (DNA directed), delta 1, catalytic subunit [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 0          CAJ83173.1 polymerase (DNA directed), delta 1, catalytic subunit 125kDa [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-XZG63627.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATG------------------------------------------------------------------------------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------TAG------------------------------------------------------TAG------------------------------------------------------------------------------------------ATG---------TAA---------------------------TGA------------TAA---------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2  SIG                                      Xt7.1-XZG63627.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTGGCAGACAGATGATCGAGAAAACCAAGCAACTGGTTGAGTCCAAATATACTCTGGACAATGGATATAAGGCTGACGCCAAGGTGATCTATGGCGACACGGATTCTGTCATGTGCAAACTTGGGGTGCAGACCGTGGTGGAGGCCATGGAGATAGGAAGAGAGGCAGCAGAATGGGTGTCCAGTCATTTTACTCCTCCAATAAAACTGGAATTTGAAAAGGTTTATTTTCCCTACCTGTTGATCAACAAGAAGCGATACGCCGGGCTGTACTTCTCATCCAGCGCCAATACTCATGATAAGATGGACTGCAAAGGAATAGAGACTGTGCGAAGAGACAACTGCCCACTTGTGGCCAATTTGATAAATACTTGTCTGCAGAAAATTCTGATTGACCGGGATCCTATGGGAGCCGTGGAGCATGCTAAAGACGTGATCTCTGATTTGCTGTGCAATCGGATAGATATCTCGCAGCTTGTGATTACAAAGGAGTTGACGCGGACGGCTGATGAGTACGCAGGGAAACAGGCCCACGTGGAGCTTGCAGAGAGGATGAGAAAGCGTGACCCTGGCAGCGCCCCTAATCTGGGAGACCGAGTTCCGTATGTGATCATAGGAGCTGCAAAAGGAGTGGCCGCTTATATGAAGTCTGAGGACCCCATTTACGTGCTTGAGAATAACATCCCTATCGACACCCAATATTATCTGGAACAGCAACTTGCAAAACCTCTTCTTAGGATTTTTGAACCCATTCTGGGTGAATCCAAGGCCGAAAGTATTCTTCTGAAGGGGGAGCACACACGCTGCAAGACCGTGCTGACCGCCAAGGTTGGGGGCCTCATGGCGTTTGCTAAGAAACGCAGCACGTGCATTGGCTGCAAAGCAACACTAAATCATGATGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTTTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGTGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGGACAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATAGCGGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGTGCCAGGCAAAGAGCTGCGCTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCTTTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTGCAGTAAAAAAAAA
                                                  Xt7.1-CHK-1008290936                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGACAGATGATCGAGAAAACCAAGCAACTGGTTGAGTCCAAATATACTCTGGACAATGGATATAAGGCTGACGCCAAGGTGATCTATGGCGACACGGATTCTGTCATGTGCAAACTTGGGGTGCAGACCGTGGTGGAGGCCATGGAGATAGGAAGAGAGGCAGCAGAATGGGTGTCCAGTCATTTTACTCCTCCAATAAAACTGGAATTTGAAAAGGTTTATTTTCCCTACCTGTTGATCAACAAGAAGCGATACGCCGGGCTGTACTTCTCATCCAGCGCCAATACTCATGATAAGATGGACTGCAAAGGAATAGAGACTGTGCGAAGAGACAACTGCCCACTTGTGGCCAATTTGATAAATACTTGTCTGCAGAAAATTCTGATTGACCGGGATCCTATGGGAGCCGTGGAGCATGCTAAAGACGTGATCTCTGATTTGCTGTGCAATCGGATAGATATCTCGCAGCTTGTGATTACAAAGGAGTTGACGCGGACGGCTGATGAGTACGCAGGGAAACAGGCCCACGTGGAGCTTGCAGAGAGGATGAGAAAGCGTGACCCTGGCAGCGCCCCTAATCTGGGAGACCGAGTTCCGTATGTGATCATAGGAGCTGCAAAAGGAGTGGCCGCTTATATGAAGTCTGAGGACCCCATTTACGTGCTTGAGAATAACATCCCTATCGACACCCAATATTATCTGGAACAGCAACTTGCAAAACCTCTTCTTAGGATTTTTGAACCCATTCTGGGTGAATCCAAGGCCGAAAGTATTCTTCTGAAGGGGGAGCACACACGCTGCAAGACCGTGCTGACCGCCAAGGTTGGGGGCCTCATGGCGTTTGCTAAGAAACGCAGCACGTGCATTGGCTGCAAAGCAACACTAAATCATGATGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTTTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGTGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGGACAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATAGCGGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGTGCCAGGCAAAGAGCTGCGCTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCTTTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTGCAGTAACAAAAAAAAAAAA
  5   1   2       ext Te4       in                         CAAN5551.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCACTGAAAGTCAGCGCTAACTCTGTGTATGGTTTTACAGGAGCACAGGTTGGCAAACTGCCCTGCTTGGAGATATCGCAGAGTGTCACCGGGTTTGGCAGACAGATGATCGAGAAAACCAAGCAACTGGTTGAGTCCAAATATACTCTGGACAATGGATATAAGGCTGACGCCAAGGTGATCTATGGCGACACGGATTCTGTCATGTGCAAACTTGGGGTGCAGACCGTGGTGGAGGCCATGGAGATAGGAAGAGAGGCAGCAGAATGGGTGTCCAGTCATTTTACTCCTCCAATAAAACTGGAATTTGAAAAGGTTTATTTTCCCTACCTGTTGATCAACAAGAAGCGATACGCCGGGCTGTACTTCTCATCCAGCGCCAATACTCATGATAAGATGGACTGCAAAGGAATAGAGACTGTGCGAAGAGACAACTGCCCACTTGTGGCCAATTTGATAAATACTTGTCTGCAGAAAATTCTGATTGACCGGGATCCTATGGGAGCCGTGGAGCATGCTAAAGACGTGATCTCTGATTTGCTGTGCAATCGGATAGATATCTCGCAGCTTGTGATTACAAAGGAGTTGACGCGGACGGCTGATGAGTACGCAGGGAAACAGGCCCACGTGGAGCTTGCAGAGAGGATGAGAAAGCGTGACCCTGGCAGCGCCCCTAATCTGGGAGACCGAGTTCCGTATGTGATCATAGGAGCTGCAAAAGGAGTGGCCGCTTATATGAAGTCTGAGGACCCCATTTACGTGCTTGAGAATAACATCCCTATCGACACCCCATATTATCTGGAACAGCAACTTGCAAAACCT
  5   1   2       ext Te3       in                        CAAM15036.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTGGCAGACAGATGATCGAGAAAACCAAGCAACTGGTTGAGTCCAAATATACTCTGGACAATGGATATAAGGCTGACGCCAAGGTGATCTATGGCGACACGGATTCTGTCATGTGCAAACTTGGGGTGCAGACCGTGGTGGAGGCCATGGAGATAGGAAGAGAGGCAGCAGAATGGGTGTCCAGTCATTTTACTCCTCCAATAAAACTGGAATTTGAAAAGGTTTATTTTCCCTACCTGTTGATCAACAAGAAGCGATACGCCGGGCTGTACTTCTCATCCAGCGCCAATACTCATGATAAGATGGACTGCAAAGGAATAGAGACTGTGCGAAGAGACAACTGCCCACTTGTGGCCAATTTGATAAATACTTGTCTGCAGAAAATTCTGATTGACCGGGATCCTATGGGAGCCGTGGAGCATGCTAAAGACGTGATCTCTGATTTGCTGTGCAATCGGATAGATATCTCGCAGCTTGTGATTACAAAGGAGTTGACGCGGACGGCTGATGAGTACGCAGGGAAACAGGCCCACGTGGAGCTTGCAGAGAGGATGAGAAAGCGTGACCCTGGCAGCGCCCCTAATCTGGGAGACCGAGTTCCGTATGTGATCATAGGAGCTGCAAAAGGAGTGGCCGCTTATATGAAGTCTGAGGACCCCATTTACGTGCTTGAGAATAACATCCCTATCGACACCCAATATTATCTGGAACAGCAACTTGCAAAACCTCTTCTTAGGATTTTTGAACCCATTCTGGGTGAATCCAAGGCCGAAAGTATTCTTCTGAAGGGGGAGCACACACGCTGCAAGACCGTGCTGAC
  5   1   0       add Te5       in                         CAAO4033.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTGATAATGAGCTGCTCAAAAGGCTGCTGAGAATGGAAGGGGTTGTTTTGAATTGCTCTGTTTATAAAGGAACAGGGGTATGGCCAGTGAAAACCGTTAAATTGGCAAAAATAATAGGAAACATGATTTTTTTTTTAATAATTGAAACCATAGGCAGATTGTAAGTTCAACACAAGTGGTGGTATTAGTATAGAGTACATAGTGCACTACTTTAAGGCTAGGGTCTATATGTAATATATGTTATATAATGAACGAATGGTTTATTTATGTGTAGAAAGCGCATGCACTGTAACGTTAATGGTTGCCAAAAGAGCCTTTATACACGTGCCCGCCTACCCATGGCGAGGTGCAGTCTGTACTCTGTGATTTGCCACTTTCATTGGCACAAGGAAGCTCTCTATATACCTGTATGTAACACTTGTCAGGAGCAGCCATTCAGTACAGAGCTGTGCAGGCAACTCCAACTTGTATGTATTAACTGATGTGCAGGTAGTTCCATCCCTTCACTCATCTTATTAAGCACATGTTCCATGTCAGCCACCATCAACCTTTTCTGATGTGCAAGTAAAGGGGATACATGTAATGGCATGGGGGCTGTATAGGCACAGTGTGGGCAACCCCGAACCCCTTGTTGCTTTGTAGGCCATGGTACCATGTGCTTCTATGCAGCCAGTGAATCATGCAGACAGGCAGCATCCAGTGATGTTGGTCCCTGCGCCAGGCATGTTTGGTACCCCCAGGTTATGTGAATTTAATGGCATTTATATCTTCCACAGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGGCT
  5   1   0       add Tad5      in                         XZT41590.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGAACAGATTGCTCTGTTTATAAAGGAACAGGGGTATGGCCATTGAAAACTGTTAAATTAGTGCTTTATAATGGCAAAAATAATAGGAAAACATGATTTTTGTTTTTAAAAATTGAAACCATAGGCAGATTGTAAGTTCAACACAAGTCTTATTTATTCAGTTCAGTTTTAGCAAAGATGCTTTTAGGTGTGTACTGTCCCTTTAAGTGGTGGTATTAGTATAGAGTACATAGTGCACTACTTTAAGGCTAGGGTCTATATATAATATATTTTATTTTACTCTGTGATTTGCCACTTTCATTGGCACAAGGAAGCACTCTATATACCTGTATGTAACACTTGTCAGGAGCAGCCATTCCATACAGAGCTGTGCAGGCAACTCCAACTTGTATGTATTGACTGATGTGCAGGTAGTTTCACTCCTTCAATCATCTTATTAAGCACATGTTCCACTTCAGCCACCATCAACCTTTTCTGATGTGCAAATAAAGGGCATACATGTAATGGCACGTGGGCTGTATAGGCGCAATGTGGGCAGCCCCGAACCCCTTGTTGCTTTGTAGGCCAGGGTACCATGTGCTTGTATGCAGCCAGCGAATCATGCAGACAGGCAGTAGTATCTAGTGAAGTTGGCCCCTTCACCAGGCATGTTTGGTACCCCCAGGTTATGTGAATTAATGGCATTTATATCTTCCCACAGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTA
  5   1   2       add Gas7      in                         XZG40600.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGATCCTATGGGCGCCGTGGAGCATGCTAAATACGTGATCTCTGATTTGCTGTGCAATCGGATAGATATCTCGCAGCTTGTGATTACAAAGGAGTTGACGCGGACGGCTGATGAGTACGCAGGGAAACAGGCCCACGTGGAGCTTGCAGAGAGGATGAGAAAGCGTGACCCCGGCAGCGCCCCTAATCTGGGAGACCGAGTTCCATATGTGATCATAGGAGCTGCAAAAGGAGTGGCCGCTTATATGAAGTCTGAGGACCCCATTTACGTGCTTGAGAATAACATCCCTATCGACACCCAATATTATCTGGAACAGCAACTTGCAAAACCTCTTCTTAGGATTTTTGAACCCATTCTGGGTGAATCCAAGGCCGAAAGTATTCTTCTGAAGGGGGAGCACACACGCTGCAAGACCGTGCTGACCGCCAAGGTTGGGGGCCTCATGGCGTTTGCTAAGAAACGCAGCACGTGCATTGGCTGCAAAGCAACACTAAATCATGATGGTGCTGTGTGCAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTCTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGCGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTG
  5   1   2       ext Tad5      in                          XZT6643.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACGTGATCTCTGATTTGCTGTGCAATCGGATAGATATCTCGCAGCTTGTGATTACAAAGGAGTTGACGCGGACGGCTGATGAGTACGCAGGGAAACAGGCCCACGTGGAGCTTGCAGAGAGGATGAGAAAGCGTGACCCTGGCAGCGCCCCTAATCTGGGAGACCGAGTTCCGTATGTGATCATAGGAGCTGCAAAAGGAGTGGCCGCTTATATGAAGTCTGAGGACCCCATTTACGTGCTTGAGAATAACATCCCTATCGACACCCAATATTATCTGGAACAGCAACTTGCAAAACCTCTTCTTAGGATTTTTGAACCCATTCTGGGTGAATCCAAGGCCGAAAGTATTCTTCTGAAGGGGGAGCACACACGCTGCAAGACCGTGCTGACCGCCAAGGTTGGGGGCCTCATGGCGTTTGCTAAGAAACGCAGCACGTGCATTGGCTGCAAAGCAACACTAAATCATGATGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTTTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGTGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGGACAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTT
  5   1   4      seed Gas7      in                         XZG63627.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCTGATTTGCTGTGCAATCGGATAGATATCTCGCAGCTTGTGATTACAAAGGAGTTGACGCGGACGGCTGATGAGTACGCAGGGAAACAGGCCCACGTGGAGCTTGCAGAGAGGATGAGAAAGCGTGACCCTGGCAGCGCCCCTAATCTGGGAGACCGAGTTCCGTATGTGATCATAGGAGCTGCAAAAGGAGTGGCCGCTTATATGAATTCTGAGGACCCCATTTACGTGCTTGAGAATAACATCCCTATCGACACCCAATATTATCTGGAACAGCAACTTGCAAAACCTCTTCTTAGGATTTTTGAACCCATTCTGGGTGAATCCAAGGCCGAAAGTATTCTTCTGAAGGGGGAGCACACACGCTGCAAGACCGTGCTGACCGCCAAGGTTGGGGGCCTCATGGCGTTTGCTAAGAAACGCAGCACGTGCATTGGCTGCAAAGCAACACTAAATCATGATGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTTTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGTGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGGACAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCCAACACAGATACGGATAGCGGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATC
  5   1   2       ext Gas7      in                         XZG31468.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGGAGCACACACGCTGCAAGACCGTGCTGACCGCCAAGGTTGGGGGCCTCATGGCGTTTGCTAAGAAACGCAGCACGTGCATTGGCTGCAAAGCAACACTAAATCATGATGGTGCTGTGTGCAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTCTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGCGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGAAGAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATATCTGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGAGCCAGGCAAAGAGCTGCACTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATT
  3   1   0       chi Tad5      in                         XZT41590.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGAAAAGGCCCCTTGTATCAAATCAGGAAAGTGGGAAATTGGCAGCAGAAATGAATGTATAGTGGTACATTACACTGACTGGTACAAGGAGTCCATTTTGACCCCAGGGAAGCCTGTTCCATGCAAGCGGTTAAACCTTTATTTTAGCTATGATTTAAGTCACACATTCTTTCATATAATGGATATTTTTATGTCTCTCTATTTCTCACCTAACATCTCAAACACTTTGTATGCCACAGCCGCGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGAAGAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATATCTGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTAATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGAGCCAGGCAAAGAGCTGCACTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCATTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTGCAGT
  3   1   4      seed Gas7      in                         XZG63627.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTTGCTAAGAAACGCAGCACGTGCATTGGCTGCAAAGCAACACTAAATCATGATGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTTTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGTGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGGACAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATAGCGGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGTGCCAGGCAAAGAGCTGCGCTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCTTTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTGC
  3   1   2       ext Te4       in                         CAAN5551.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGCAAAGCAACACTAAATCATGATGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTTTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGTGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGGACAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATAGCGGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGTGCCAGGCAAAGAGCTGCGCTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCTTTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTGCAGT
  3   1   2       add Te5       in                         CAAO4033.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTTTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGTGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGGACAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATAGCGGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGTGCCAGGCAAAGAGCTGCGCTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCTTTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTGCAGT
  3   1   2       add Tbd1 PIPE out                       CBXT20293.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTGCTGTGTGCAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTTTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGCGACTGCCCAATATTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAGAGTGAAGAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATATCTGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGGGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGAGCCAGGCAAAGAGCTGCACTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGGCTGCTCCTCTGCTTCATTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAGCAAATATCTAAGGAATAAAATATTTTGCAGTAAAAAAAAAAAAAAA
  3   1   3        nb Te4  5g3  out                        CAAN6379.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTTTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGTGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGGACAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATAGCGGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGTGCCAGGCAAAGAGCTGCGCTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCTTTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTGCAGT
  3   1   2       ext Te3       in                        CAAM15036.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTTTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGTGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGGACAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATAGCGGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGTGCCAGGCAAAGAGCTGCGCTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCTTTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTGCAGTAACTT
  3   1   3        nb Te4  5g3  out                        CAAN5843.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTTTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGTGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGGACAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATAGCGGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGTGCCAGGCAAAGAGCTGCGCTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCTTTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTGCAGTAACTT
  3   1   2       ext Tad5      in                          XZT6643.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGGCCTAGAAGAGAAATTTTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGTGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGGACAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATAGCGGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGTGCCAGGCAAAGAGCTGCGCTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCTTTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTGCAGTAAAAAAAAAAAAAAAGGGC
  3   1   3        nb Te3  5g3  out                        CAAM6615.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAGAGAAATTTTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGTGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGGACAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATAGCGGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGTGCCAGGCAAAGAGCTGCGCTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCTTTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTGCAGT
  3   1   2       add Gas7      in                         XZG40600.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAGAAATTCTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGCGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGAAGAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATATCTGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGAGCCAGGCAAAGAGCTGCACTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCATTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTGCAGTAAAAAAAAAAAAAAAGG
  3   1   3        nb Te4  5g3  out                        CAAN1263.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGTGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGGACAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATAGCGGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGTGCCAGGCAAAGAGCTGCGCTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCTTTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTGCAGT
  3   1   3        nb TpA  FL   out                   TTpA009c14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGCCGTGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTNAGGACCCTGTCCCTTCAGGACAAAGTGGACAGACTGAGATAAGATCTTCTCTCCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATAGCGGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGTGCCAGGCAAAGAGCTGCGCTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCTTTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTGCAGTAACTTAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas7      in                         XZG31468.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTGCCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGAAGAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATATCTGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGAGCCAGGCAAAGAGCTGCACTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCATTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTGCAGTAAAAAATAAACCAAAAAAAAACCAAAAAAAAAAAAAG
  5   1   2       ext Gas       in                   TGas121g06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTCTAAGACAGGCCATGAAAAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGAAGAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATATCTGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTAATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGAGCCAGGCAAAGAGCTGCACTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCATTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGA
  3   1   2       ext Gas       in                   TGas121g06.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTTTAAGACAGGCCATGAAAAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGAAGAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATATCTGCCATCATGCTTTCTGCATAAATACTGGACATTGCCCTCAGCTGCCACTAATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGAGCCAGGCAAAGAGCTGCACTCGGGCTGTATCCCCATGTTGGGGTTGGCAGGGGCCCCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCATTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTACAGTaaaaaaaaaaaataaaaaaaaagaaaaaaaaaaaaaaaaaaaaaaaaaGC
  3   1   3        nb Gas0      out                        dad28g06.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACCCTGTCCCTTCAGGACAAAGTGAAGAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATATCTGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTAATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGAGCCAGGCAAAGAGCTGCACTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCATTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAAATCTAAGGAATAAAATATTTTGCAGTAAAAAAAAA
  3   1   3        nb Gas       in                    TGas123j13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGGACATTGCCCTCAGCTGCCACTAATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGAGCCAGGCAAAGAGCTGCACTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCATTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTGCA
  5   1   3        nb Gas       in                   TGas123j13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGACATTGCCCTCAGCTGCCACTAATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGAGCCAGGCAAAGAGCTGCACTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCATTTCTGGGAAGACTTCAAGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAAGTTTTTGTACCGACAACAAATATCTAAAGAATAAAATATTTTGCAGT
  3   1   3        nb Gas7      in                         XZG12900.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACCACGCGTCCGGCCAGGCAAAGAGCTGCGCTCGGGCTGTATCCCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTGGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCTTTTCTGGGAAGCCTTCAGGTTTGTTACCCATTCTGTTTCATCCATCTTGATGGATTCTCAGGGTTTTTG
  5   1   3        nb Gas7      in                         XZG12900.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAAGAGCTGCGCTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCTTTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTGCAGTAAAAAAAAAAAAAAAGG
  5   1   2  SIG                                    Xt7.1-TNeu054j18.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGGAAACAGGCCCACGTGGAGCTTGCAGAGAGGATGAGAAAGCGTGACCCCGGCAGCGCCCCTAATCTGGGAGACCGAGTTCCATATGTGATCATAGGAGCTGCAAAAGGAGTGGCCGCTTATATGAAGTCTGAGGACCCCATTTACGTGCTTGAGAATAACATCCCTATCGACACCCAATATTATCTGGAACAGCAACTTGCAAAACCTCTTCTTAGGATTTTTGAACCCATTCTGGGTGAATCCAAGGCCGAAAGTATTCTTCTGAAGGGGGAGCACACACGCTGCAAGACCGTGCTGACCGCCAAGGTTGGGGGCCTCATGGCGTTTGCTAAGAAACGCAGCACGTGCATTGGCTGCAAAGCAACACTAAATCATGATGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTCTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGCGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGAAGAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATATCTGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGGGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGGCTGCTCCTCTGCTTCATTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAAT
                                                  Xt7.1-CHK-1008290934                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAGGCCCACGTGGAGCTTGCAGAGAGGATGAGAAAGCGTGACCCCGGCAGCGCCCCTAATCTGGGAGACCGAGTTCCATATGTGATCATAGGAGCTGCAAAAGGAGTGGCCGCTTATATGAAGTCTGAGGACCCCATTTACGTGCTTGAGAATAACATCCCTATCGACACCCAATATTATCTGGAACAGCAACTTGCAAAACCTCTTCTTAGGATTTTTGAACCCATTCTGGGTGAATCCAAGGCCGAAAGTATTCTTCTGAAGGGGGAGCACACACGCTGCAAGACCGTGCTGACCGCCAAGGTTGGGGGCCTCATGGCGTTTGCTAAGAAACGCAGCACGTGCATTGGCTGCAAAGCAACACTAAATCATGATGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTCTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGCGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGAAGAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATATCTGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGGGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGGCTGCTCCTCTGCTTCATTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTG
  5   1   2       ext Neu       in                   TNeu054j18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTTGAAAAGGTTTATTTTCCCTACCTGCTGATCAACAAGAAGCGATACGCTGGGCTGTACTTCTCATCCAGCGCCAATACTCATGATAAGATGGACTGCAAAGGAATAGAGACTGTGCGAAGAGACAACTGCCCACTTGTGGCCAATTTGATAAATACTTGTCTGCAGAAAATTCTGATTGACCGGGATCCTATGGGAGCCGTGGAGCATGCTAAAGACGTGATCTCTGATTTGCTGTGCAATCGGATAGATATCTCGCAGCTTGTGATTACAAAGGAGTTGACGCGGACGGCTGATGAGTACGCAGGGAAACAGGCCCACGTGGAGCTTGCAGAGAGGATGAGAAAGCGTGACCCCGGCAGCGCCCCTAATCTGGGAGACCGAGTTCCATATGTGATCATAGGAGCTGCAAAAGGAGTGGCCGCTTATATGAAGTCTGAGGACCCCATTTACGTGCTTGAGAATAACATCCCTATCGACACCCAATATTATCTGGAACAGCAACTTGCAAAACCTCTTCTTAGGATTTTTGAACCCATTCTGGGTGAATCCAAGGCCGAAAGTATTCTTCTGAAGGGGGAGCACACACGCTGCA
  5   1   2       ext Gas8      in                         st114h14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGGAAACAGGCCCACGTGGAGCTTGCAGAGAGGATGAGAAAGCGTGACCCCGGCAGCGCCCCTAATCTGGGAGACCGAGTTCCATATGTGATCATAGGAGCTGCAAAAGGAGTGGCCGCTTATATGAAGTCTGAGGACCCCATTTACGTGCTTGAGAATAACATCCCTATCGACACCCAATATTATCTGGAACAGCAACTTGCAAAACCTCTTCTTAGGATTTTTGAACCCATTCTGGGTGAATCCAAGGCCGAAAGTATTCTTCTGAAGGGGGAGCACACACGCTGCAAGACCGTGCTGACCGCCAAGGTTGGGGGCCTCATGGCGTTTGCTAAGAAACGCAGCACGTGCATTGGCTGCAAAGCAACACTAAATCATGATGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTCTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGCGACTGCCCAATCTTTTACATGAGAAAGAANGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCC
  5   1   2       ext Gas8      in                         st113h14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGGCCCACGTGGAGCTTGCAGAGAGGATGAGAAAGCGTGACCCCGGCAGCGCCCCTAATCTGGGAGACCGAGTTCCATATGTGATCATAGGAGCTGCAAAAGGAGTGGCCGCTTATATGAAGTCTGAGGACCCCATTTACGTGCTTGAGAATAACATCCCTATCGACACCCAATATTATCTGGAACAGCAACTTGCAAAACCTCTTCTTAGGATTTTTGAACCCATTCTGGGTGAATCCAAGGCCGAAAGTATTCTTCTGAAGGGGGAGCACACACGCTGCAAGACCGTGCTGACCGCCAAGGTTGGGGGCCTCATGGCGTTTGCTAAGAAACGCAGCACGTGCATTGGCTGCAAAGCAACACTAAATCATGATGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTCTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGCGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTT
  5   1   3        nb Gas8      in                         st115h14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCTTGCAGAGAGGATGANAAAGCGTGACCCCGGCNGCGCCCCTAATCTGGGAGACCGAGTTCCATATGTGATCATAGGAGCTGCAAAAGGAGTGGCCGCTTATATGAAGTCTGAGGACCCCATTTACGTGCTTGAGAATAACATCCCTATCGACACCCAATATTATCTGGAACANCAACTTGCAAAACCTCTTCTTAGGATTTTTGAACCCATTCTGGGTGAATCCAAGGCCGAAAGTATTCTTCTGAAGGGGGAGCACACACGCTGCAAGACCGTGCTGACCGCCNAGGTTGGGGGCCTCATGGCGTTTGCTAAGAAACNCANCACGTGCATTGGCTGCAAAGCAACACTAAATCATGATGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCANAAAGAGATCTCTCAACTTT
  3   1   2       ext Gas8      in                         st113h14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGGCCGAAAGTATTTTTCTGAAGGGGGAGCACACACGCTGCAAGACCGTGCTGACCGCCAAGGTTGGGGGCCTCATGGCGTTTGCTAAGAAACGCAGCACGTGCATTGGCTGCAAAGCAACACTAAATCATGATGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTCTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGCGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGAAGAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATATCTGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGGGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGGCTGCTCCTCTGCTTCATTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTT
  3   1   2       ext Gas8      in                         st114h14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGGAGCACACACGCTGCAAGACCGTGCTGACCGCCAAGGTTGGGGGCCTCATGGGCGTTTGCTAAGAAACGCAGCACGTGCATTGGCTGCAAAGCAACACTAAATCATGATGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTCTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGCGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGAAGAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATATCTGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGGGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGGCTGCTCCTCTGCTTCATTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTT
  3   1   2       ext Neu       in                    TNeu054j18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAACGCAGCACGGTGCATTGGCTGCAAAGCAACACTAAATCCATGATGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAAGAGATCTCTCAAACTTTCGGGCCTAGAAGAGAAATTCTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGCGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGAAGAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATATCTGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTAATCTGGGAGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCACACCTTATTACCTTTTATATTCCCATTACAGATAAAAAAAAAAGCTTTAAGGCACTTAAAGACCATAAGTTGCTATACCCTGTCATGGAGCCAGGCAAAGAGCTGCACTCGGGCTGTATCGCCATGTTGGGGTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGCTGCTCCTCTGCTTCATTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCGTCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACTTATGGGTAAGGAATAAAATATTTTGCAGTTCTTTTTTAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas8      in                         st115h14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAAGAAACGCAGCACGTGCATNGGCTGCAAAGCAACACTAAATCATGATGGTGCTGTGTGTAACTACTGCAAGCAGCGCGAGTCTGAACTTATCCAGAAAGAGATCTCTCAACTTTCGGGCCTAGAAGAGAAATTCTCTCGTCTTTGGACCCAGTGCCAGCGGTGCCAGGGCAGCTTACACGAGGATGTTCTATGCACAAGCCGCGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGAAGAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATATCTGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGGGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGGCTGCTCCTCTGCTTCATTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTT
  5   1   2       ext Gas       in                   TGas119o17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGGGGCCCGGGGGCTTACACGAGGATGTTCTATGCACAAGCCGCGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGAAGAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATATCTGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGGGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCAGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAACTGAGGGGCTGCTCCTCTGCTTCATTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTGCAGT
  3   1   2       ext Gas       in                    TGas119o17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCGGGGGCTTACACGAGGATGTTCTATGCACAAGCCGCGACTGCCCAATCTTTTACATGAGAAAGAAGGTGCAGAAAGACCTGGATGACCAGGAGAAGCTGATCCTTCGCTTTGGACCCCCAGCTTGGTAGGACCCTGTCCCTTCAGGACAAAGTGAAGAGACTGAGATAAGATCTTCTCTCCTGTAGGTTCCTGATTGGGTTTGGGAAAGGAGTCAGGAGTTGGGCCTGCGATTTCCCAGATGTGTTTGCCAAACACAGATACGGATATCTGCCATCATGCTTTCTGCATAACTACTGGACATTGCCCTCAGCTGCCACTGATCTGGGGGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGGCTGCTCCTCTGCTTCATTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTGCA
  3   1   2       ext Eye       out                        CCAX4417.g3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAACATTGCCCTCAGCTCCCACTGATCTGGGGGCATATAATGGACTGGCGATTGGGGTTTCTTTTTGGCAGGGGCACCATTCCCATTTGTTCCATTTGTACTTAGAATACAAACTGAGGGGCTGCTCCTTTGCTTCATTTCTGGGAAGACTTCAGGTTTGTTACACATTCTGTTTCATCCACTTGATGGATTCTCAGGTTTTTGTACCGACAACAAATATCTAAGGAATAAAATATTTTGCAGTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)