Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 80%

 1012076145 Xt7.1-CAAO9043.5.5 - 27 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAO9043.5.5 GCAGGCTGGTGCCACACAGTAGCCATTACTAACGGCTCTGTAACAATACAGCATTGGGCCGGAGGAGGGCGCCACTGAGGGGCCCAGTTTATACAGGAGACGCTGCCCGTTGCTGAACGCTCAGTCAGGATGAAAACAAACCGGCCTTCCTAGATTTTCTCCCCTATAATAACATCGTGCATCATTTTTACTGGGCAGGCAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGTCGGTTTGATAAATAAAACTTCTGTTCCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCA
                                                  Xt7.1-CHK-1008228874       TGGTGCCACACAGTAGCCATTACTAACGGCTCTGTAACAATACAGCATTGGGCCGGAGGAGGGCGCCACTGAGGGGCCCAGTTTATACAGGAGACGCTGCCCGTTGCTGAACGCTCAGTCAGGATGAAAACAAACCGGCCTTCCTAGATTTTCTCCCCTATAATAACATCGTGCATCATTTTTACTGGGCAGGCAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGTCGGTTTGATAAATAAAACTTCTGTTxxxxxxGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTT
                                                      consensus depths      2     2     2     2     2     2     2     2     2     2     2     2     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     7     6     9     6     9     7    14    16    17    17    19    19    20    20    21    21    22    22    23    22    24    22    24    22    24    22    24    22    24    22    24    22    24    22    24    22    24    22    24    23    25    23    25    24    26    23    26    23    25    24    26    24    26    24    26    23    26    24    26    24    26    24    26    23    26    24    26    25    26    25    26    25    26    25    26    25    26    25    26    25    26    25    26    25    26    24    26    24    26    24    26    24    26    22    26    24    26    24    26    23    26    23    25    23    25    23    25    23    25    17    24    20    23    10    16     9    16    10    16     9    13     9    10     8     9     5     8     7     8     6     7     4     7     4     7     2     3     2     2     2     2     2     2     2     2
  5   1   2  SIG                                      Xt7.1-CAAO7948.5 GCAGGCTGGTGCCACACAGTAGCCATTACTAACGGCTCTGTAACAATACAGCATTGGGCCGGAGGAGGGCGCCACTGAGGGGCCCAGTTTATATAGGAGACGCTGCCCGTTGCTGAACGCTCAGTCAGGATGAAAGCAAACCGGCCTTCCTAGATTTTCCCCCCTATAATAACATCGTGCATCATTTTTACTGGGCAGGCAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGTCGGTTTGATAAATAAAACTTCTGTT
  5   1   2  SIG                                      Xt7.1-CAAM5381.5                                                                      CGCCACTGAGGGGCCCAGTTTATACAGGAGACGCTGCCCGTTGCTGAACGCTCAGTCAGGATGAAAACAAACCGGCCTTCCTAGATTTTCTCCCCTATAATAACATCGTGCATCATTTTTACTGGGCAGGCAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTAGTCTGATAAATAAAACTTCTGTTTATCTGAAAAAAAAAAATCTGTCAATAGCTCATGTCGTCCATTGTGGAGTTATCTCTGAATCT
  5   1   2  SIG                                      Xt7.1-CAAO9043.5                                                                                                                                                                GGTAGAGGGGCGGGGCCAGCAGTGACATTTATAAAGGGAACAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGTCGGTTTGATAAATAAAACTTCTGTTTGT
  5   1   2                                            Xt7.1-XZG6279.5                                                                                                                                                                                                                                                                                                                                                                                                    TCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGAGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGC
                                                                   VAR                                                                                                                                                                                                 GTAGTAACAGGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCTCTAGTCTGATAAATAAAACTTCTGTTTATCTG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --T---------
                                               BLH ATG     256      55 
                                               BLH MIN     253      14 
                                               BLH MPR     166      14 
                                               BLH OVR     256     359 
                                               CDS MIN     256       4 
                                               EST CLI     182       4 
                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dm ==== 2e-013     NP_001034051.1 CG33977-PA [Drosophila melanogaster] =================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                       PROTEIN === Mm ==== 4e-030     NP_081043.1 dolichyl-phosphate mannosyltransferase polypeptide 3 [Mus musculus] =====================================================================================================================================================================
                                                                                                                                                                                                                                             PROTEIN --- Hs ---- 3e-031     NP_061846.2 dolichyl-phosphate mannosyltransferase polypeptide 3 isoform 1; prostin 1;dolichol-phosphate mannose synthase subunit 3; dolichyl-phosphatebeta-D-mannosyltransferase subunit 3; mannose-P-dolichol synthase subunit 3[Homo sapiens] ==============================================================================================
                                                                                                                                                                                                                                                                                                                                       PREDICTED = Xt ==== 1e-047     AAH84190.1 Hypothetical LOC496471 [Xenopus tropicalis] ==============================================================================================================================================================================================
                                                    Xt7.1-CAAO9043.5.5                    TAG------------------TAA---------------------------------------------------------------------------------------TGA---------------------------------TAATAA------------------------------------------------------------------------TGA---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------TGATAA
                                                                   ORF                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                               ]
  5   1   2  SIG                                      Xt7.1-CAAO7948.5 GCAGGCTGGTGCCACACAGTAGCCATTACTAACGGCTCTGTAACAATACAGCATTGGGCCGGAGGAGGGCGCCACTGAGGGGCCCAGTTTATATAGGAGACGCTGCCCGTTGCTGAACGCTCAGTCAGGATGAAAGCAAACCGGCCTTCCTAGATTTTCCCCCCTATAATAACATCGTGCATCATTTTTACTGGGCAGGCAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGTCGGTTTGATAAATAAAACTTCTGTT
                                                  Xt7.1-CHK-1008294570       TGGTGCCACACAGTAGCCATTACTAACGGCTCTGTAACAATACAGCATTGGGCCGGAGGAGGGCGCCACTGAGGGGCCCAGTTTATATAGGAGACGCTGCCCGTTGCTGAACGCTCAGTCAGGATGAAAGCAAACCGGCCTTCCTAGATTTTCCCCCCTATAATAACATCGTGCATCATTTTTACTGGGCAGGCAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGTCGGTTTGATAAATAAAACTTCTGTTTGTCTG
  5   1   4   14 seed Te4  5g3  in                         CAAN4283.5p GCAGGCTGGTGCCACACAGTAGCCATTACTAACGGCTCTGTAACAATACAGCATTGGGCCGGAGGAGGGCGCCACTGAGGGGCCCAGTTTATATAGGAGACGCTGCCCGTTGCTGAACGCTCAGTCAGGATGAAAGCAAACCGGCCTTCCTAGATTTTCCCCCCTATAATAACATCGTGCATCATTTTTACTGGGCAGGCAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGNGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGC
  5   1   2   30  ext Te1  5x3                            CBWN15868.b1 GCAGGCTGGTGCCACACAGTAGCCATTACTAACGGCTCTGTAACAATACAGCATTGGGCCGGAGGAGGGCGCCACTGAGGGGCCCAGTTTATACAGGAGACGCTGCCCGTTGCTGAACGCTCAGTCAGGATGAAAACAAACCGGCCTTCCTAGATTTTCTCCCCTATAATAACATCGTGCATCATTTTTACTGGGCAGGCAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAAATGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTG
  5   1   3        nb Te5                                  CAAO7948.5p                                                                 GAGGGCGCCACTGAGGGGCCCAGTTTATATAGGAGACGCTGCCCGTTGCTGAACGCTCAGTCAGGATGAAAGCAAACCGGCCTTCCTAGATTTTCCCCCCTATAATAACATCGTGCATCATTTTTACTGGGCAGGCAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCA
  3   1   4      seed Te4  5g3  in                         CAAN4283.3p                                                                                                                                                                     TATAATAACATCGTGCATCATTTTTACGGGGCAGGCAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGTCGGTTTGATAAATAAAACTTCTGTTTGTCTG
  5   1   2  SIG                                      Xt7.1-CAAM5381.5                                                                      CGCCACTGAGGGGCCCAGTTTATACAGGAGACGCTGCCCGTTGCTGAACGCTCAGTCAGGATGAAAACAAACCGGCCTTCCTAGATTTTCTCCCCTATAATAACATCGTGCATCATTTTTACTGGGCAGGCAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTAGTCTGATAAATAAAACTTCTGTTTATCTGAAAAAAAAAAATCTGTCAATAGCTCATGTCGTCCATTGTGGAGTTATCTCTGAATCT
                                                  Xt7.1-CHK-1008294568                                                                            TGAGGGGCCCAGTTTATACAGGAGACGCTGCCCGTTGCTGAACGCTCAGTCAGGATGAAAACAAACCGGCCTTCCTAGATTTTCTCCCCTATAATAACATCGTGCATCATTTTTACTGGGCAGGCAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTAGTCTGATAAATAAAACTTCTGTTTATCTGAAAAxxxxxAATCTGTCAATAGCTCATGTCGTCCATTGTGGAGTTATCTCT
  3   1   4      seed Te3  5g3  in                         CAAM5381.3p                                                                      CGCCACTGAGGGGCCCAGTTTATACAGGAGACGCTGCCCGTTGCTGAACGCTCAGTCAGGATGAAAACAAACCGGCCTTCCTAGATTTTCTCCCCTATAATAACATCGTGCATCATTTTTACTGGGCAGGCAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTAGTCTGATAAATAAAACTTCTGTTTATCTG
  5   1   4   14 seed Te3  5g3  in                         CAAM5381.5p .....................................................................CGCCACTGAGGGGCCCAGTTTATACAGGAGACGCTGCCCGTTGCTGAACGCTCAGTCAGGATGAAAACAAACCGGCCTTCCTAGATTTTCTCCCCTATAATAACATCGTGCATCATTTTTACTGGGCAGGCAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTAGTCTGATAAATAAAACTTCTGTTTATCTGAAAAAAAAAAAAAA
  3   1   3        nb Gas8 5g3  in                          st41l06.3p                                                                                                                                                                                                    GGAACAGGTAGCCACATACCCCGGGACACGTTGGCTCNTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGNTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGACCCAATGGGCAGGGTTCTCT
  5   1   2   32  ext Gas7 5g                              XZG50018.5p .........................................................................................................................................................................................................GGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTAGTCTGATAAATAAAACTTCTGTTTATCTGANAAAAAAAAAAAAAAA
  5   1   3        nb Gas8 5g3  in                          st41l06.5p                                                                                                                                                                                                                   ATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTAGTCTGATAAATAAAACTTCTGTTTATCTGAAACAAAAAAAAA
  5   1   3        nb HdA  5g                        THdA033b22.p1kSP6                                                                                                                                                                                                                             ACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTAGTCTGATAAATAAAACTTCTGTTTATCTG
  5   1   2       ext HdA                            THdA033b16.p1kSP6                                                                                                                                                                                                                                                                                   GGCTACTGGCACTGACTGTCCTGGGGGCCGCCTGGGTTACCCGGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAACTCCTGTGGACCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCACTCAACGACTGCTATGATGCAGCCCGGGAACTGCAGCAGCAAATCATCGAGGCAAATATAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCACCCCCAGTACCGACCAACGTGGCACCCAATGGGCACGGTTTCTCTGGCGCCCCCAGTACAGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGACACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACTGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTAGTCTGATAAATAAAACTTCTGTTTATCTGACAATTGTCAATCTGTCAATAGCTCATGTCGTCCATTGTGGAGTTATCTCTGAATCTGTG
  5   1   2  SIG                                      Xt7.1-CAAO9043.5                                                                                                                                                                GGTAGAGGGGCGGGGCCAGCAGTGACATTTATAAAGGGAACAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGTCGGTTTGATAAATAAAACTTCTGTTTGT
                                                  Xt7.1-CHK-1008294574                                                                                                                                                                      GGGGCGGGGCCAGCAGTGACATTTxxxxxxGxAACAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGTCGGTTTGATAAATAAAACTTCT
  5   1   1           Tad0 FL                     IMAGE:6985928.FL-MGC                                                                                                                                                              GGCGGGGCCAGCAGTGACATTTATAAAGGGAACAGGTAGTAACAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGTCGGTTTGATAAATAAAACTTCTGTTTGTCTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas8 5g3  in                          st53g14.3p                                                                                                                                                AGGGCTCGAGTGATGAGGTAGAGGGGCGGGGCCAGCAGTGACATTTATAAAGGGAACAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGACCCAATGGCAGG
  5   1   2       add Tad0 FL                            IMAGE:6985928                                                                                                                                                  GAATTCCGGGATGGCGGGGCCAGCAGTGACATTTATAAAGGGAACAGGTAGTAACAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGNGACCCNATGGGCAGGNTTTCTCTGGTCNGTTTTGATAATAAACTTCTGTTTGT
  5   1   2       ext Gas8 5g3  in                          st53g14.5p                                                                                                                                                                GGTAGAGGGGCGGGGCCAGCAGTGACATTTATAAAGGGAACAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACNGACCAACGTGNGACCCAATGGGCAGGGTTTCTCT
  5   1   3        nb Te5                                  CAAO9043.5p                                                                                                                                                                                       CATTTTTACTGGGCAGGCAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGTCGGTTTGATAAATAAAACTTCTGTTTGTCT
  5   1   3   10   nb Spl2 5g3  in                       CBSS10411.fwd ......................................................................................................................................................................................AAGGGAACAGGTAGTAACAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGAC
  5   1   2       ext Te5       in                         CAAO2777.5p                                                                                                                                                                                           GAACAGGTAGTAACAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCTCCAGTAC
  3   1   2       ext Te5       in                         CAAO2777.3p                                                                                                                                                                                            AACAGGTAGTACCAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGTCGGTTTGATAAATAAAACTTCTGTTTGTCTGAAAAAAAAAAAA
  3   1   4      seed Gas8 5g3  in                          st61g12.3p                                                                                                                                                                                                CTAAAGGGCACAGGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGCAGGGTTCTCNG
  5   1   4      seed Gas8 5g3  in                          st61g12.5p                                                                                                                                                                                                          GGTAGCCACATACCCCGGGACACGTTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGNGACCCAATGGNCAGGGTTTCTCT
  5   1   3        nb Gas8 5g3  in                          st62g12.5p                                                                                                                                                                                                              CCACATACCCCGGGACACGATTGGCTCCTGCGCTGGCACTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAATGTCCTGGGGNCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAA
  3  -1   3        nb Ski1      in                         CABJ8284.3p                                                                                                                                                                                                                                              AGAGGCCTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCT
  5  -1   3        nb Ski1      in                         CABJ8284.5p                                                                                                                                                                                                                                                    CTGACATCCCACCATGACCAAGCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCT
  3   1   3        nb Spl2 5g3  in                       CBSS10411.rev                                                                                                                                                                                                                                                                         GCTGGCAGAGTGGCTACTGGCACTGAGTGTCCTGGGGGCCGCCTGGGTTACCCTGAACTTTAACTTGCTGGGCTTGGATCTGCCCCCGCCCCTCCAGCAGCTCCTGTGGCCCCTGCCTGTTTATCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGATCAACGTGGCACCCAATGGGCAGGTTTTCTCTGGCGCCCCCAGTACGGACCAATGTGGGACCCAATGGGCAGGGTTTCTCTGGTCGGTTTGATAAATAAAACTTCTGTTTGTCTG
  3   1   3        nb Gas8 5g3  in                          st62g12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                  GNCCACCATTGGNTANNGNGTGGCAACNTTCAANGACTGCGAGGATGCGGCCCNGGAACTGCAGCAGCAAATCAGNGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTNTGATTATTCCTNTGGGCACNGGCGCCNCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCANTCGTGGCATCCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAATCGTGGGACCCAATGGNCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAATCGTGGGATCCCAATGGCAGGNTT
  5   1   2                                            Xt7.1-XZG6279.5                                                                                                                                                                                                                                                                                                                                                                                                    TCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGAGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGC
                                                  Xt7.1-CHK-1008294572                                                                                                                                                                                                                                                                                                                                                                                                          GGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGAGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCC
  5   1   4      seed Gas7      in                          XZG6279.5p                                                                                                                                                                                                                                                                                                                                                                                                    TCTGCTGGTCGTGTTTGGCTGCTACTCTCTGGCCACCATTGGCTACCGCGTGGCAACCTTCAACGACTGCGAGGATGCGGCCCGGGAACTGCAGCAGCAAATCAGCGAGGCAAAGAGAGACTTGGCCCTGAAAGGCCTGAAATTCTGATTATTCCTCTGGGCACCGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGAGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTAC
  3   1   4      seed Gas7      in                          XZG6279.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTTTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGCACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGAACCAACGTGGGACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGTACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGTACCCAATGGGCAGGGTTTCTCTGGCGCCCCCAGTACGGACCAACGTGGTACCCAATGGGCAGAGTTTCTCTGGTCGGTTTGATAAATAAAACTTCTGTTGTCTGAAAAAAAAAAAAAAAN

In case of problems mail me! (mike.gilchrist@crick.ac.uk)