Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   3.0    0Xt7.1-TTpA009b07.5.5                       38 END     1           1        2                pou domain class 3 transcription factor 1 [Xenopus tropicalis]
     2   2.0    0Xt7.1-CAAK6713.5                            3 END     1           1       33                PREDICTED: cdc25 isoform 1 [Danio rerio]

 This cluster: approximate FL confidence score = 0%

 1012076122 Xt7.1-CABD11912.5.5 - 57 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     3     2     4     4     6     5     6     5     6     5     6     5     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9    10    10    10    10    10    10    10    10    10    10    11    11    11    12    12    12    13    13    13    14    13    14    12    13    13    14    12    13    11    12    10    11    10    11    10    11    10    11    10    11    11    11    10    10    10    10    10    10     9    10    10    10    10    11    10    11    10    11    11    11    11    11    10    10    10    10     9    10     9    10     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     6     7     6     7     6     7     6     7     8     8     8     8     8     8     8     8     8     8     7     7     7     7     6     7     6     8     6     8     6     8     6     8     6     7     6     8     7     9     7     9     7     9     7     8     7     8     7     8     6     8     6     8     5     7     6     7     5     7     5     6     5     6     5     6     5     7     5     7     7     9     8     9     8     9     8     8     8     8     8     8     8     8     8     8     8     9     8     9     9    10    10    10    11    11    11    11    12    12    12    12    12    12    12    12    12    12    11    12    10    12    10    12    10    11    11    12    13    14    13    14    13    14    13    14    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    13    14    12    15    12    15    12    15    12    15    12    15    12    14    12    13    13    14    13    14    13    14    13    14    13    14    14    15    14    15    14    15    14    15    14    15    14    16    13    15    18    20    21    22    22    23    22    23    21    22    22    22    22    22    21    21    23    24    23    24    22    24    22    24    22    23    20    22    19    22    18    22    18    22    19    24    19    23    18    23    19    23    18    22    18    22    18    22    18    26    18    26    18    25    19    25    19    25    20    25    20    25    18    25    19    25    20    25    20    25    15    24    15    24    15    24    15    24    14    24    13    24    15    24    15    24    13    23    13    22    14    22    14    22    14    22    14    22    14    22    12    22    14    22    14    22    13    22    14    22    13    22    14    21    14    20    14    20    13    20    12    16    11    14    10    14     9    13
  5   1   2  SIG                                      Xt7.1-CABK2143.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGCTGTCCTGCCTACTCCGTCTCCGTAACCCCTCGCAATTGTTATGACGTTGCTGTTTAGGGATCTTCTCCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGATGTGTCACACTTGCACTTTTATGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAAATATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGAATGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTATCCAATTATTATTGGTGTTATCCCCTTTTATAGAATGTGAGATTGCAATGCTTATAATATACCCGCTCTGTCCCTGTTGTGCACGATGTTAAGTGTATTCATTCAAGGGGAGGAAATATAAATATATAACTCTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTATTATGTGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAACGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTATCCCCTTCTATTGAATGTGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TATTATATACCC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----C-G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------AG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------C-----
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Sc ---- 2e-022     NP_013750.1 Mitotic Inducer Homolog  S. pombe cdc25+ homolog; Mih1p [Saccharomycescerevisiae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 2e-022     NP_491862.1 cell Division Cycle related, abnormal cell LINeage LIN-60 (67.9 kD) (cdc-25.1)[Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 2e-046     XP_781555.2 PREDICTED: similar to Cdc25 [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Dm ---- 1e-047     NP_524547.1 string CG1395-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 2e-076     XP_682719.1 PREDICTED: cdc25 isoform 1 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                    PROTEIN --- ?? ---- 3e-080     NP_001081956.1 tyrosine phosphatase Cdc25A [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                PROTEIN --- Xl ---- 1e-080     BAA11652.1 Cdc25A [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                 PREDICTED - Gg ---- 2e-084     XP_418479.2 PREDICTED: similar to Cell division cycle 25A [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                     PROTEIN --- Mm ---- 3e-085     NP_031684.3 cell division cycle 25 homolog A [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                             PROTEIN --- Hs ---- 3e-086     NP_068658.1 cell division cycle 25B isoform 2 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xt ==== 1e-123     AAI25768.1 Unknown (protein for IMAGE:7760861) [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CABD11912.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------TAG---------ATG------TAG---------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------ATG------TAG---------------------------------------------------TGA------------------------------------ATG---------TAA------------------------------------------------------------------TGA---------------------------------------ATG---------------------------------------------------------------------------TGA---------------------------------------------------------ATG------------------------------------------------------------TAA------------------------------------------ATG------------------------------------------------------------------------------ATG------TAA---------------------------TGA------------TGATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------ATG------------------------------------------TAATGA------------------------------------------ATG---TGA---------------------TAATAG---TGA---------------TGA---TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------ATG------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   0       chi Gas7 5x   ?                          XZG47645.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGCGATTGTCGGGCCCCTGTGCCTCTTATTTCCTTTCCCTGCCCATGATCTGCCTGAAATAGGGACGCCCATGTAGGGGACAGGGCACATAGGAACCCCCCGATCCCATCGCTGTATATTCTTTCCGCTTGTGCCCCCCCACCCCTCCTCTGCATGTGCAATATACTGCCCTCTGCTGCACCCCAAGATCTGCAACAGCCTCTGCACCCCGGAACCTGACATCAGCTTTGCACCCCGGAACCTGACATCAGCACCCTTGCAGCTTAGCACCCTTCCCGTTCTGCAACAAGCTCTGCACTTCTGACTCTGTGACTCTGAAGCCTCTGCACTTCCTGCTCTGCATAAGGATCTACTAAAGCCTCTGCACCCCGGGATATACAAAGGCCTCTGCATTGCTCTGCACTTTTGCCTGCTCTTTGCAGCCCCCCAGTTTGCTGTGTTGCACCCCTAGTTCCTAGCCCAGACCCCCCAACAATGGAGCTAGAGAAGCTGCTGAATGATTTCAGTCCCAGCCGGAGCCAGGTCCCTGTGCCCAGACCCACCCTGCTGCCAGGCTTTGCCATGGTTGGAGCCCGGGGCCTACTGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCANAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGG
  5   1   2       ext Gas8                                   st2i16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGAACGAGGAACCGAAAATGAAGTTGGGAAGGTCCAAGTCTGTGTGCCTCGCTACCGTGGAAAAGATACTGGACAACGATGAGAGAGAGCTCATTGGTGATTCCTCAAAGGCGTATTTACTGAAAACAGTGGAAGGGAAACACCAAGATCTGAAATACATCACTCCTGAAATGATGGACTGTGTGCTGAGTGGGAAGTATAAGGACACGATTGAGCGCTGTGTGATTATCGACTGCAGATACCCCTATGAATACGAGGGTGGGCATATCAAGGGAGCCATAAACCTGCCCCTGGAACAGGACGTAGAAGCCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTT
  5   1   3        nb Neu                            TNeu041a05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACGAGGAACCGAAATGAAGTTGGGAAGGTCCAAGTCTGTGTGCCTCGCTACCGTGGAAAAGATACTGGACAACGATGAGAGAGAGCTCATTGGTGATTCCTCAAAGGCGTNATTTACTGAAAACAGTGGAAGGGAAACACCAAGATCTGAAATACATCACTCCTGAAATGATGGACTGTGTGCTGAGTGGGAAGTATAAGGACACGATTGAGCGCTGTGTGATTATCGACTGCAGATACCCCTATGAATACGAGGGTGGGCATATCAAGGGAGCCATAAACCTGCCCCTGGAACAGGACGTAGAAGCCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCT
  5   1   2       ext Spl1 FLt5                             CABK400.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGTTGGGAGGTCCAGTCTGTGTGCCTCGCTACCGTGGAAAAGATACTGGACAACGATGAGAGAGAGCTCATTGGTGATTCCTCAAAGGCGTATTTACTGAAAACAGTGGAAGGGAAACACCAAGATCTGAAATACATCACTCCTGAAATGATGGACTGTGTGCTGAGTGGGAAGTATAAGGACACGATTGAGCGCTGTGTGATTATCGACTGCAGATACCCCTATGAATACGAGGGTGGGCATATCAAGGGAGCCATAAACCTGCCCCTGGAACAGGACGTAGAAGCCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGNGGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTATGTTCTGGA
  5   1   3        nb HdA                            THdA011i18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCAGTCTGTGTGCCTCGCATACCGTGGATAAGATACTGGACAACGATGAGAGAGAGCTCATTGGTGATTCCTCAAAGGCGTATTTACTGAAAACAGTGGAAGGGAAACACCAAGATCTGAAATACATCACTCCTGAAATGATGGACTGTGTGCTGAGTGGGAAGTATAAGGACACGATTGAGCGCTGTGTGATTATCGACTGCAGATACCCCTATGAATACGAGGGTGGGCATATCAAGGGAGCCATAAACCTGCCCCTGGAACAGGACGTAGAAGCCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCG
  5   1   4      seed Gas7      in                         XZG45147.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCAAGTCTGTGTGCCTCGCTACCGTGGAAAAGATACTGGACAACGATGAGAGAGAGCTCATTGGTGATTCCTCAAAGGCGTATTTACTGAAAACAGTGGAAGGGAAACACCAAGATCTGAAATACATCACTCCTGAAATGATGGACTGTGTGCTGAGTGGGAAGTATAAGGACACGATTGAGCGCTGTGTGATTATCGACTGCAGATACCCCTATGAATACGAGGGTGGGCATATCAAGGGAGCCATAAACCTGCCCCTGGAACAGGACGTAGAAGCCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGGGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTTGCTCGGCCAAGCCGGACAGTACT
  5   1   2       add In63                            IMAGE:8958297.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTAGAGAGCTCATTGGTTGATTCCTCAAAGGCGTATTTACTGAAAACAGTGGAAGGGAAACACCAAGATCTGAAATACATCACTCCTGAAATGATGGACTGTGTGCTGAGTGGGAAGTATAAGGACACGATTGAGCGCTGTGTGATTATCGACTGCAGATACCCCTATGAATACGAGGGTGGGCACATCAAGGGAGCCATAAACCTGCCCCTGGAACAGGACGTAGAAGCCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGAGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGACAGTGCTTTGTTCTGGAGAGAGAAGCTTCTTGTCATGACGAGTATTCGTTCGTCATGGTCTTTTTCACACGCATACTTGGCATCACTGGACATGAACGTAATCAGGTGCGCAATTGCTTCAACTGTGAACTCCACCGTGAAGCGCTTATCTCACTGTGAACTG
  5   1   3        nb Tad5                                 XZT67257.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAAACAGTGGAAGGGAAACACCAAGATCTGAAATACATCACTCCTGAAATGATGGACTGTGTGCTGAGTGGGAAGTATAAGGACACGATTGAGCGCTGTGTGATTATCGACTGCAGATACCCCTATGAATACGAGGGTGGGCATATCAAGGGAGCCATAAACCTGCCCCTGGAACAGGACGTAGAAGCCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGGGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAGAAGCTTCTTGTCATTGGACGAAGTAATCGTTTCGTCATTGGTCTTTTTTCACAACGGCATTACCTTTGCCATCACTGGACATGAACGTAAT
  5   1   3        nb Gas7                                 XZG49736.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGGGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAGAAGCTTCTTGTCATTGGACGAAGTAATCGTTTCGTCATTGGTCTTTTTTCACAACGGCATTACCTTTGCCATCACTGGACATGAACGTAATCAGGTTGGCCGCAGTGCCCTTCAGAGCTGTGAACCTCCACCGTGGAGCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTT
  5   1   3        nb TpA       ?                    TTpA061i21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGGGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAGAAGCTTCTTGTCATTGGACGAAGTAATCGTTTCGTCATTGGTCTTTTTTCACAACGGCATTACCTTTGCCATCACTGGACATGAACGTAATCAGGTTGGCCGCAGTGCCCTTCAGAGCTGTGAACCTCCACCGTGGAGCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTTGGAGGGACCCACTTGAATATTCCCCCTTGGCTGTCCTGCTACTCCGTCTCCGTAACCCCTCGCAGTTGTTATGAGGTTGCTGTTTGGGATTTTCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGTGTGTCGCACTTGCACTTTTATCAGCCTCTCAGGTNGCGTGGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCATCAGCTGGGAGTTCAGTACTG
  5   1   2       ext Gas7      in                         XZG31053.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAGGAGGCTACAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGGGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAGAAGCTTCTTGTCATTGGACGAAGTAATCGTTTCGTCATTGGTCTTTTTTCACAACGGCATTACCTTTGCCATCACTGGACATGAACGTAATCAGGTTGGCCGCAGTGCCCTTCAGAGCTGTGAACCTCCACCGTGGAGCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTTGGAGGGACCCACTTGAATATTCCCCCTTGGCTGTCCTGCTACTCCGTCTCCGTAACCCCTCGCAGTTGTTATGAGGTTGCTGTTTGGGATTTTCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGTGTGTCGCACTTGCACTTTTATCAGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAG
  5   1   3        nb Gas                            TGas042h21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCTGTTTCTGCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGAGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAGAAGCTTCTTGTCATTGGACGAAGTAATCGTTTCGTCATTGGTCTTTTTTCACAACGGCATTACCTTTGCCATCACTGGACATGAACGTAATCAGGTTGGCCGCAGTGCCCTTCAGAGCTGTGAACCTCCACCGTGGAGCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTTGGAGGGACCCACTTGAATATTCCCCCTTGGCTGTCCTGCTACTCCGTCTCCGTAACCCCTCGCAGTTGTTATGAGGCTGCTGTTTGGGATTNTCATCGCCAAATGGCTCTGTGTGTNTCTGTAGTTCTGCGTGTGTCGCACTTGCACTTT
  5   1   2       ext Gas1      in                     NISC_mq09b10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCTAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGAGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAGAAGCTTCTTGTCATTGGACGAAGTAATCGTTTCGTCATTGGTCTTTTTTCACAACGGCATTACCTTTGCCATCACTGGACATGAACGTAATCAGGTTGGCCGCAGTGCCCTTCAGAGCTGTGAACCTCCACCGTGGAGCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTTGGAGGGACCCACTTGAGTATATTCCCCCGTGGGTGTCCTGCTACTCCGTCTCCGTAACCCCTCGCAGTTGTTATGAGGCTGCTGTTT
  5   1   3        nb Gas0                                 dad17e05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGGGGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGAGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAG
  5   1   2       add Neu                            TNeu034g17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGCCGGAGACTCTCCAGGGGGCAGCCCCGCGCTAAGAAGACTCTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAGAAGCTTCTTGTCATTGGACGAAGTAATCGTTTCGTCATTGGTCTTTTTTCACAACGGCATTACCTTTGCCATCACTGGACATGAACGTAATCAGGTTGGCCGCAGTGCCCTTCAGAGCTGTGAACCTCCACCGTGGAGCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTTGGAGGGACCCACTTGAATATTCCCCCTTGGCTGTCCTGCTACTCCGTCTCCGTAACCCCTCGCAGTTGTTATGAGGTTGCTGTTTGGGATTTTCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGTGTGTCGCACTTGCACTTTTATCAGCCTCTCAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTCTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTG
  5   1   2       add In63                            IMAGE:8959358.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACCCGTCGGAGCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTTGGAGGGACCCACTTGAATATTCCCCCTTGGCTGTCCTGCTACTCCGTCTCCGTAACCCCTCGCAGTTGTTATGAGGCTGCTGTTTGGGATTTTCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGTGTGTCGCACTTGCACTTTTATCAGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATGCCCTGAAGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTATACTGCGCTGCCCGCCCCTCTGGAAATGGGACAGCATATAATGTGTGCGCAGATGATGGGTTAGGTGGCATGTCAGGATCATGACTGACTATACATACTAGCTAATCCATGCACAGGGGACACTGCCAGCAGTAGTTGGTCAACCTCTCCACCATGTA
  5   1   2       ext Gas                            TGas060e14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTTGGAGGGACCCACTTGAATATTCCCCCTTGGCTGTCCTGCTACTCCGTCTCCGTAACCCCTCGCAGTTGTTATGAGGCTGCTGTTTGGGATTTTCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGTGTGTCGCACTTGCACTTTTATCAGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATTATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCAAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTACCTGTTGGTTAGACATGTTTGGTC
  5   1   2       add In63                            IMAGE:8959580.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTTTTTTATTTTTTATTTTTTAAAATAAAAAAAAAAAAATTCTCACTTGCCTTTTATCAGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCACCCCAATGTACCCAATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATTCCTCTGATGAGGAGGCAGACTGGTGTGGACTATATAATAAGTTGGCCTGTCCATTGGGGTCCTCGCTAATATTTTGGGCCCTGCCCACCACCCGCTAAAGGATATTATTTTGGCCTGAAACCGTGTTTGGGACACGATGGCCT
  5   1   2       ext Lun1                                 CABD5946.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGA
  5   1   3        nb Gas7                                  XZG1234.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCATCATGTGTTTATGGTAATTTGAGTATTTGTGCAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGC
  5   1   2       ext Gas7      in                         XZG35403.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCA
  5   1   0       chi Gas8      in                          st70o12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACTGCCAAGCAGTGATGTTTGGGCCAACCCTCTTCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAANTGGGTGTCCAATTGGGGTCTCACTAATAT
  5   1   2       add In62                            IMAGE:8952404.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACCTCTGATAAAGATGACTCCCCAATACGAATTCGTCCCCAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTTCATAGAGCAATTCCAGTTCAGAAAATCATATTTTCTTTCAAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACTACTTTATGATGTGAGGACTATATCTATAAGTTGATTGTTATTTAGCGAAGTGAA
  5   1   3        nb Gas       in                   TGas079e09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCAAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTA
  5   1   3        nb Tad5                                 XZT64224.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTTCTAATAAAACACCCCCCCCCGAATAAATATG
  5   1   3        nb Gas7                                  XZG1257.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTT
  5   1   2       ext Gas7      in                         XZG27894.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGGACGCGTGGGCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCCTCTCCCTAGT
  5   1   2       ext Gas7      in                         XZG38319.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCACTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTA
  5   1   3        nb Gas7                                 XZG18284.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCTCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCATTTGGGTATAATAGATATGATTTATCCCTTTCCAATGAT
  5   1   3        nb Lun1                                CABD11912.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACCAGTTTGTAATAAGAAAACAATTATTTAT
  5   1   3        nb Gas7                                 XZG16611.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAA
  5   1   2       ext Gas7      in                         XZG60141.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGTAAAAAAAAAAAAA
  5   1   3        nb Gas       out                  TGas061d19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTAAGGTTCGGCCTGCCCACCACCCGCTAAAGATTTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTGTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCC
  3   1   2       ext Gas7      in                         XZG31053.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTT
  3   1   2       ext Gas7      in                         XZG35403.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTACCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGTAAAAAAAAAAAAAAAAGG
  3   1   2       ext Gas7      in                         XZG38319.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGT
  3   1   2       ext Gas7      in                         XZG60141.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGAAAAAAAAAAAAAAAGG
  3   1   2       ext Gas7      in                         XZG27894.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTGTTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTACCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGTAAAAAAAAAAAAAAAAGG
  3   1   3        nb Gas8      out                         st75j05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCTGAAACTGNTGGACAGTTGGGTCGACCCACACATTANTANTGCCAAGCCACCCAGTACCAAACTGATTTGCTATNGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCNTAGAGCANTTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACNTCATCTGGTTNTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCNTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTANTNAGCGANGATNNGATCCCGTGTGCCCAGTNGGGTATAATAGATATGATTTATCCCTNTCCANTGATGGTAGAATNTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGNCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCANGTTTTCTGCATTNTGTTCANTGGAACAAGTTTGTAATAAGAAAACAAATTANTTATTTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACNTATTANTTGNGTTATCCCCTTACNATNGAATGTGTGATTGCAATGC
  3   1   3        nb Gas7 PIPE out                        XZG49984.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGTAAAAAAAAAAAAAAAGG
  3   1   3        nb Gas8      out                         st90h18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAGCTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCCAGTAAATATGTACTCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAACGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTG
  5   1   3        nb Gas                            TGas012f17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATG
  3   1   3        nb Gas       in                    TGas079e09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCCTAATTAAACAACCCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATTAAAAAAAAAAAAAAAAAA
  3   1   2       add Gas8      in                          st70o12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCACAAGCAACCNGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTNTGCTGACTTCTTAATAAACAACCCCCCCCCAGTAAATATGTACTCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAACGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATGCGNGTTNTCCCCTTCTANANNATGTGTGATTG
  3   1   4      seed Gas7      in                         XZG45147.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAGCAACCAGCCCGGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTTTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTTTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATTTATACCCAGGCCTTACTTTAATGATGTGAGGAGTCTATTTTTTTTTTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTGGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTTTGCATTTTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTTTTTTTTTGGTTTTGCCCAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTCCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCCCTTTTTTTTTGTGTTATCCCCTTTTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTAT
  3   1   3        nb Gas8                                  st31l21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACTTCTTAATAAACAACCCCCCCCCAGTAAATATGTACTCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGNGAGGAGTCTATTATTCTANTATGTGAGNGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAANGATGGTAGAATCTGAAANCGTTATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTNTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAACGGTGNCTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACCTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCCTGTTCTGCAGCAATGT
  3   1   2       ext Gas1      in                     NISC_mq09b10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCTTAATAAACAACCCCCCCCCAGTAAATATGTACTCCCCTCTCCCTAGTTTAATCTATACCCAGCCCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGGGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTTTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAACGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTTTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATTTTAACCTTTTTATGTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG
  5   1   3        nb Gas                            TGas129p15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGGGGGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAACGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGTAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas                            TGas027a10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                NAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAACGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAACGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCA
  5   1   3        nb TpA                            TTpA078b12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGAGTCTATTATTCNTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCA
  5   1   3        nb Gas                               TGas006k15.sp6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCGGGCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAACGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGTaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  5   1   2       ext Tad5                                  XZT8782.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCTTTCCATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTACCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGTaanaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  5   1   2  SIG                                      Xt7.1-CABK2143.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGCTGTCCTGCCTACTCCGTCTCCGTAACCCCTCGCAATTGTTATGACGTTGCTGTTTAGGGATCTTCTCCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGATGTGTCACACTTGCACTTTTATGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAAATATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGAATGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTATCCAATTATTATTGGTGTTATCCCCTTTTATAGAATGTGAGATTGCAATGCTTATAATATACCCGCTCTGTCCCTGTTGTGCACGATGTTAAGTGTATTCATTCAAGGGGAGGAAATATAAATATATAACTCTT
                                                  Xt7.1-CHK-1008287008                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCTGCCTACTCCGTCTCCGTAACCCCTCGCAATTGTTATGACGTTGCTGTTTAGGGATCTTCTCCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGATGTGTCACACTTGCACTTxTxxGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAAATATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGAATGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTATCCAATTATTATTGGTGTTATCCCCTTTTATAGAATGTGAGATTGCAATGCTTATAATATACCCGCTCTGTCCCTGTTGTGCACGATGTTAAGTGTATTCATTCAAGGGGAGGAAATATAAATATATAACTCTTTTTATG
  5   1   2       ext TbA       in                   TTbA063a07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGCTGTCCTGCCTACTCCGTCTCCGTAACCCCTCGCAATTGTTATGACGTTGCTGTTTAGGGATCTTCTCCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGATGTGTCACACTTGCACTTTTATCAACCTCCCTGTGCGTGGGGGGCTGCACAGCATTGCTCCTCCCCCCGCCTCT
  5   1   4      seed Spl1      in                         CABK2143.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTTCATCGCCAATGGCTCTGTGTGTTTCTGTAGTTCTGCGTGTGTCGCACTTGCACTTTTATCAGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCT
  3   1   4      seed Spl1      in                         CABK2143.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGC
  3   1   2       ext TbA       in                    TTbA063a07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAATAAATAAGTACCCCCCTCTCCCTAGTTTAATGTATACCCAGACCTTACTTTAATGATGTGAGGAGTTTATTATTCTATTACGTGAGTGTTATTAAGCGAGGATATGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATGTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAAAGGCCACTTTTCTTAAATACGCCAAGTTTTAGGCAATCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAAATATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGAATGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTATCCAATTATTATTGGTGTTATCCCCTTTTATAGAATGTGAGATTGCAATGCTTATAATATACCCGCTCTGTCCCTGTTGTGCACGATGTTAAGTGTATTCATTCAAGGGGAGGAAATATAAATATATAACTCTTTTTATGTAAAAAAAAAAAAAAAAAAAGCG

In case of problems mail me! (