Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   3.0    0Xt7.1-TTpA009b07.5.5                       38 END     1           1        2                pou domain class 3 transcription factor 1 [Xenopus tropicalis]
     2   2.0    0Xt7.1-CAAK6713.5                            3 END     1           1       33                PREDICTED: cdc25 isoform 1 [Danio rerio]

 This cluster: approximate FL confidence score = 0%

 1012076122 Xt7.1-CABD11912.5.5 - 57 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CABD11912.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAACGAGGAACCGAAAATGAAGTTGGGAAGGTCCAAGTCTGTGTGCCTCGCTACCGTGGAAAAGATACTGGACAACGATGAGAGAGAGCTCATTGGTGATTCCTCAAAGGCGTATTTACTGAAAACAGTGGAAGGGAAACACCAAGATCTGAAATACATCACTCCTGAAATGATGGACTGTGTGCTGAGTGGGAAGTATAAGGACACGATTGAGCGCTGTGTGATTATCGACTGCAGATACCCCTATGAATACGAGGGTGGGCATATCAAGGGAGCCATAAACCTGCCCCTGGAACAGGACGTAGAAGCCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGGGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAGAAGCTTCTTGTCATTGGACGAAGTAATCGTTTCGTCATTGGTCTTTTTTCACAACGGCATTACCTTTGCCATCACTGGACATGAACGTAATCAGGTTGGCCGCAGTGCCCTTCAGAGCTGTGAACCTCCACCGTGGAGCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTTGGAGGGACCCACTTGAATATTCCCCCTTGGCTGTCCTGCTACTCCGTCTCCGTAACCCCTCGCAGTTGTTATGAGGTTGCTGTTTGGGATTTTCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGTGTGTCGCACTTGCACTTTTATCAGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTA
                                                  Xt7.1-CHK-1008225151                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAACCGAAAATGAAGTTGGGAAGGTCCAAGTCTGTGTGCCTCGCTACCGTGGAAAAGATACTGGACAACGATGAGAGAGAGCTCATTGGTGATTCCTCAAAGGCGTATTTACTGAAAACAGTGGAAGGGAAACACCAAGATCTGAAATACATCACTCCTGAAATGATGGACTGTGTGCTGAGTGGGAAGTATAAGGACACGATTGAGCGCTGTGTGATTATCGACTGCAGATACCCCTATGAATACGAGGGTGGGCATATCAAGGGAGCCATAAACCTGCCCCTGGAACAGGACGTAGAAGCCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGGGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAGAAGCTTCTTGTCATTGGACGAAGTAATCGTTTCGTCATTGGTCTTTTTTCACAACGGCATTACCTTTGCCATCACTGGACATGAACGTAATCAGGTTGGCCGCAGTGCCCTTCAGAGCTGTGAACCTCCACCGTGGAGCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTTGGAGGGACCCACTTGAATATTCCCCCTTGGCTGTCCTGCTACTCCGTCTCCGTAACCCCTCGCAGTTGTTATGAGGTTGCTGTTTGGGATTTTCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGTGTGTCGCACTTGCACTTTTATCAGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCxxxxTxTTTATG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     3     2     4     4     6     5     6     5     6     5     6     5     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9    10    10    10    10    10    10    10    10    10    10    11    11    11    12    12    12    13    13    13    14    13    14    12    13    13    14    12    13    11    12    10    11    10    11    10    11    10    11    10    11    11    11    10    10    10    10    10    10     9    10    10    10    10    11    10    11    10    11    11    11    11    11    10    10    10    10     9    10     9    10     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     6     7     6     7     6     7     6     7     8     8     8     8     8     8     8     8     8     8     7     7     7     7     6     7     6     8     6     8     6     8     6     8     6     7     6     8     7     9     7     9     7     9     7     8     7     8     7     8     6     8     6     8     5     7     6     7     5     7     5     6     5     6     5     6     5     7     5     7     7     9     8     9     8     9     8     8     8     8     8     8     8     8     8     8     8     9     8     9     9    10    10    10    11    11    11    11    12    12    12    12    12    12    12    12    12    12    11    12    10    12    10    12    10    11    11    12    13    14    13    14    13    14    13    14    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    13    14    12    15    12    15    12    15    12    15    12    15    12    14    12    13    13    14    13    14    13    14    13    14    13    14    14    15    14    15    14    15    14    15    14    15    14    16    13    15    18    20    21    22    22    23    22    23    21    22    22    22    22    22    21    21    23    24    23    24    22    24    22    24    22    23    20    22    19    22    18    22    18    22    19    24    19    23    18    23    19    23    18    22    18    22    18    22    18    26    18    26    18    25    19    25    19    25    20    25    20    25    18    25    19    25    20    25    20    25    15    24    15    24    15    24    15    24    14    24    13    24    15    24    15    24    13    23    13    22    14    22    14    22    14    22    14    22    14    22    12    22    14    22    14    22    13    22    14    22    13    22    14    21    14    20    14    20    13    20    12    16    11    14    10    14     9    13
  5   1   2  SIG                                     Xt7.1-CABD11912.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGAACGAGGAACCGAAAATGAAGTTGGGAAGGTCCAAGTCTGTGTGCCTCGCTACCGTGGAAAAGATACTGGACAACGATGAGAGAGAGCTCATTGGTGATTCCTCAAAGGCGTATTTACTGAAAACAGTGGAAGGGAAACACCAAGATCTGAAATACATCACTCCTGAAATGATGGACTGTGTGCTGAGTGGGAAGTATAAGGACACGATTGAGCGCTGTGTGATTATCGACTGCAGATACCCCTATGAATACGAGGGTGGGCATATCAAGGGAGCCATAAACCTGCCCCTGGAACAGGACGTAGAAGCCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGGGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAGAAGCTTCTTGTCATTGGACGAAGTAATCGTTTCGTCATTGGTCTTTTTTCACAACGGCATTACCTTTGCCATCACTGGACATGAACGTAATCAGGTTGGCCGCAGTGCCCTTCAGAGCTGTGAACCTCCACCGTGGAGCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTTGGAGGGACCCACTTGAATATTCCCCCTTGGCTGTCCTGCTACTCCGTCTCCGTAACCCCTCGCAGTTGTTATGAGGTTGCTGTTTGGGATTTTCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGTGTGTCGCACTTGCACTTTTATCAGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTT
  5   1   2  SIG                                      Xt7.1-CABK2143.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGCTGTCCTGCCTACTCCGTCTCCGTAACCCCTCGCAATTGTTATGACGTTGCTGTTTAGGGATCTTCTCCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGATGTGTCACACTTGCACTTTTATGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAAATATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGAATGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTATCCAATTATTATTGGTGTTATCCCCTTTTATAGAATGTGAGATTGCAATGCTTATAATATACCCGCTCTGTCCCTGTTGTGCACGATGTTAAGTGTATTCATTCAAGGGGAGGAAATATAAATATATAACTCTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTATTATGTGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAACGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTATCCCCTTCTATTGAATGTGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TATTATATACCC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----C-G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------AG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------C-----
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Sc ---- 2e-022     NP_013750.1 Mitotic Inducer Homolog  S. pombe cdc25+ homolog; Mih1p [Saccharomycescerevisiae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 2e-022     NP_491862.1 cell Division Cycle related, abnormal cell LINeage LIN-60 (67.9 kD) (cdc-25.1)[Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 2e-046     XP_781555.2 PREDICTED: similar to Cdc25 [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Dm ---- 1e-047     NP_524547.1 string CG1395-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 2e-076     XP_682719.1 PREDICTED: cdc25 isoform 1 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                    PROTEIN --- ?? ---- 3e-080     NP_001081956.1 tyrosine phosphatase Cdc25A [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                PROTEIN --- Xl ---- 1e-080     BAA11652.1 Cdc25A [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                 PREDICTED - Gg ---- 2e-084     XP_418479.2 PREDICTED: similar to Cell division cycle 25A [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                     PROTEIN --- Mm ---- 3e-085     NP_031684.3 cell division cycle 25 homolog A [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                             PROTEIN --- Hs ---- 3e-086     NP_068658.1 cell division cycle 25B isoform 2 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xt ==== 1e-123     AAI25768.1 Unknown (protein for IMAGE:7760861) [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CABD11912.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------TAG---------ATG------TAG---------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------ATG------TAG---------------------------------------------------TGA------------------------------------ATG---------TAA------------------------------------------------------------------TGA---------------------------------------ATG---------------------------------------------------------------------------TGA---------------------------------------------------------ATG------------------------------------------------------------TAA------------------------------------------ATG------------------------------------------------------------------------------ATG------TAA---------------------------TGA------------TGATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------ATG------------------------------------------TAATGA------------------------------------------ATG---TGA---------------------TAATAG---TGA---------------TGA---TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------ATG------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   2  SIG                                     Xt7.1-CABD11912.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGAACGAGGAACCGAAAATGAAGTTGGGAAGGTCCAAGTCTGTGTGCCTCGCTACCGTGGAAAAGATACTGGACAACGATGAGAGAGAGCTCATTGGTGATTCCTCAAAGGCGTATTTACTGAAAACAGTGGAAGGGAAACACCAAGATCTGAAATACATCACTCCTGAAATGATGGACTGTGTGCTGAGTGGGAAGTATAAGGACACGATTGAGCGCTGTGTGATTATCGACTGCAGATACCCCTATGAATACGAGGGTGGGCATATCAAGGGAGCCATAAACCTGCCCCTGGAACAGGACGTAGAAGCCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGGGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAGAAGCTTCTTGTCATTGGACGAAGTAATCGTTTCGTCATTGGTCTTTTTTCACAACGGCATTACCTTTGCCATCACTGGACATGAACGTAATCAGGTTGGCCGCAGTGCCCTTCAGAGCTGTGAACCTCCACCGTGGAGCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTTGGAGGGACCCACTTGAATATTCCCCCTTGGCTGTCCTGCTACTCCGTCTCCGTAACCCCTCGCAGTTGTTATGAGGTTGCTGTTTGGGATTTTCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGTGTGTCGCACTTGCACTTTTATCAGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTT
                                                  Xt7.1-CHK-1008287010                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGGAACCGAAAATGAAGTTGGGAAGGTCCAAGTCTGTGTGCCTCGCTACCGTGGAAAAGATACTGGACAACGATGAGAGAGAGCTCATTGGTGATTCCTCAAAGGCGTATTTACTGAAAACAGTGGAAGGGAAACACCAAGATCTGAAATACATCACTCCTGAAATGATGGACTGTGTGCTGAGTGGGAAGTATAAGGACACGATTGAGCGCTGTGTGATTATCGACTGCAGATACCCCTATGAATACGAGGGTGGGCATATCAAGGGAGCCATAAACCTGCCCCTGGAACAGGACGTAGAAGCCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGGGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAGAAGCTTCTTGTCATTGGACGAAGTAATCGTTTCGTCATTGGTCTTTTTTCACAACGGCATTACCTTTGCCATCACTGGACATGAACGTAATCAGGTTGGCCGCAGTGCCCTTCAGAGCTGTGAACCTCCACCGTGGAGCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTTGGAGGGACCCACTTGAATATTCCCCCTTGGCTGTCCTGCTACTCCGTCTCCGTAACCCCTCGCAGTTGTTATGAGGTTGCTGTTTGGGATTTTCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGTGTGTCGCACTTGCACTTTTATCAGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGTA
  0   1   1           Spl1 FLt5                         CABK400.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTGGGAAGGTCCAAGTCTGTGTGCCTCGCTACCGTGGAAAAGATACTGGACAACGATGAGAGAGAGCTCATTGGTGATTCCTCAAAGGCGTATTTACTGAAAACAGTGGAAGGGAAACACCAAGATCTGAAATACATCACTCCTGAAATGATGGACTGTGTGCTGAGTGGGAAGTATAAGGACACGATTGAGCGCTGTGTGATTATCGACTGCAGATACCCCTATGAATACGAGGGTGGGCATATCAAGGGAGCCATAAACCTGCCCCTGGAACAGGACGTAGAAGCCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGGGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAGAAGCTTCTTGTCATTGGACGAAGTAATCGTTTCGTCATTGGTCTTTTTTCACAACGGCATTACCTTTGCCATCACTGGACATGAACGTAATCAGGTTGGCCGCAGTGCCCTTCAGAGCTGTGAACCTCCACCGTGGAGCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTTGGAGGGACCCACTTGAATATTCCCCCTTGGCTGTCCTGCTACTCCGTCTCCGTAACCCCTCGCAGTTGTTATGAGGTTGCTGTTTGGGATTTTCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGTGTGTCGCACTTGCACTTTTATCAGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext HdA                           THdA030g10.p1kaSP6                                                                                                                                                                                                                                                                GTCTCTGCTTGGATTCCCCCAGCCCCCAGGACTCGGAGCTCCCCCACGAAACGTTTGAAAAGGTTATTTTTGAATCAAGAATCCCCCCCAACGATATCAAGCTGCCAATCAGAAGAATCCACTCCTTGCCGGAGACTCTCCAGGGGGGCAGCCCCGCGCTAAGAAGACTCTCCCACCCTTTGGACTTGGATCTGCCCAAACCCCTCGAGAAGATCCCAGCGGAGAAAGACAATAAGGAGAATGAATTACTTCTCTTTAAGAAGCCGCGCCCATTCCTCCGCACCAGGCTACGCACCTTCGATGGCTGCAGCGACAGAGAGGCTTTTTCCAAAAGGCCAAACTCCGCCCCCACTCTCATGTTTTTCAGCCCTGACAAGATCAACTCTGAAATGGAAAACGAGAGTCCCATCCGTTTACGCAAATCCTCCCTGACCTTCTCTCTGTGCAATGACGATGACGACGATGACGGATTCATGGAAATTATGGATGATGAAGAGATAAAGACTGATATTCCCTCTGGAATGCGGAATCTGCTGACTGCCCCATTCGTCAACAAAGAAGACAAGAGTGACCCGGATCTGATTATTAAAAGCAAATGCCGCCGGCTGTTCCGATCACCCTCCATGCCTAGTAGCATCATCAGGCCCATACTCAAACGATTGGACAGACCAGAGGATGGTGAGACCCCTGTGAAGTCAAAGAGGTTGAAGAACTTGCCGCAGTCACATTCGGAAGAATGGCCAGAGAACGAGGAACCGAANATGAAGTTGGGAAGGTCCAAGTCTGTGTGCCTCGCTACCGTGGAAAAGATACTGGACAACGATGAGAGAGAGCTCATTGGTGATTCCTCAAAGGCGTATTTACT
  5   1   0       chi Gas7 5x   ?                          XZG47645.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGCGATTGTCGGGCCCCTGTGCCTCTTATTTCCTTTCCCTGCCCATGATCTGCCTGAAATAGGGACGCCCATGTAGGGGACAGGGCACATAGGAACCCCCCGATCCCATCGCTGTATATTCTTTCCGCTTGTGCCCCCCCACCCCTCCTCTGCATGTGCAATATACTGCCCTCTGCTGCACCCCAAGATCTGCAACAGCCTCTGCACCCCGGAACCTGACATCAGCTTTGCACCCCGGAACCTGACATCAGCACCCTTGCAGCTTAGCACCCTTCCCGTTCTGCAACAAGCTCTGCACTTCTGACTCTGTGACTCTGAAGCCTCTGCACTTCCTGCTCTGCATAAGGATCTACTAAAGCCTCTGCACCCCGGGATATACAAAGGCCTCTGCATTGCTCTGCACTTTTGCCTGCTCTTTGCAGCCCCCCAGTTTGCTGTGTTGCACCCCTAGTTCCTAGCCCAGACCCCCCAACAATGGAGCTAGAGAAGCTGCTGAATGATTTCAGTCCCAGCCGGAGCCAGGTCCCTGTGCCCAGACCCACCCTGCTGCCAGGCTTTGCCATGGTTGGAGCCCGGGGCCTACTGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCANAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGG
  5   1   2       ext Gas8                                   st2i16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGAACGAGGAACCGAAAATGAAGTTGGGAAGGTCCAAGTCTGTGTGCCTCGCTACCGTGGAAAAGATACTGGACAACGATGAGAGAGAGCTCATTGGTGATTCCTCAAAGGCGTATTTACTGAAAACAGTGGAAGGGAAACACCAAGATCTGAAATACATCACTCCTGAAATGATGGACTGTGTGCTGAGTGGGAAGTATAAGGACACGATTGAGCGCTGTGTGATTATCGACTGCAGATACCCCTATGAATACGAGGGTGGGCATATCAAGGGAGCCATAAACCTGCCCCTGGAACAGGACGTAGAAGCCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTT
  5   1   3        nb Neu                            TNeu041a05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACGAGGAACCGAAATGAAGTTGGGAAGGTCCAAGTCTGTGTGCCTCGCTACCGTGGAAAAGATACTGGACAACGATGAGAGAGAGCTCATTGGTGATTCCTCAAAGGCGTNATTTACTGAAAACAGTGGAAGGGAAACACCAAGATCTGAAATACATCACTCCTGAAATGATGGACTGTGTGCTGAGTGGGAAGTATAAGGACACGATTGAGCGCTGTGTGATTATCGACTGCAGATACCCCTATGAATACGAGGGTGGGCATATCAAGGGAGCCATAAACCTGCCCCTGGAACAGGACGTAGAAGCCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCT
  5   1   2       ext Spl1 FLt5                             CABK400.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGTTGGGAGGTCCAGTCTGTGTGCCTCGCTACCGTGGAAAAGATACTGGACAACGATGAGAGAGAGCTCATTGGTGATTCCTCAAAGGCGTATTTACTGAAAACAGTGGAAGGGAAACACCAAGATCTGAAATACATCACTCCTGAAATGATGGACTGTGTGCTGAGTGGGAAGTATAAGGACACGATTGAGCGCTGTGTGATTATCGACTGCAGATACCCCTATGAATACGAGGGTGGGCATATCAAGGGAGCCATAAACCTGCCCCTGGAACAGGACGTAGAAGCCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGNGGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTATGTTCTGGA
  5   1   3        nb HdA                            THdA011i18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCAGTCTGTGTGCCTCGCATACCGTGGATAAGATACTGGACAACGATGAGAGAGAGCTCATTGGTGATTCCTCAAAGGCGTATTTACTGAAAACAGTGGAAGGGAAACACCAAGATCTGAAATACATCACTCCTGAAATGATGGACTGTGTGCTGAGTGGGAAGTATAAGGACACGATTGAGCGCTGTGTGATTATCGACTGCAGATACCCCTATGAATACGAGGGTGGGCATATCAAGGGAGCCATAAACCTGCCCCTGGAACAGGACGTAGAAGCCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCG
  5   1   4      seed Gas7      in                         XZG45147.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCAAGTCTGTGTGCCTCGCTACCGTGGAAAAGATACTGGACAACGATGAGAGAGAGCTCATTGGTGATTCCTCAAAGGCGTATTTACTGAAAACAGTGGAAGGGAAACACCAAGATCTGAAATACATCACTCCTGAAATGATGGACTGTGTGCTGAGTGGGAAGTATAAGGACACGATTGAGCGCTGTGTGATTATCGACTGCAGATACCCCTATGAATACGAGGGTGGGCATATCAAGGGAGCCATAAACCTGCCCCTGGAACAGGACGTAGAAGCCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGGGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTTGCTCGGCCAAGCCGGACAGTACT
  5   1   2       add In63                            IMAGE:8958297.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTAGAGAGCTCATTGGTTGATTCCTCAAAGGCGTATTTACTGAAAACAGTGGAAGGGAAACACCAAGATCTGAAATACATCACTCCTGAAATGATGGACTGTGTGCTGAGTGGGAAGTATAAGGACACGATTGAGCGCTGTGTGATTATCGACTGCAGATACCCCTATGAATACGAGGGTGGGCACATCAAGGGAGCCATAAACCTGCCCCTGGAACAGGACGTAGAAGCCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGAGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGACAGTGCTTTGTTCTGGAGAGAGAAGCTTCTTGTCATGACGAGTATTCGTTCGTCATGGTCTTTTTCACACGCATACTTGGCATCACTGGACATGAACGTAATCAGGTGCGCAATTGCTTCAACTGTGAACTCCACCGTGAAGCGCTTATCTCACTGTGAACTG
  5   1   3        nb Tad5                                 XZT67257.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAAACAGTGGAAGGGAAACACCAAGATCTGAAATACATCACTCCTGAAATGATGGACTGTGTGCTGAGTGGGAAGTATAAGGACACGATTGAGCGCTGTGTGATTATCGACTGCAGATACCCCTATGAATACGAGGGTGGGCATATCAAGGGAGCCATAAACCTGCCCCTGGAACAGGACGTAGAAGCCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGGGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAGAAGCTTCTTGTCATTGGACGAAGTAATCGTTTCGTCATTGGTCTTTTTTCACAACGGCATTACCTTTGCCATCACTGGACATGAACGTAAT
  5   1   3        nb Gas7                                 XZG49736.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTATTTGCTGAAGGAGCCCATAGTACCGCAGAGCCCAGACAAGCGAGTGATCATTATCTTCCACTGCGAGTTCTCCTCAGAGAGGGGCCCCAGGATGTGCCGGTTCATTAGAAAGCAAGACCGCAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGGGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAGAAGCTTCTTGTCATTGGACGAAGTAATCGTTTCGTCATTGGTCTTTTTTCACAACGGCATTACCTTTGCCATCACTGGACATGAACGTAATCAGGTTGGCCGCAGTGCCCTTCAGAGCTGTGAACCTCCACCGTGGAGCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTT
  5   1   3        nb TpA       ?                    TTpA061i21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATAGTAACGAGTACCCCAAGCTACACTATCCTGAACTTTATGTCCTTAAAGGAGGCTACAAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGGGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAGAAGCTTCTTGTCATTGGACGAAGTAATCGTTTCGTCATTGGTCTTTTTTCACAACGGCATTACCTTTGCCATCACTGGACATGAACGTAATCAGGTTGGCCGCAGTGCCCTTCAGAGCTGTGAACCTCCACCGTGGAGCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTTGGAGGGACCCACTTGAATATTCCCCCTTGGCTGTCCTGCTACTCCGTCTCCGTAACCCCTCGCAGTTGTTATGAGGTTGCTGTTTGGGATTTTCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGTGTGTCGCACTTGCACTTTTATCAGCCTCTCAGGTNGCGTGGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCATCAGCTGGGAGTTCAGTACTG
  5   1   2       ext Gas7      in                         XZG31053.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAGGAGGCTACAGGATTTCTTTCCCAGCTTTCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGGGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAGAAGCTTCTTGTCATTGGACGAAGTAATCGTTTCGTCATTGGTCTTTTTTCACAACGGCATTACCTTTGCCATCACTGGACATGAACGTAATCAGGTTGGCCGCAGTGCCCTTCAGAGCTGTGAACCTCCACCGTGGAGCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTTGGAGGGACCCACTTGAATATTCCCCCTTGGCTGTCCTGCTACTCCGTCTCCGTAACCCCTCGCAGTTGTTATGAGGTTGCTGTTTGGGATTTTCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGTGTGTCGCACTTGCACTTTTATCAGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAG
  5   1   3        nb Gas                            TGas042h21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCTGTTTCTGCAGTCCCAATGTGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGAGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAGAAGCTTCTTGTCATTGGACGAAGTAATCGTTTCGTCATTGGTCTTTTTTCACAACGGCATTACCTTTGCCATCACTGGACATGAACGTAATCAGGTTGGCCGCAGTGCCCTTCAGAGCTGTGAACCTCCACCGTGGAGCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTTGGAGGGACCCACTTGAATATTCCCCCTTGGCTGTCCTGCTACTCCGTCTCCGTAACCCCTCGCAGTTGTTATGAGGCTGCTGTTTGGGATTNTCATCGCCAAATGGCTCTGTGTGTNTCTGTAGTTCTGCGTGTGTCGCACTTGCACTTT
  5   1   2       ext Gas1      in                     NISC_mq09b10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGAGCCGCAGTCCTACAGGCCGATGCACCACGAGGACTTCTAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGCAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGAGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAGAAGCTTCTTGTCATTGGACGAAGTAATCGTTTCGTCATTGGTCTTTTTTCACAACGGCATTACCTTTGCCATCACTGGACATGAACGTAATCAGGTTGGCCGCAGTGCCCTTCAGAGCTGTGAACCTCCACCGTGGAGCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTTGGAGGGACCCACTTGAGTATATTCCCCCGTGGGTGTCCTGCTACTCCGTCTCCGTAACCCCTCGCAGTTGTTATGAGGCTGCTGTTT
  5   1   3        nb Gas0                                 dad17e05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGGGGGCCGATGCACCACGAGGACTTCAAAGAACACCTGAAGCTGTTCCGTTCTAAGAGCCGGACGTGGGCCGGAGACAAGAGCAAGCGAGAGATGTACAGTCGGCTGAAGAACCAGTAGAGGACAAAGATGGAGGATAGAGCGCTCGTTGTCTTAAACTGGGGCCAGGGCTGGTCCCTTGGAGGTGCTGCACAGTTGGATCCACGTGGGCACTGAATGGAGGTGTTCCATGCATGGAACTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAG
  5   1   2       add Neu                            TNeu034g17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGCCGGAGACTCTCCAGGGGGCAGCCCCGCGCTAAGAAGACTCTCCCGGATTTGGCTCGGCCAAGCCGGACAGTACTGGAGAGGTGGGCTTGGGTGGACAGTGGCTTTGTTCTGGAAGAGAGAAGCTTCTTGTCATTGGACGAAGTAATCGTTTCGTCATTGGTCTTTTTTCACAACGGCATTACCTTTGCCATCACTGGACATGAACGTAATCAGGTTGGCCGCAGTGCCCTTCAGAGCTGTGAACCTCCACCGTGGAGCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTTGGAGGGACCCACTTGAATATTCCCCCTTGGCTGTCCTGCTACTCCGTCTCCGTAACCCCTCGCAGTTGTTATGAGGTTGCTGTTTGGGATTTTCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGTGTGTCGCACTTGCACTTTTATCAGCCTCTCAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTCTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTG
  5   1   2       add In63                            IMAGE:8959358.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACCCGTCGGAGCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTTGGAGGGACCCACTTGAATATTCCCCCTTGGCTGTCCTGCTACTCCGTCTCCGTAACCCCTCGCAGTTGTTATGAGGCTGCTGTTTGGGATTTTCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGTGTGTCGCACTTGCACTTTTATCAGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATGCCCTGAAGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTATACTGCGCTGCCCGCCCCTCTGGAAATGGGACAGCATATAATGTGTGCGCAGATGATGGGTTAGGTGGCATGTCAGGATCATGACTGACTATACATACTAGCTAATCCATGCACAGGGGACACTGCCAGCAGTAGTTGGTCAACCTCTCCACCATGTA
  5   1   2       ext Gas                            TGas060e14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCGCTAATCACTGTGACTGCGTCTGTGCCTCTGTTATAAGCCCCCGGCAGGCTGGTTTCTGTTGGAGGGACCCACTTGAATATTCCCCCTTGGCTGTCCTGCTACTCCGTCTCCGTAACCCCTCGCAGTTGTTATGAGGCTGCTGTTTGGGATTTTCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGTGTGTCGCACTTGCACTTTTATCAGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATTATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCAAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTACCTGTTGGTTAGACATGTTTGGTC
  5   1   2       add In63                            IMAGE:8959580.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTTTTTTATTTTTTATTTTTTAAAATAAAAAAAAAAAAATTCTCACTTGCCTTTTATCAGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCACCCCAATGTACCCAATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATTCCTCTGATGAGGAGGCAGACTGGTGTGGACTATATAATAAGTTGGCCTGTCCATTGGGGTCCTCGCTAATATTTTGGGCCCTGCCCACCACCCGCTAAAGGATATTATTTTGGCCTGAAACCGTGTTTGGGACACGATGGCCT
  5   1   2       ext Lun1                                 CABD5946.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGA
  5   1   3        nb Gas7                                  XZG1234.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCATCATGTGTTTATGGTAATTTGAGTATTTGTGCAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGC
  5   1   2       ext Gas7      in                         XZG35403.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCA
  5   1   0       chi Gas8      in                          st70o12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACTGCCAAGCAGTGATGTTTGGGCCAACCCTCTTCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAANTGGGTGTCCAATTGGGGTCTCACTAATAT
  5   1   2       add In62                            IMAGE:8952404.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACCTCTGATAAAGATGACTCCCCAATACGAATTCGTCCCCAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTTCATAGAGCAATTCCAGTTCAGAAAATCATATTTTCTTTCAAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACTACTTTATGATGTGAGGACTATATCTATAAGTTGATTGTTATTTAGCGAAGTGAA
  5   1   3        nb Gas       in                   TGas079e09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCAAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTA
  5   1   3        nb Tad5                                 XZT64224.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTTCTAATAAAACACCCCCCCCCGAATAAATATG
  5   1   3        nb Gas7                                  XZG1257.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTT
  5   1   2       ext Gas7      in                         XZG27894.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGGACGCGTGGGCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCCTCTCCCTAGT
  5   1   2       ext Gas7      in                         XZG38319.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCACTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTA
  5   1   3        nb Gas7                                 XZG18284.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCTCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCATTTGGGTATAATAGATATGATTTATCCCTTTCCAATGAT
  5   1   3        nb Lun1                                CABD11912.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACCAGTTTGTAATAAGAAAACAATTATTTAT
  5   1   3        nb Gas7                                 XZG16611.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAA
  5   1   2       ext Gas7      in                         XZG60141.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGTAAAAAAAAAAAAA
  5   1   3        nb Gas       out                  TGas061d19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTAAGGTTCGGCCTGCCCACCACCCGCTAAAGATTTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTGTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCC
  3   1   2       ext Gas7      in                         XZG31053.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTT
  3   1   2       ext Gas7      in                         XZG35403.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTACCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGTAAAAAAAAAAAAAAAAGG
  3   1   2       ext Gas7      in                         XZG38319.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGT
  3   1   2       ext Gas7      in                         XZG60141.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGAAAAAAAAAAAAAAAGG
  3   1   2       ext Gas7      in                         XZG27894.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTGTTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTACCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGTAAAAAAAAAAAAAAAAGG
  3   1   3        nb Gas8      out                         st75j05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCTGAAACTGNTGGACAGTTGGGTCGACCCACACATTANTANTGCCAAGCCACCCAGTACCAAACTGATTTGCTATNGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCNTAGAGCANTTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACNTCATCTGGTTNTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCNTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTANTNAGCGANGATNNGATCCCGTGTGCCCAGTNGGGTATAATAGATATGATTTATCCCTNTCCANTGATGGTAGAATNTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGNCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCANGTTTTCTGCATTNTGTTCANTGGAACAAGTTTGTAATAAGAAAACAAATTANTTATTTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACNTATTANTTGNGTTATCCCCTTACNATNGAATGTGTGATTGCAATGC
  3   1   3        nb Gas7 PIPE out                        XZG49984.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGTAAAAAAAAAAAAAAAGG
  3   1   3        nb Gas8      out                         st90h18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAGCTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCCAGTAAATATGTACTCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAACGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTG
  5   1   3        nb Gas                            TGas012f17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATG
  3   1   3        nb Gas       in                    TGas079e09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCCTAATTAAACAACCCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATTAAAAAAAAAAAAAAAAAA
  3   1   2       add Gas8      in                          st70o12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCACAAGCAACCNGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTNTGCTGACTTCTTAATAAACAACCCCCCCCCAGTAAATATGTACTCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAACGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATGCGNGTTNTCCCCTTCTANANNATGTGTGATTG
  3   1   4      seed Gas7      in                         XZG45147.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAGCAACCAGCCCGGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTTTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTTTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATTTATACCCAGGCCTTACTTTAATGATGTGAGGAGTCTATTTTTTTTTTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTGGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTTTGCATTTTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTTTTTTTTTGGTTTTGCCCAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTCCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCCCTTTTTTTTTGTGTTATCCCCTTTTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTAT
  3   1   3        nb Gas8                                  st31l21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACTTCTTAATAAACAACCCCCCCCCAGTAAATATGTACTCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGNGAGGAGTCTATTATTCTANTATGTGAGNGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAANGATGGTAGAATCTGAAANCGTTATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTNTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAACGGTGNCTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACCTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCCTGTTCTGCAGCAATGT
  3   1   2       ext Gas1      in                     NISC_mq09b10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCTTAATAAACAACCCCCCCCCAGTAAATATGTACTCCCCTCTCCCTAGTTTAATCTATACCCAGCCCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGGGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTTTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAACGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTTTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATTTTAACCTTTTTATGTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG
  5   1   3        nb Gas                            TGas129p15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGGGGGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAACGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGTAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas                            TGas027a10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                NAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAACGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAACGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCA
  5   1   3        nb TpA                            TTpA078b12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGAGTCTATTATTCNTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCA
  5   1   3        nb Gas                               TGas006k15.sp6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCGGGCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAACGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGTaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  5   1   2       ext Tad5                                  XZT8782.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCTTTCCATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTACCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGTaanaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  5   1   2  SIG                                      Xt7.1-CABK2143.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGCTGTCCTGCCTACTCCGTCTCCGTAACCCCTCGCAATTGTTATGACGTTGCTGTTTAGGGATCTTCTCCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGATGTGTCACACTTGCACTTTTATGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAAATATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGAATGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTATCCAATTATTATTGGTGTTATCCCCTTTTATAGAATGTGAGATTGCAATGCTTATAATATACCCGCTCTGTCCCTGTTGTGCACGATGTTAAGTGTATTCATTCAAGGGGAGGAAATATAAATATATAACTCTT
                                                  Xt7.1-CHK-1008287008                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCTGCCTACTCCGTCTCCGTAACCCCTCGCAATTGTTATGACGTTGCTGTTTAGGGATCTTCTCCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGATGTGTCACACTTGCACTTxTxxGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAAATATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGAATGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTATCCAATTATTATTGGTGTTATCCCCTTTTATAGAATGTGAGATTGCAATGCTTATAATATACCCGCTCTGTCCCTGTTGTGCACGATGTTAAGTGTATTCATTCAAGGGGAGGAAATATAAATATATAACTCTTTTTATG
  5   1   2       ext TbA       in                   TTbA063a07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGCTGTCCTGCCTACTCCGTCTCCGTAACCCCTCGCAATTGTTATGACGTTGCTGTTTAGGGATCTTCTCCATCGCCAAATGGCTCTGTGTGTTTCTGTAGTTCTGCGATGTGTCACACTTGCACTTTTATCAACCTCCCTGTGCGTGGGGGGCTGCACAGCATTGCTCCTCCCCCCGCCTCT
  5   1   4      seed Spl1      in                         CABK2143.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTTCATCGCCAATGGCTCTGTGTGTTTCTGTAGTTCTGCGTGTGTCGCACTTGCACTTTTATCAGCCTCTCAAGGTGCGTGGGGGGCTGCACAGCATTGCTCCGCCCCCCGCCTCTGAAGAGGCCAATCAGCTGGGAGTTTCAGTAACTGCCGGCTCATTAGTGTGTGTGCATTGGCTGCATCAATGTGTTTATAGGTTAATTTGTGTATTTGTGCAAATGCTTGTGCCCCGCTGCTGCATTATGGGTGAGATCCTTATTTTATATTATTTAGCCCCCTTGTTGAAATGATATTTTTATAATCTCCCTTGATTTCTTTGTTTATAAAAACAACAAAATATGAATCAAAATCCAGGAACCCAAAACCCTGAGAAGAACATTTATCTGTGCTTGTTCCTTACAGAGTAGTGATGCATGGGGCGGCCCCAAACCTGCAGGACCCATGGATTTACCTGTTGGTTAGACATGTTTGGTCCAACCAATTGCCCTGAAGGCGGGCTGTATTTGCCATCAGCCTTTCCCTGTTCTCTCTGTCAGCCACACTAGTAATGGGGCGGTGCTTATGTTTATACTTGCGCTTGCCCCGCCCCTCTGGAGATGGGACAGGCATATAAATTGGTGTTGCCGGCCAGGTATGGGTTGGGTTAGGGTTGGCCATGGTTCAAGAAATCAGTGACTGGTACATAGCAATAACTAGCTATATATTCAAATGCCAGCAGGGGGAGCACCCCAACCCAATGTACCCATAAAGCTGCCATTATTTATATACATGTGCCTGACCAACCCATCTCTGATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCT
  3   1   4      seed Spl1      in                         CABK2143.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATGAGGAGGCAGACTGTGTGACTATATAAATAAGTGGCTGTCCAATTGGGGTCTCGCTAATATTTGGCCTGCCCACCACCCGCTAAAGATATTATTTGCTGAAACTGTTGGACAGTTGGGTCGACCCACACATTACTACTGCCAAGCCACCCAGTACCAAACTGATTTGCTATTGGACTCACAAGCAACCAGCCCTGTTCATATATGTAATTCATAGAGCAATTCCAGTTCAAGAAAATCATATTTTCTTTCAAAAAGTAAAAGCACTTCATCTGGTTTTGCTGACTTCTTAATAAACAACCCCCCCCGAATAAATATGTACCCCCCTCTCCCTAGTTTAATCTATACCCAGACCTTACTTTAATGATGTGAGGAGTCTATTATTCTATTATGTGAGTGTTATTTAGCGATGATTTGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATCTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAATGGCCACTTTCCCTAAATACGCCATGTTTTCTGCATTCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAATTATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGACTGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTCTCCACTTATTATTTGTGTTATCCCCTTCTATTGAATGTGTGATTGCAATGCTTATTATATACCCGCTCTGTCCCTGTTCTGCACAATGTTCTGTGTATTCATTCAGGGGAAAAATAAAATCTTAACCTTTTTATGC
  3   1   2       ext TbA       in                    TTbA063a07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAATAAATAAGTACCCCCCTCTCCCTAGTTTAATGTATACCCAGACCTTACTTTAATGATGTGAGGAGTTTATTATTCTATTACGTGAGTGTTATTAAGCGAGGATATGATCCCGTGTGCCCAGTTGGGTATAATAGATATGATTTATCCCTTTCCAATGATGGTAGAATGTGAAAACGTTATATATATATATATATTTAGTTAGTAGTTCCAGATTGCCATTGGCCTATAAAAGGCCACTTTTCTTAAATACGCCAAGTTTTAGGCAATCTGTTCATTGGAACAAGTTTGTAATAAGAAAACAAAATATTTATTTTTTTGGTTTTGCACAGTTTCAAAATGAGAACCCAGCTATTCCCATAGCTATACCCAATGGTGAATGCCAGGGAAAGTAGTGTTCCCATTGGAAGAGTATCCAATTATTATTGGTGTTATCCCCTTTTATAGAATGTGAGATTGCAATGCTTATAATATACCCGCTCTGTCCCTGTTGTGCACGATGTTAAGTGTATTCATTCAAGGGGAGGAAATATAAATATATAACTCTTTTTATGTAAAAAAAAAAAAAAAAAAAGCG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)