Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TGas120h03.3.5                      100 END     1           4        1                MGC80689 protein [Xenopus laevis]
     2   2.0    0Xt7.1-TEgg125o12.5                          5 END     2           8       40                PREDICTED: similar to laminin, alpha 2 (merosin, congenital muscular dystrophy) [Gallus gallus]

 This cluster: approximate FL confidence score = 0%

 1012076081 Xt7.1-CABE11904.3 - 23 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     6     6     6     6     6     6     6     6     6     6     5     6     5     5     5     5     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     9     9    10    10    11    11    11    11    12    12    12    12    13    13    13    13    15    15    15    15    15    15    16    16    18    18    18    18    18    18    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    16    16    16    16    16    16    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    16    16    16    16    16    16    16    16    16    16    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    14    14    14    14    14    14    14    14    14    14    13    13    13    13    13    13    13    13    13    13     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -A----------
                                                                       ...PROTEIN --- Xl ---- 8e-009     AAL02123.1 Slit [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Xt ---- 7e-011     AAI25708.1 Hypothetical protein MGC145769 [Xenopus tropicalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 6e-017     ABJ09595.1 gamma-carboxyglutamic acid protein 4 [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 5e-034     NP_476617.1 CG10236-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 3e-040     NP_001023281.1 K08C7.3a [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED = ?? ==== 3e-042     XP_696971.1 PREDICTED: similar to laminin alpha 2 subunit precursor, partial [Danio rerio] ===============================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 2e-042     XP_795348.2 PREDICTED: similar to laminin alpha chain, partial [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 9e-097     NP_001030158.1 hypothetical protein LOC569971 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_032507.2 laminin, alpha 2 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_001073291.1 laminin alpha 2 subunit isoform b precursor [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_419746.2 PREDICTED: similar to laminin, alpha 2 (merosin, congenital muscular dystrophy) [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABE11904.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------TGATAA---------------------------------------------------ATG---------------------------------------------------------------------ATG------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   2       bld Tad5                                 XZT28451.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGACGTCTACAGAATAACCATCAGACCTGAAAAGGGGGAGTTCCATGATGGGAAAGAACATTCTCTCCGGCTAGAAAGAACACGAAATCTGTTTACTGTTCAGGTTGATGAAGATAAGACTCAGACACTGAAAATTCCATCTAGCCAATCATTGGATGTGAAAAAGCTCTTTGTAGGAGGCATTGATTCTGATACACAGTTTTTACCGTTCCGAAACGTACCGCCATTTGAAGGATGCATTTGGAACCTTCTTGTCAATGCTGTGCCAATGGATTTCGCTCAGCCTGTGTCTTTTGAGAATGCTGATATTGGTCAGTGTCCCACTCTGTTGCAAGACAGGTTACCAACACATCCAGAAGAAAATGGAGACAGGGATAAAAATGCAACTCAATCATTAGTTTTACCTACTGCAACACCATATCCTGTTCCTCCTTCTGAGCCTGACTCCACTGACGAGAAGAGTGCCAACATAACAGATGACCATGAGACCCCAACGGGTGGATGTGCGGCTGACAGAGATCCACTAATATTGAAGAATGGGAAACAATTTGGACTCTCCAGAAACAGTCATGTTGCATTTGCATTTGATGATACCAAAGTGAAAAACACACTTTCCATTGAACTTGAGCTTCGTACTGAAGCAGAGTCTGGGTTAGTATTCTACATGGCTCGCATAAACCATGCTGATTTTGCTACAATTCAGATAAAAGAAGGAATGGCTCACTTTAGATATGATCTCGGAAGTGGTGACACCAGCACAATGGTTCCTCTTCGATAAATGATGGAAGTTGGCAC
  5   1   2       bld Te1       out                       CBWN10904.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTTTACTGTTCAGGTTGATGAAGATAAGACTCAGACACTGAAAATTCCATCTAGCCAATCATTGGATGTGAAAAAGCTCTTTGTAGGAGGCATTGATTCTGATACACAGTTTTTACCGTTCCGAAACGTACCGCCATTTGAAGGATGCATTTGGAACCTTCTTGTCAATGCTGTGCCAATGGATTTCGCTCAGCCTGTGTCTTTTGAGAATGCTGATATTGGTCAGTGTCCCACTCTGTTGCAAGACAGGTTACCAACACATCCAGAAGAAAATGGAGACAGGGATAAAAATGCAACTCAATCATTAGTTTTACCTACTGCAACACCATATCCTGTTCCTCCTTCTGAGCCTGACTCCACTGACGAGAAGAGTGCCAACATAACAGATGACCATGAGACCCCAACGGGTGGATGTGCGGCTGACAGAGATCCACTAATATTGAAGAATGGGAAACAATTTGGACTCTCCAGAAACAGTCATGTTGCATTTGCATTTGATGATACCAAAGTGAAAAACACACTTTCCATTGAACTTGAGCTTCGTACTGAAGCAGAGTCTGGGTTAGTATTCTACATGGCTCGCATAAACCATGCTGATTTTGCTACAATTCAGATCAAAGAAGGAATGGCTCACTTTAGATATGATCTTGGAAGTGGTGACACCAGCACAATGGTTCCTCTTCGAATAAATGATGGAAGTTGGCACAAGATAACGGTATTCAGGACAAAGCAAACAGCATATCTTTTTGTGGATAACATTAGTA
  5   1   2       bld Brn2      in                        CAAJ20287.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACAGGATATGGTGTTGCAGTAGGTAAAACTATATCCTGTTCCTCCTTCTGAGCCTGACTCCACTGACGAGAAGAGTGCCAACATAACAGATGACCATGAGACCCCAACGGGTGGATGTGCGGCTGACAGAGATCCACTAATATTGAAGAATGGGAAACAATTTGGACTCTCCAGAAACAGTCAAATGCAAATGCAACATGACTGTTTCTGGAGAGTCATGTTGCATTTGCATTTGATGATACCAAAGTGAAAAACACACTTTCCATTGAACTTGAGCTTCGTACTGAAGCAGAGTCTGGGTTAGTATTCTACATGGCTCGCATAAACCATGCTGATTTTGCTACAATTCAGATAAAAGAAGGAATGGCTCACTTTAGATATGATCTCGGAAGTGGTGACACCAGCACAATGGTTCCTCTTCGAATAAATGATGGAAGTTGGCACAAGATAACGGTATTCAGGACAAAGCAAACAGCATATCTTTTTGTGGATAACATTAGTAACTCCACTGTGAGTCCAAAGAAAGCAGATATCCTTGATGTGGTTGGAATGCTTTATGTTGGTGGGTTGCCTATAAATTACACCACCAAAAGAATTGGTCCAGTGCTGCATAGTATACATGGCTGCATCCGAAATTTCAGAATGGTGGAAGGGCATACAGACCTAGAAAATCCAACGTCCAGCTATAATGTTGGTTCTTGCTTTGTAAACCCTGAAAAGGGAACATATTTTCATGGATCAGGCTTTGCAAAAGCAGTTGGAGCATTTAAAGTCGGCATGGATCTTCTTGTAGAGCTGGAGTTCCGTACATCAAAAACAAATGGAGTTATTCTTGGATAAGT
  5   1   2       bld Te1       in                         CBWN8611.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAACAATTTGGACTCTCCAGAAACAGTCATGTTGCATTTGCATTTGATGATACCAAAGTGAAAAACACACTTTCCATTGAACTTGAGCTTCGTACTGAAGCAGAGTCTGGGTTAGTATTCTACATGGCTCGCATAAACCATGCTGATTTTGCTACAATTCAGATAAAAGAAGGAATGGCTCACTTTAGATATGATCTCGGAAGTGGTGACACCAGTACAATGGTTCCTCTTCGAATAAATGATGGAAGTTGGCACAAGATAACGGTATTCAGGACAAAGCAAACAGCATATCTTTTTGTGGATAACATTAGTAACTCCACTGTGAGTCCAAAGAAAGCAGATATCCTTGATGTGGTTGGAATGCTTTATGTTGGTGGGTTGCCTATAAATTACACCACCAAAAGAATTGGTCCAGTGCTGCATAGTATACATGGCTGCATCCGAAATTTCAGAATGGTGGAAGGGCATACAGACCTAGAAAATCCAACGTCCAGCTATAATGTTGGTTCTTGCTTTGTAAACCCTGAAAAGGGAACATATTTTCATGGATCAGGCTTTGCAAAAGCAGTTGGAGCATTTAAAGTCGGCATGGATCTTCTTGTAGAGCTGGAGTTCCGTACATCAAAAACAAATGGAGTTATTCTTGGAATAAGTGGCAAAAAGATGGATGGATTGNGCATTGAATTAGTGGATGGTAAACTTCTTTTCCATGCAGACAATGGAGCTGGTCGTTTTACAGCATTCTATGAAC
  5   1   2       bld Thy1      in                        CBST4756.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGATTTTGCTACAATTCAGATAAAAGAAGGAATGGCTCACTTTAGATATGATCTCGGAAGTGGTGACACCAGCACAATGGTTCCTCTTCGAATAAATGATGGAAGTTGGCACAAGATAACGGTATTCAGGACAAAGCAAACAGCATATCTTTTTGTGGATAACATTAGTAACTCCACTGTGAGTCCAAAGAAAGCAGATATCCTTGATGTGGTTGGAATGCTTTATGTTGGTGGGTTGCCTATAAATTACACCACCAAAAGAATTGGTCCAGTGCTGCATAGTATACATGGCTGCATCAGAAATTTCAGAATGGTGGAAGGGCATACAGACCTAGAAAATCCAACGTCCAGCTATAATGTTGGTTCTTGCTTTGTAAACCCTGAAAAGGGAACATATTTTCATGGATCAGGCTTTGCAAAAGCAGTTGGAGCATTTAAAGTCGGCATGGATCTTCTTGTAGAGCTGGAGTTCCGTACATCAAAAACAAATGGAGTTATTCTTGGAATAAGTGGCAAAAAGATGGATGGATTGGGCATTGAATTAGTGGATGGTAAACTTCTTTTCCATGCAGACAATGGAGCTGGTCGTTTTACAGCATTCTATGAACCAGAGCTTCCAGGTGGTTTATGTGATGGGAAGTGGCACAAAGTGTCAGCAAGCAAACTTAAGCACCGCTTAGAGCTGATAGTCGATGAGAACAAAGTAGAAGCAAGTAGCTCTAATTCTGCATCCACCTCTGCAGATACAAATGATCCAGTTTATGTTG
  5   1   2       bld Bone      in                        CBTC9786.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCTCACTTTAGATATGATCTCGGAAGTGGTGACACCAGCACAATGGTTCCTCTTCGAATAAATGATGGAAGTTGGCACAAGATAACGGTATTCAGGACAAAGCAAACAGCATATCTTTTTGTGGATAACATTAGTAACTCCACTGTGAGTCCAAAGAAAGCAGATATCCTTGATGTGGTTGGAATGCTTTATGTTGGTGGGTTGCCTATAAATTACACCACCAAAAGAATTGGTCCAGTGCTGCATAGTATACATGGCTGCATCAGAAATTTCAGAATGGTGGAAGGGCATACAGACCTAGAAAATCCAACGTCCAGCTATAATGTTGGTTCTTGCTTTGTAAACCCTGAAAAGGGAACATATTTTCATGGATCAGGCTTTGCAAAAGCAGTTGGAGCATTTAAAGTCGGCATGGATCTTCTTGTAGAGCTGGAGTTCCGTACATCAAAAACAAATGGAGTTATTCTTGGAATAAGTGGCAAAAAGATGGATGGATTGGGCATTGAATTAGTGGATGGTAAACTTCTTTTCCATGCAGACAATGGAGCTGGTCGTTTTACAGCATTCTATGAACCAGAGCTTCCAGGTGGTTTATGTGATGGGAAGTGGCACAAAGTGTCAGCAAGCAAACTTAAGCACCGCTTAGAGCTGATAGTCGATGAGAACAAAGTAGAAGCAAGTAGCTCTAATTCTGCATCCACCTCTGCAGATACAAATGATCCAGTTTATGTTGGGG
  5   1   2       bld Ova1      in                        CABE11904.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACAAAGCAAACAGCATATCTTTTTGTGGATAACATTAGTAACTCCACTGTGAGTCCAAAGAAAGCAGATATCCTTGATGTGGTTGGAATGCTTTATGTTGGTGGGTTGCCTATAAATTACACCACCAAAAGAATTGGTCCAGTGCTGCATAGTATACATGGCTGCATCAGAAATTTCAGAATGGTGGAAGGGCATACAGACCTAGAAAATCCAACGTCCAGCTATAATGTTGGTTCTTGCTTTGTAAACCCTGAAAAGGGAACATATTTTCATGGATCAGGCTTTGCAAAAGCAGTTGGAGCATTTAAAGTCGGCATGGATCTTCTTGTAGAGCTGGAGTTCCGTACATCAAAAACAAATGGAGTTATTCTTGGAATAAGTGGCAAAAAGATGGATGGATTGGGCATTGAATTAGTGGATGGTAAACTTCTTTTCCATGCAGACAATGGAGCTGGTCGTTTTACAGCATTCTATGAACCAGAGCTTCCAGGTGGTTTATGTGATGGGAAGTGGCACAAAGTGTCAGCAAGCAAACTTAAGCACCGCTTAGAGCTGATAGTCGATGAGAACAAAGTAGAAGCAAGTAGCTCTAATTCTGCATCCACCTCTGCAGATACAAATGATCCAGTTTATGTTGGGGGTTATCCTGAAGGACTGAGTCAGTTTGGCCTGACCACTGATGAGAGATTTAAGGGTTGCATCAGAGATCTCAAACTTACCAAAGGGAAATCAAAACCACAGGAAATTAACTTCAGCAAGGCACTGGAGCTGGAAGGAGTGCAGCCATTAACTTGCCCAGGAATTTAACACAATTTGTTTTGATAATTAACCCAAACATATCACATTATTGTGTACTGGAAAG
  5   1   2       bld Gas8      in                          st35k22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATGCTTTATGTTGGTGGGTTGCCTATAAATTACACCACCAAAAGAATTGGTCCAGTGCTGCATAGTATACATGGCTGCATCAGAAATTTCAGAATGGTGGAAGGGCATACAGACCTAGAAAATCCAACGTCCAGCTATAATGTTGGTTCTTGCTTTGTAAACCCTGAAAAGGGAACATATTTTCATGGATCAGGCTTTGCAAAAGCAGTTGGAGCATTTAAAGTCGGCATGGATCTTCTTGTAGAGCTGGAGTTCCGTACATCAAAAACAAATGGAGTTATTCTTGGAATAAGTGGCAAAAAGATGGATGGATTGGGCATTGAATTAGTGGATGGTAAACTTCTTTTCCATGCAGACAATGGAGCTGGTCGTTTTACAGCATTCTATGAACCAGAGCTTCCAGGTGGTTTATGTGATGGGAAGTGGCACAAAGTGTCAGCAAGCAAACTTAAGCACCGCTTAGAGCTGATAGTCGATGAGAACAAAGTAGAAGCAAGTAGCTCTAATTCTGCATCCACCTCTGCAGATACAAATGATCCAGTTTATGTTGGGGGTTATCCTGAAGGACTGAGTCAGTTTGGCCTGACCACTGATGAGAGATTTAAGGGTTGCATCAGAG
  3   1   2      seed Ova1      in                        CABE11904.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTGGTCCAGTGCTGCATAGTATACATGGCTGCATCAGAAATTTCAGAATGGTGGAAGGGCATACAGACCTAGAAAATCCAACGTCCAGCTATAATGTTGGTTCTTGCTTTGTAAACCCTGAAAAGGGAACATATTTTCATGGATCAGGCTTTGCAAAAGCAGTTGGAGCATTTAAAGTCGGCATGGATCTTCTTGTAGAGCTGGAGTTCCGTACATCAAAAACAAATGGAGTTATTCTTGGAATAAGTGGCAAAAAGATGGATGGATTGGGCATTGAATTAGTGGATGGTAAACTTCTTTTCCATGCAGACAATGGAGCTGGTCGTTTTACAGCATTCTATGAACCAGAGCTTCCAGGTGGTTTATGTGATGGGAAGTGGCACAAAGTGTCAGCAAGCAAACTTAAGCACCGCTTAGAGCTGATAGTCGATGAGAACAAAGTAGAAGCAAGTAGCTCTAATTCTGCATCCACCTCTGCAGATACAAATGATCCAGTTTATGTTGGGGGTTATCCTGAAGGACTGAGTCAGTTTGGCCTGACCACTGATGAGAGATTTAAGGGTTGCATCAGAGATCTCAAACTTACCAAAGGGAAATCAAAACCACAGGAAATTAACTTCAGCAAGGCACTGGAGCTGGAAGGAGTGCAGCCATTAACTTGCCCAGGAATTTAACACAATTTGTTTTGATAATTAACCCAAACATATCACATTATTGTGTACTGGAAAGTGCACAAACTTGCCATGGAAGCATGGCACACCCATGCCAACATCAGCCTCATCATTAATCCTATATTTGAATGTTATTCACTAAATATGTTGAATAAAGAATAATTATATTATC
  5  -1   2       bld Ovi1      in                         CABI7369.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGGAAGGGCATACAGACCTAGAAAATCCAACGTCCAGCTATAATGTTGGTTCTTGCTTTGTAAACCCTGAAAAGGGAACATATTTTCATGGATCAGGCTTTGCAAAAGCAGTTGGAGCATTTAAAGTCGGCATGGATCTTCTTGTAGAGCTGGAGTTCCGTACATCAAAAACAAATGGAGTTATTCTTGGAATAAGTGGCAAAAAGATGGATGGATTGGGCATTGAATTAGTGGATGGTAAACTTCTTTTCCATGCAGACAATGGAGCTGGTCGTTTTACAGCATTCTATGAACCAGAGCTTCCAGGTGGTTTATGTGATGGGAAGTGGCACAAAGTGTCAGCAAGCAAACTTAAGCACCGCTTAGAGCTGATAGTCGATGAGAACAAAGTAGAAGCAAGTAGCTCTAATTCTGCATCCACCTCTGCAGATACAAATGATCCAGTTTATGTTGGGGGTTATCCTGAAGGACTGAGTCAGTTTGGCCTGACCACTGATGAGAGATTTAAGGGTTGCATCAGAGATCTCAAACTTACCAAAGGGAAATCAAAACCACAGGAAATTAACTTCAGCAAGGCACTGGAGCTGGAAGGAGTGCAGCCATTAACTTGCCCAGGAATTTAACACAATTTGTTTTGATAATTAACCCAAACATATCACATTATTGTGTACTGGAAAGTGCACAAACTTGCCATGGAAGCATGGCACACCCATGCCAACATCAGCCTCATCATTAATCCTATATTTGAATGTTATTCACTAAATATGTTGAATAAAGAATAATTATATTATC
  3   1   2       bld Brn2      in                        CAAJ20287.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCATACAGACCTAGAAAATCCAACGTCCAGCTATAATGTTGGTTCTTGCTTTGTAAACCCTGAAAAGGGAACATATTTTCATGGATCAGGCTTTGCAAAAGCAGTTGGAGCATTTAAAGTCGGCATGGATCTTCTTGTAGAGCTGGAGTTCCGTACATCAAAAACAAATGGAGTTATTCTTGGAATAAGTGGCAAAAAGATGGATGGATTGGGCATTGAATTAGTGGATGGTAAACTTCTTTTCCATGCAGACAATGGAGCTGGTCGTTTTACAGCATTCTATGAACCAGAGCTTCCAGGTGGTTTATGTGATGGGAAGTGGCACAAAGTGTCAGCAAGCAAACTTAAGCACCGCTTAGAGCTGATAGTCGATGAGAACAAAGTAGAAGCAAGTAGCTCTAATTCTGCATCCACCTCTGCAGATACAAATGATCCAGTTTATGTTGGGGGTTATCCTGAAGGACTGAGTCAGTTTGGCCTGACCACTGATGAGAGATTTAAGGGTTGCATCAGAGATCTCAAACTTACCAAAGGGAAATCAAAACCACAGGAAATTAACTTCAGCAAGGCACTGGAGCTGGAAGGAGTGCAGCCATTAACTTGCCCAGGAATTTAACACAATTTGTTTTGATAATTAACCCAAACATATCACATTATTGTGTACTGGAAAGTGCACAAACTTGCCATGGAAGCATGGCACACCCATGCCAACATCAGCCTCATCATTAATCCTATATTTGAATGTTATTCACTAAATATGTTGAATAAAGAATAATTATATTATC
  3   1   2       bld Thy1      in                        CBST4756.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTAGAAAATCCAACGTCCAGCTATAATGTTGGTTCTTGCTTTGTAAACCCTGAAAAGGGAACATATTTTCATGGATCAGGCTTTGCAAAAGCAGTTGGAGCATTTAAAGTCGGCATGGATCTTCTTGTAGAGCTGGAGTTCCGTACATCAAAAACAAATGGAGTTATTCTTGGAATAAGTGGCAAAAAGATGGATGGATTGGGCATTGAATTAGTGGATGGTAAACTTCTTTTCCATGCAGACAATGGAGCTGGTCGTTTTACAGCATTCTATGAACCAGAGCTTCCAGGTGGTTTATGTGATGGGAAGTGGCACAAAGTGTCAGCAAGCAAACTTAAGCACCGCTTAGAGCTGATAGTCGATGAGAACAAAGTAGAAGCAAGTAGCTCTAATTCTGCATCCACCTCTGCAGATACAAATGATCCAGTTTATGTTGGGGGTTATCCTGAAGGACTGAGTCAGTTTGGCCTGACCACTGATGAGAGATTTAAGGGTTGCATCAGAGATCTCAAACTTACCAAAGGGAAATCAAAACCACAAGAAATTAACTTCAGCAAGGCACTGGAGCTGGAAGGAGTGCAGCCATTAACTTGCCCAGGAATTTAACACAATTTGTTTTGATAATTAACCCAAACATATCACATTATTGTGTACTGGAAAGTGCACAAACTTGCCATGGAAGCATGGCACACCCATGCCAACATCAGCCTCATCATTAATCCTATATTTGAATGTTATTCACTAAATATGTTGAATAAAGAATAATTATATTATC
  3   1   2       bld Gas8      in                          st35k22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGTCCAGCTATAATGTTGGTTCNTGCTTTGTAAACCCTGAAAAGGGAACATATTTTCATGGATCAGGCTTTGCAAAAGCAGTTGGAGCATTTAAAGTCGGCATGGATCTTCTTGTAGAGCTGGAGTTCCGTACATCAAAAACAAATGGAGTTATTCTTGGAATAAGTGGCAAAAAGATGGATGGATTGGGCATTGAATTAGTGGATGGTAAACTTCTTTTCCATGCAGACAATGGAGCTGGTCGTTTTACAGCATTCTATGAACCAGAGCTTCCAGGTGGTTTATGTGATGGGAAGTGGCACAAAGTGTCAGCAAGCAAACTTAAGCACCGCTTAGAGCTGATAGTCGATGAGAACAAAGTAGAAGCAAGTAGCTCTAATTCTGCATCCACCTCTGCAGATACAAATGATCCAGTTTATGTTGGGGGTTATCCTGAAGGACTGAGTCAGTTTGGCCTGACCACTGATGAGAGATTTAAGGGTTGCATCAGAGATCTCAAACTTACCAAAGGGAAATCAAAACCACAGGAAATTAACTTCAGCAAGGCACTGGAGCTGGAAGGAGTGCAGCCATTAACTTGCCCAGGAATTTAACACAATTTGTTTTGATAATTAACCCAAACATATCACATTATTGTGTACTGGAAAGTGCACAAACTTGCCATGGAAGCATGGCACACCCATGCCAACATCAGCCTCATCATTA
  3   1   2       bld Bone                                CBTC5543.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTGCTTTGTAAACCCTGAAAAGGGAACATATTTTCATGGATCAGGCTTTGCAAAAGCAGTTGGAGCATTTAAAGTCGGCATGGATCTTCTTGTAGAGCTGGAGTTCCGTACATCAAAAACAAATGGAGTTATTCTTGGAATAAGTGGCAAAAAGATGGATGGATTGGGCATTGAATTAGTGGATGGTAAACTTCTTTTCCATGCAGACAATGGAGCCGGTCGTTTTACAGCAGTCTATGAACCAGAGCTTCCAGGTGGTTTATGTGATGGGAAGTGGCACAAAGTGTCAGCAAGCAAACTTAAGCACCGCTTAGAGCTGATAGTCGATGAGAACAAAGTAGAAGCAAGTAGCTCTAATTCTGCATCCACCTCTGCAGATACAAATGATCCAGTTTATGTTGGGGGTTATCCTGAAGGACTGAGTCAGTTTGGCCTGACCACTGATGAGAGATTTAAGGGTTGCATCAGAGATCTCAAACTTACCAAAGGGAAATCAAAACCACAGGAAATTAACTTCAGCAAGGCACTGGAGCTGGAAGGAGTGCAGCCATTAACTTGCCCAGGAATTTAACACAATTTGTTTTGATAATTAACCCAAACATATCACATTATTGTGTACTGGAAAGTGCACAAACTTGCCATGGAAGCATGGCACACCCATGCCAACATCAGCCTCATAATTAATCCTATATTTGAATGTTATTCACTAAATATGTTGAATAAAGAATAATTATATTATC
  3   1   2       bld Bone      in                        CBTC9786.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGAACATATTTTCATGGATCAGGCTTTGCAAAAGCAGTTGGAGCATTTAAAGTCGGCATGGATCTTCTTGTAGAGCTGGAGTTCCGTACATCAAAAACAAATGGAGTTATTCTTGGAATAAGTGGCAAAAAGATGGATGGATTGGGCATTGAATTAGTGGATGGTAAACTTCTTTTCCATGCAGACAATGGAGCTGGTCGTTTTACAGCATTCTATGAACCAGAGCTTCCAGGTGGTTTATGTGATGGGAAGTGGCACAAAGTGTCAGCAAGCAAACTTAAGCACCGCTTAGAGCTGATAGTCGATGAGAACAAAGTAGAAGCAAGTAGCTCTAATTCTGCATCCACCTCTGCAGATACAAATGATCCAGTTTATGTTGGGGGTTATCCTGAAGGACTGAGTCAGTTTGGCCTGACCACTGATGAGAGATTTAAGGGTTGCATCAGAGATCTCAAACTTACCAAAGGGAAATCAAAACCACAGGAAATTAACTTCAGCAAGGCACTGGAGCTGGAAGGAGTGCAGCCATTAACTTGCCCAGGAATTTAACACAATTTGTTTTGATAATTAACCCAAACATATCACATTATTGTGTACTGGAAAGTGCACAAACTTGCCATGGAAGCATGGCACACCCATGCCAACATCAGCCTCATCATTAATCCTATATTTGAATGTTATTCACTAAATATGTTGAATAAAGAATAATTATATTATC
  5   1   2       bld Bone      in                        CBTC3407.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCTTTGCAAAAGCAGTTGGAGCATTTAAAGTCGGCATGGATCTTCTTGTAGAGCTGGAGTTCCGTACATCAAAAACAAATGGAGTTATTCTTGGAATAAGTGGCAAAAAGATGGATGGATTGGGCATTGAATTAGTGGATGGTAAACTTCTTTTCCATGCAGACAATGGAGCCGGTCGTTTTACAGCAGTCTATGAACCAGAGCTTCCAGGTGGTTTATGTGATGGGAAGTGGCACAAAGTGTCAGCAAGCAAACTTAAGCACCGCTTAGAGCTGATAGTCGATGAGAACAAAGTAGAAGCAAGTAGCTCTAATTCTGCATCCACCTCTGCAGATACAAATGATCCAGTTTATGTTGGGGGTTATCCTGAAGGACTGAGTCAGTTTGGCCTGACCACTGATGAGAGATTTAAGGGTTGCATCAGAGATCTCAAACTTACCAAAGGGAAATCAAAACCACAGGAAATTAACTTCAGCAAGGCACTGGAGCTGGAAGGAGTGCAGCCATTAACTTGCCCAGGAATTTAACACAATTTGTTTTGATAATTAACCCAAACATATCACATTATTGTGTACTGGAAAGTGCACAAACTTGCCATGGAAGCATGGCACACCCATGCCAACATCAGCCTCATAATTAATCCTATATTTGAATGTTATTCACTAAATATGTTGAATAAAGAATAATTATATTATC
  3   1   2       bld Bone      in                        CBTC3407.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCTTTGCAAAAGCAGTTGGAGCATTTAAAGTCGGCATGGATCTTCTTGTAGAGCTGGAGTTCCGTACATCAAAAACAAATGGAGTTATTCTTGGAATAAGTGGCAAAAAGATGGATGGATTGGGCATTGAATTAGTGGATGGTAAACTTCTTTTCCATGCAGACAATGGAGCCGGTCGTTTTACAGCAGTCTATGAACCAGAGCTTCCAGGTGGTTTATGTGATGGGAAGTGGCACAAAGTGTCAGCAAGCAAACTTAAGCACCGCTTAGAGCTGATAGTCGATGAGAACAAAGTAGAAGCAAGTAGCTCTAATTCTGCATCCACCTCTGCAGATACAAATGATCCAGTTTATGTTGGGGGTTATCCTGAAGGACTGAGTCAGTTTGGCCTGACCACTGATGAGAGATTTAAGGGTTGCATCAGAGATCTCAAACTTACCAAAGGGAAATCAAAACCACAGGAAATTAACTTCAGCAAGGCACTGGAGCTGGAAGGAGTGCAGCCATTAACTTGCCCAGGAATTTAACACAATTTGTTTTGATAATTAACCCAAACATATCACATTATTGTGTACTGGAAAGTGCACAAACTTGCCATGGAAGCATGGCACACCCATGCCAACATCAGCCTCATAATTAATCCTATATTTGAATGTTATTCACTAAATATGTTGAATAAAGAATAATTATATTATC
  3   1   2       bld Te1       in                         CBWN8611.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTTGTAGAGCTGGAGTTCCGTACATCAAAAACAAATGGAGTTATTCTTGGAATAAGTGGCAAAAAGATGGATGGATTGGGCATTGAATTAGTGGATGGTAAACTTCTTTTCCATGCAGACAATGGAGCTGGTCGTTTTACAGCATTCTATGAACCAGAGCTTCCAGGTGGTTTATGTGATGGGAAGTGGCACAAAGTGTCAGCAAGCAAACTTAAGCACCGCTTAGAGCTGATAGTCGATGAGAACAAAGTAGAAGCAAGTAGCTCTAATTCTGCATCCACCTCTGCAGATACAAATGATCCAGTTTATGTTGGGGGTTATCCTGAAGGACTGAGTCAGTTTGGCCTGACCACTGATGAGAGATTTAAGGGTTGCATCAGAGATCTCAAACTTACCAAAGGGAAATCAAAACCACAGGAAATTAACTTCAGCAAGGCACTGGAGCTGGAAGGAGTGCAGCCATTAACTTGCCCAGGAATTTAACACAATTTGTTTTGATAATTAACCCAAACATATCACATTATTGTGTACTGGAAAGTGCACAAACTTGCCATGGAAGCATGGCACACCCATGCCAACATCAGCCTCATCATTAATCCTATATTTGAATGTTATTCACTAAATATGTTGAATAAAGAATAATTATATTATCAAAAAAAAAAAAAAA
  3   1   2       bld Te3       out                        CAAM9615.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTAGAGCTGGAGTTCCGTACATCAAAAACAAATGGAGTTATTCTTGGAATAAGTGGCAAAAAGATGGATGGATTGGGCATTGAATTAGTGGATGGTAAACTTCTTTTCCATGCAGACAATGGAGCTGGTCGTTTTACAGCATTCTATGAACCAGAGCTTCCAGGTGGTTTATGTGATGGGAAGTGGCACAAAGTGTCAGCAAGCAAACTTAAGCACCGCTTAGAGCTGATAGTCGATGAGAACAAAGTAGAAGCAAGTAGCTCTAATTCTGCATCCACCTCTGCAGATACAAATGATCCAGTTTATGTTGGGGGTTATCCTGAAGGACTGAGTCAGTTTGGCCTGACCACTGATGAGAGATTTAAGGGTTGCATCAGAGATCTCAAACTTACCAAAGGGAAATCAAAACCACAGGAAATTAACTTCAGCAAGGCACTGGAGCTGGAAGGAGTGCAGCCATTAACTTGCCCAGGAATTTAACACAATTTGTTTTGATAATTAACCCAAACATATCACATTATTGTGTACTGGAAAGTGCACAAACTTGCCATGGAAGCATGGCACACCCATGCCAACATCAGCCTCATCATTAATCCTATATTTGAATGTTATTCACTAAATATGTTGAATAAAGAATAATTATATTATC
  3   1   2       bld Brn3      out                        CAAK5404.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGAGCTGGAGTTCCGTACATCAAAAACAAATGGAGTTATTCTTGGAATAAGTGGCAAAAAGATGGATGGATTGGGCATTGAATTAGTGGATGGTAAACTTCTTTTCCATGCAGACAATGGAGCTGGTCGTTTTACAGCATTCTATGAACCAGAGCTTCCAGGTGGTTTATGTGATGGGAAGTGGCACAAAGTGTCAGCAAGCAAACTTAAGCACCGCTTAGAGCTGATAGTCGATGAGAACAAAGTAGAAGCAAGTAGCTCTAATTCTGCATCCACCTCTGCAGATACAAATGATCCAGTTTATGTTGGGGGTTATCCTGAAGGACTGAGTCAGTTTGGCCTGACCACTGATGAGAGATTTAAGGGTTGCATCAGAGATCTCAAACTTACCAAAGGGAAATCAAAACCACAGGAAATTAACTTCAGCAAGGCACTGGAGCTGGAAGGAGTGCAGCCATTAACTTGCCCAGGAATTTAACACAATTTGTTTTGATAATTAACCCAAACATATCACATTATTGTGTACTGGAAAGTGCACAAACTTGCCATGGAAGCATGGCACACCCATGCCAACATCAGCCTCATCATTAATCCTATATTTGAATGTTATTCACTAAATATGTTGAATAAAGAATAATTATATTATC
  5   1   2       bld Hrt1      in                         CAAQ4357.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATCGATTCGGGGAAGTGGCACAAAGTGTCAGCAAGCAAACTTAAGCACCGCTTAGAGCTGATAGTCGATGAGAACAAAGTAGAAGCAAGTAGCTCTAATTCTGCATCCACCTCTGCAGATACAAATGATCCAGTTTATGTTGGGGGTTATCCTGAAGGACTGAGTCAGTTTGGCCTGACCACTGATGAGAGATTTAAGGGTTGCATCAGAGATCTCAAACTTACCAAAGGGAAATCAAAACCACAGGAAATTAACTTCAGCAAGGCACTGGAGCTGGAAGGAGTGCAGCCATTAACTTGCCCAGGAATTTAACACAATTTGTTTTGATAATTAACCCAAACATATCACATTATTGTGTACTGGAAAGTGCACAAACTTGCCATGGAAGCATGGCACACCCATGCCAACATCAGCCTCATCATTAATCCTATATTTGAATGTTATTCACTAAATATGTTGAATAAAGAATAATTATATTATCAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Hrt1      in                         CAAQ4357.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGAAGTGGCACAAAGTGTCAGCAAGCAAACTTAAGCACCGCTTAGAGCTGATAGTCGATGAGAACAAAGTAGAAGCAAGTAGCTCTAATTCTGCATCCACCTCTGCAGATACAAATGATCCAGTTTATGTTGGGGGTTATCCTGAAGGACTGAGTCAGTTTGGCCTGACCACTGATGAGAGATTTAAGGGTTGCATCAGAGATCTCAAACTTACCAAAGGGAAATCAAAACCACAGGAAATTAACTTCAGCAAGGCACTGGAGCTGGAAGGAGTGCAGCCATTAACTTGCCCAGGAATTTAACACAATTTGTTTTGATAATTAACCCAAACATATCACATTATTGTGTACTGGAAAGTGCACAAACTTGCCATGGAAGCATGGCACACCCATGCCAACATCAGCCTCATCATTAATCCTATATTTGAATGTTATTCACTAAATATGTTGAATAAAGAATAATTATATTATC

In case of problems mail me! (